Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000749 (gene) - C. hemisphaerica

Overview
NameXLOC_000749
Unique NameXLOC_000749
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000010:243650..358078-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000749 ID=XLOC_000749|Name=XLOC_000749|organism=Clytia hemisphaerica|type=gene|length=114429bp|location=Sequence derived from alignment at sc0000010:243650..358078- (Clytia hemisphaerica)
TAGACGGTTTTATAATAAAAGATGAAAAATAATTAATGTGATGATTATTT GGAGTAATGATGGATGAAAATAGCTCCCAAGATCTTTGTAAGTATTTGAA TTTTCTCTACTATTCCTTTATTCAAAATTTAATTATGTCTTTCAATACTT TTGATATTTTATCTAGTACTCTTTTCTCTGCAGAATTGTTGTCAAGCTAA AATGTCATCAATATTTTTACGTCAAATTTTGTCAACAAACTTGAGTATCT TAGTGTTACATTGGCTGAATTGAAAATTAACTTTCTGTTACCATCAACAA CAAGCAGAAAATAATTTTCATGATTCAAACCCTGAGAGTTCTATCTAATC ACTTTTATTGTATTTTTACAAACTAAAAAACATTGTAGATCTTCCTGAAA GAAGTTCTTTTAAAGGCAACAAAATTGTTAAATATCTCACTCGAATGACA ACTCTTCTTTCTAGTAAAGAAATTGTGTTAAACTTCTTCTCCTGAATAGG AGACTTGTTTTACATGCAGTTGCAAACTTTCTTATGATCTTTATTTTTAT AAGTAATTCGAAAAATAAGCAGCTAAACAAATGTTATTTGTTCTTTGAGA GATAAGGAAGTTTGAATATTAAAAGTTTCATCAAATCTCTCTTATGGAAA CATGCAAGCCAACTCATGATAATTTTTGAACAATGAAGCATATAAAAAGC TGGTTTTCTTTCCAAGAAAGTGAGTTTCTTTCGCTTAAATATGTAGAGAA AAATACCAAGATAGGAAGATTTACAAGTAGTTTTTATGAAGAATAAAATT TGATTTTGTTTTTTAGACGTGACAAGACAGAAACTAGTCGTGGTTAAAAG GTAATTGAGTTATATGGTCATAAAATCAGATTTTCATTGACCTTAGTTTA AGTCTCCCGGGACCTTTTAATCTAATCGTGCCTCGTCATGAGGCTGAATC ATCGATATAAAGGAGCTTTGGTATAAATATTTCTAGTTGTCTTCAGAATA ATTTAGTCTATTTCCAGCTATGTTGTCTAAAAGGTTTCACGAGAAATATG GAGGGCTTCGTGTATTGCAAACAAAAACTATGGAAATTCAAACTGAAAGA CTTGTCACTCAAGAAAGTTATACTGTTACTAAATTGCAAATCAGTCCTTT TAAATTGGTTATTGGAAAAGATACTCAAGTAAACAACAGCTTTGTTGTTA AGACAACAAAGAAGATTGCAGCTTTTGATGAAATAGGCAGAAAAGTTGCC AAGCCAGATGAACGTTTTACTTTGAAGATTGATCCCAATAGAAAAATCAT CAAACGCCCTAAAGTTGCAGACTATATCTTTTTTGCACCAATCAAATTCA ACCAGCACGAAGATATTATAATAGAAAAGGCCCAAGAGTTTAAAGAGACC ACCAAAACACAGATTGACGAAAATCAGAACCAACTAGCTTGTCATTCTTT GGCGCATTTAGACTATCATAAGTGGTCTTTTCGGGCTAGTTCAGCTAATT TGTGTTGTATTTGCACAAAGTATAGTAAGCAAACATATATTACTGTTAAC ATTGTTTTGATTCTTATTATTGAAAAACTTTACTTTGTGTCTTGAGGTAT GAAAATGAATGAATATTGTAGCCTGATGAATACCTCATTACACGAATATT ACTAGGCAAGTATTCAACGGCCTTGAAATTACACGCAAAAAATTAACACG