XLOC_024544 (gene) - C. hemisphaerica

Overview
NameXLOC_024544
Unique NameXLOC_024544
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0002412:625..1187+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_024544 ID=XLOC_024544|Name=XLOC_024544|organism=Clytia hemisphaerica|type=gene|length=563bp|location=Sequence derived from alignment at sc0002412:625..1187+ (Clytia hemisphaerica)
TCAGGTTAATTGAAAAGAGAGTCTTTGCCGGCGCCCTAGTAAACGCCCGT TACACCCTGTCAGTcgtactctaaggtcccgaatagacgtcccccccccg cttattaattttcgaaaatatttcggACCCGCCcgttcttattaggaccc cccgtttattagtttttaagaatattttcagctgtcaaagagaaggaccc ttattttgctctaaatagcctgattttagcctttatttacctaaatattt tcagacccccccgtttattcagagccccccgtttattatattttgcaaaa atttcggacccccccttttattcagaccccccctactattcgggacctta gagtatgcGTTCACCAGATCTACTTTGACCAGAAAGTCTGGGTTCTAAAT TTAGCCGACCTCGTGCGTGGTCTCATATATAAAATACCTCAGTCTCTAGT AACGCTTCTTTCGAACATCGTCAGTCTTGGTTACTCAAAGCAGTCatgaa gatatttgtttttataaatctcACAATTCTAACCTTGTGCTTGGCTGATC CTTCGGGTTCGAG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00040388TCONS_00040388Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0002412supercontigsc0002412:625..1187 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.8 0 0.1 1.09 0 0 0 0 1.92 2.72 0.59 2.28 0.3 1.64 0.72 1.2 4.36 3.13 2.93 2.64 2.65 0 0 0.57 1.4 0.66 0 0 0 0