AATTTAATTTGCTTTTTCAAGGACAACACGGCTGGTTTTAATTGAGGGAG TTTCTGTTAACACGAAATTTTTCAATTTGTGTTAATAAAATGACTAGTAA TATTCGTTAAATAAGGTAAGTTATTGCTAGGGATTTTTAGTTTCTTTGCT TTTCTTAAAAATTGTTATTTTCACCTCAATTAGATGAACGATCAGACACC CAAAAGAAGACCTTCACCAGATGGATCAATCATATTTTGAAAAAAGTATC CTTTTGTTTTGAATTTGAAATATGTTATATTTCATANTACTGTTAACATT GTTTTGATTCTAATTATTGAAAAACTTTACTTTGTGGTATGAAAAGGAAT GAATATTATAGCCTGATGAATACCTTATTACACGAATATTACTAGGCAAG TATTCAACGGCCTTGAAATTACACGCAAAAAATAACACGAATTTAATTTG CTTTTTCAAGGACACCACGGCTGGTTTTAATTAAGGGAGTTTTTGTTAAC ACGAAATTTTTCAATTTGTGTTAATAAAATGACTAGTAATATTCGTGAAA TAAGGTAAGTTATTGCTAGGGATTTTTGGTTTTTTTCTTTTCTAAAAAAT TGTTATTTTCACCTCAATTAGATGAACGATCAGACACCCAAAAGAAGACC TTCACCAGATGGATCAATCATATTTTGAAAAAAGTATCCTTTTGTTTTGA ATTTGAAATATGTTATATTTCATATGTATGTGAAGAAATTCATAGAATTT CTGTCCAACTATCTGCATACATACATTATATATTTTTTGAAATGGATTTG GAACAAAATCCTGTAGGCTTCGAATCCAAGAAAATTTACAAAAATGAGAC TTGTTCTTCCATTTGATACAGGTTTTTGAATTTATTCATAGTGATAATGA TTCCTTTTGAAATTTGCAGTAAATATTATTAAATTAGAATTTTATTCTAC TTTTTTAAGCAACTTCATTATTGTTGATTAATGGTTTCTTTTTAAATTTC AGAACGGTAAAAACATTGTGGTTAGGGACTTGACATTCGATTTGCAGGAT GGTGCTGTTTTATTGGCACTATTGGAATCAACAACAGGAAAAAAAATCGT AAAATTAAACTTTCAAAATTACTTTTTTGCAAATAACCTCCTCTTTTCAT TATGAATTTTGTCACTCTTTAGTCATATTTCTGTGGAATTCAACTATAAA TTTCTTTTGAAAGTTTCTCTTTATATAAATGAATTCCTTATCCAACGAAT TTAGCCAACTTTAAATAATTTTTTACTAATCTCTACCTAATTGACTGTCT CAGGCTTCCCATATGGTAGCAGGTATGAATAGCCCGCCATTTTGTTTTCC TATTTTAGTTGTCATCAGAGGGATCGAACTTTTTTGAAATTGAAATTCTA AAAACTGAACTAAAACAGAAAACAACATGGTGGACTCAGTGTGGACTAAT CGACTTAAAATCTAGAAACACTCAATTAATCCAAACACAATTTAGAATTA TTGTACCGGGTGCGCCACAAAAAAGTTTCCCTCTTTGAAACTAATTTTCT CGAAATCTAAAAATTTTAAAAGAACCATTCCTATTTCATTGGAAAGAAGA AAGATAGACTTAAATTTTGATNACTTTTCTTCTTTTCAATAAAATAGGAA TGGTTCTTTTAAAATTTTTAGATTTTGAGAAAATTACTTTTAAAGAGAGA AACTGTGTGTTTTGTGGCAAAATGAAATGAAATTGTGGCACACCCGGTAT ATATAATGAAAATAGGATTATATCTTTTTTTAAACTATATATGTTTCAGA AACAAGAAAATGGAAGAATGCGTGTACACAAAATTAGCAATGTTAACAGA GCATTGCAAGTATTCCAAGGGTATGATGTAAGTATTANCCAATTATGTCC AATTGAATAAAAATGTTACTTTCAGAAAGTGCTCGAAAACGTTAAAAATC GACCTATCAAATTTTTACTTTAAATTTGGCAATCGCAATAGCCTNATTGT TTACAGTTGAATTTTCTCCCAAGTTCCTCTTGCCGCTGGGTAGCTTGCAG CTGCAATCCAACCGGATCCAATCCGTCAAAGCAATATTGGTTAATCTGAA CTGATAAGTAACTGAAAGCATTGGTCCCTAGTCTATGGTTTAGCGCAAGT AATTAGTTTTGAATTAGAATTTGAGAACGTAGTCATGCACAATCTGATTG CTACCTATTCCATAGGTATATACCTGAGGATCTAGGAGGGTATACCCGAG GGTATTGGAGAGGGCGCCACTCATTTCCCTAGATTTCTCTACTTACCCTT GATTTGTCTGATTAGTTGCTGAGCATCAAACAGAGAGACATCAAGTGTCA TTTTGGGAATTTTTGGTATGACCTGGCCGGGTGTTTAAGTTTCTCCCTTG TGCACTATAGCTAGATCATCTACCTTCATACTACAGTCAGTCTCCCAATT AACATTTTTAGTCCCTTAAGGGAAGAAATTTTTGTGGAATTTAATTTTGC GGTTCACAGCTCAAAATTCGGAAATTTCACGGAATTTAATTTTGCAGTTA AGAGGATTTTTTGTTTACACAATGTCCTATTTTTCCCTAAAACGACCAAT TTTAGAGGTGGTTTTTTTAATTCTGAGATTATTCGTGTTTCGCAGAATTT AATTTCGCTGATTTGTCAAAACACTGCGAAATTAAATTCCGTAAAAATAT CTTCCTGCAAAGATTTTTTTCCTTATAAGGTAATGTTTTTTTTCTGGTAT CTCAAAGTTTTATTTTATCATATTTTTCATTATCTTTCTTCAGACAAAGC TGGTTAATATAAGAAGCGAGGAGATTGTGGATGGTAACATCAAATTGATT CTTGGCTTAGTTTGGAGCATCATCCTACAGTTCCAGGTATAAGGTTTTGA AATCTAATGGAAATTTCTGTTGATGCTTTCATGGGTATGTTATTTACATG AGAATATTTGTGGTCATNTGAAATTTTTGTCGGTGCTTTCATGGGTATGT TATTTACATGAGAATATTTGTGGTCATTGCTTTTTAAGTGGTATTATCTC CTTAAAGCTTTTTACAAGTGGAAAATAAACACAAACTTAATCCCATCCAT GCCATACCTTTTTCAAGTGGCGATAATATATGTTTTTCTAATAACAAATA CCTTATGTAGACAGATGTGGAGAGTTTTGTCGTGTGACTATTTGGAGTGG TCTCTATTTTTGGAACCTTTTTGAATTGAAGTGGTATTTCCATTAAAAGA GCCTCAAAGTTGATCAAATAATGAAGCCTTAAAGTTGATCAGATAATGAA ACTTCACATTACTTCCAAAAATCAAAAAATAATCCTACAGTCTACCAACA AGGAGTAGACTATATTTAAGATCTTTAAGCTCGGGCTATCATAACCAGTT GAGCATTTTCTCTAGTATTACATCGAAAGTACAAGCTCGAATAAAATTCT CATGAAATGCAATACTAATAAATAATCAAATAATGACAAACTTCAGCCTA TTATACAAAACTTTATTACTCTCCAATAAAATCTAGACTTAAATATTACC TTGATTGAATAGCAACAAGTGAAACACCTTACCAATGATAAAAGAGTCTG GACTTGTGTCTTGTTTGAATTGTAACAAAGTCTCTAGAACACAGCTGTTA GTTCAGAGGTCCTCCTTTAAATCAATACCCCAATTTGCATCATGCATCCT TGCACACAGGCATGTTTTAAAAGGTGTCCATCCCCTCTCTAATGATTACT TTATTAAAACTATAATAAATTTTGTGATTAGATATTTAAAAGTATTTCAC ACGTTTTTTCATAAGAACAAACCATTTAACATTTTTAGGCCTAGAACTCA AAAAGTTTAAGAACATCTGAGAAAAATTTAGGATGTTCTTATAAAAAACG TGTAAATGTTTCACTTTATTTTTTAAGGACAGTTTTTTTTCTGCAAATCC TTTTTTCTACAAACAAGAGTAATACACATGTTACACCACTTGTATGGCAA TACCAATTTTTTTTGTGACTTCCCCTTCAAACACTATTAAAAAACATTAC TTATCAAACTGTGAATACATGTTTCAAAGAGAAATCTGTCCTTTCGTTAC CATACACGTTTTTCATAAGAACAAACTATGTAAGAACATAAGGCTTCGAT GGCCAAAATATTAAGAACATGCTAAGAACATTGGAGTCAAAAATACTAAG AAAATGAGAACATTTTAAAAGAACATTTTTAGGCTTTATGCTCAAAAAGT TAAGAACATTCGAAGGCTTCAAGAAATTTTGGATGTTCTTATAAAAAAAC GTGTGTTTAAAATAAACTTCTTTCAAATTCTGTTTTGTAACATTTTTAAT GTTTTGTTTAATACATTATTAACAAATCTTGCCTCTACTCTCTCTTATAA TAATTCCAACTAAATACATCTTTAATTCTGTTAGTGTTAACAAAAAATGT CATTCTCTTTCTCTTTCTCGTGGCTAGTCATTCTTTTTTCTTGTGTTTTT TTCGTGTTTGTAATCAGTGTTTGCAATGTAAAAAGGAAATTCAATCATAA AGAAATGACTTTCTCCAAACTTATCACATAGTGATAAAAGCAATACAACA TCCTCTTGATGTGAATCTGCTGATGACCCATCTAAGGTAATAAAACTAAA TTTTCCATGTTTTAAAAATGATGGTACAAGAGAGAAAAAAACGACTCCAT TATAAGTTAATTAGCTTCTATTAACTAAGCGATAGCTATTTGATCATTAT TTCCAGTTTAATGAGTATCCCCCTAATCTATGGTATGTTGTTTAAAGAGA AGTTTGTCATTCCTTTTTTCTTATAATTACTCGCATACATGTATAATGTT TCTTGTGTTCTTTTTCTTGTTTGTGGAAGTGTGTGTGTAAAGGGTTTGGT CGTCCATCAGTCTTACTTTAGTGTTAATATAATATGTATGCTAGTATGTG GTATTAGACTTAGAGAGACTCAAAATCAAAGTCAAAATTGAACTTTTTTA CTATTGAAAGATTTTCCAAAGAGAGAAGAGGATGGTAGGTGTTTTTACAT TTGTTTTCCTTACTGTTCCTTAAGCTTTTTGTTTGTTTTGAAGTAATCAT TCAATCACATAACTCTTTTTTTTTTGTTCAAATGAAAACACACTGTCGAA TGTTGACTAAATGTAAACACAGGGTAAGGTTAAAGGAGGCTAAGGATTTG ATCACAAAATGTTTATTCACGATTTGTTTTTAATGCTATAGTTTACTTTC TTTATCTTTTGATTTTTCATCCATGGTCAGCTCATTTACTTGTTAAGATA CCTATCTATCTAATAGTTGAAGGTATCATCACATCATATAAATGCTCTAT TTTTATTCATCCCTAGTAGAGCCACTATTGACTATTTCTTCTTTAAATTC GAACCTATATCACACAGAAATCAAAATTTAATCTTTGCATCTCCTATTAA TTAGGTTACACCTGGTTTCATATTGAAATTAAATTAAAGTTTTCCAGGTA GCCATAATCTGCAATATTTTACGGTATATCATTTAGGGATTCACCAAATA CCTCCCCTTACGAAGTTTTCCAAAAGAAAATTTATCAGTAGATTGTATTT CAATTGCAATATTATAAGCCTGTGAAAATTTTTGGTGTTACCTGAGCCTT TGAAACCTCTTTTTGCTTCTACGCTTTTTTAAGCATAGATACTTCTTTAT ACTAGAGTATGCGTACGAGCTTTTTTTTACGAACTTTTTTTTTGCAACTC TTGTCATGTTTGACTGTTTGTTTTGCATCATAATAAAAAATTGTGTTTTC TTGATTTTTTTTTGTGATTCCATCCTTCTTGTATGGTCGTCTCTCTTGAG CCCCCTATTTTTTATTGAAGGACAGTCGTCATTAAATAGGATTTACTCTT GATGTTTTTTGTTTACAACTTGTTAGAAACAATTTTTTTTTGAAATCTAC ATTTTGAAGGTTTTTTTGAATGTGTTGAAATTCTTGTAGAAAAATCTCAT GGAGTGTGTTGTTTTTAGATTTTGTTGATTATTATACCAACTAGTATGAG TTTGTAAATTTTTTGGCTCTGTGTTTTTTTTGTTGGTTTTATGTATCACT TATGCTGATGTTATGATTGGTTCAACTAGTTCTGTATATTGGAAGTAAAT TGACTTGGTAACAAAGTATGAATCTATTTTCGATTTCTCATTTTCTTCTT TCCTCTTTTAAGCTGTTAGTGGTTGATCTTGTAAGACTATTAGATTTTAG TTCCTGATCTATCAGCTTAAAGACTATTCAAGTTTTTATGTAATAGGCTC CAATCATAAGATTTAACAAAAACCAACTTTGGCAACACTGTTTTAAAACT CCATAGGCCTTCGTATTTCTGTGCACCCTCTCGTGTCCATTGGAAGAAAA TCAACATTTTAAAACTTTTATCATCAACTTCATCATTTTTCAAGGCTCAG AATCTTCCAGTAGTAAAAACATATGCCCTGCCTAAGAACGTTCAAGGAAT TGGTTTGGCCGATCCAATCTCTCCTCTTCGATTTTATAAGGTTCTTTAGT ATATTTTCAGCTATCGAATAATGTTTAAAAGTTTGTTAGTGAATAACCTA CAAGTACATCCTTCTTGTCTTTTAGTAAATTCTTATCCTCTTAAAGTTTC TAACTTGCCCTCTTTTAGTTCAAAACTATTGATTAGAAAATAAGTTTATA CCTTAAGTTTTTAGAGCTTCTTAAATGCAACAAAAACAACATCAAATTTT TGTTGTATGTAACAAGAAGAGTTTAGATTTTTTCAGCTCAAGTATTGAGA GAAGGTGCTAGAATGCTAGAGTCTGTCCTATGGTTACTTTAATTGTCCAG CTAAATCATGTGAGTGCCAAAAGCCTGATTCTAGTTTGAAAAAGAACCAA AATTTTGCTTCAGATTATTTCATGATATTGTCAGGTTTTTTAGATTGAAT ACAGTTCTAGTCTAGGGAATACTATTTCATAATATTTATAAAAAGCCAGG GTACAGAGTTATATACCACGAATGCAATGAAACTACTGGAATTTAATTTT CATGAAGTATGTTTCCTTGACTGGAATCATAGGAATCCATCATAGGAACT TGAAAATAGATTTCACTTCCTGGCACTGTCTTTATAATTGCACAGAAATT ACATTTTAATGGATATTATTAATAACATATTACTTACCTGCTATTTTTAA CACAAGCGTCTTCTTAACTCGAACAAGTTTTCTCGTCCCTTTATAGTTAA CAATGCCTTATAAACCTTATACACTATAACTCGAACAACATTTGTGTTCC CCGTGTGGGTTTCGCCTCAACTGTATAGTTATAACACTAAATAAAGATAA TGAAGACAATGCTCTATACGCGACTCGTTCTCTTTTCTATGTCTCGTTCA GGTGAAAACGGTGATCCAACAAACACTCCATGCCACAGATTCCACCATGG AGGTGGAAAAGACCTTATTACAATGGTGTGCGCACTCTGTTCACAGGTAC CTTATACACCTTTAGACTTGTTTGTAAAAAACTTTTATCTAATACGTCAC TTGCAACCACTGACCTTATTATACCCTTGGACCAAGCAAAATCTTTGATT GGAGTTTCTTGAAAAGTGGTCATACCTTATGTACTCGATGTTCATCAATT TATAATTCAATAAAATTTCCGTTTAAAATTGTTTTCACTCAGATTGAGTA TTGCTACCTACCATTAGGGCACCACTTTCCAAAAGTTCCGATAAAAGATT TTGCTTGGTTGGGATAGAGGTGCTTGCAACCAATCAGCTGTTTTGAAAAT TATATTATAGCAATATTGCATTTCTTGAATAGACTACTTTTGATTTTTTT TATACTGGCTTACTCCAGATAGGCCTTGTTATTTGTTCTTACATGCTTTT TGTCCTGCTTTAAAGCTTAGGTAGTTTTTTAGTCTAACTAAAGCGTAGTT AAGATGTGTTATTTTGTGATTTTTAACAGCTACTTGGCAATGCTCCCCAG AATTGAACAACCATTATTTATTTGTGTACAAAGTATTCTTGCCTCCTTTG AAGTAGTTTCAATCCTTTTACAGTGGATACCAAAGTTGATTCCTCTAAGG TCAAGAAAACTGGCACTACCTGACACAATCTGCAGGAATACCAGCCTCAA ATATTGTGAACTCGTGAGTTCTTAGTGAGACTGTGAAAAGTGACGGAGTA GAGTTGAATTCATCGTCTCGAACGTGGTTGAGCAATGGAGACTAAGGCCA TGTTCAGACGTTACTGTTCCGTATCGTTTCAAAACGAAACGGTTCCGAAA CTAGTGTGAACGTCAAAATTCGAAACATCAAAAAAGAAGATGTTACAAAG TAAAACAGATCGTAACGGCTTTGCTCCACTCTTTACATCGGGACGGAACT GCTCCGTTTTCTTGCTCCGATCCGTAATAGAAACCAATATGAACACTCTC GATCCGTAACAGAAACCATACCGGAACTATACGAAACCGTAACGACTGAA CATGGCCTAAGGTTAAACTACGCAACTATTAATGGCTTGAATATTACCCA CAGATATATACTCCGATTCTGTTGTTTTTCCCATTCTAGATACAAAGATG TAGAGATCAAGAATTTCACTAGCTCATGGAGAGATGGTTTAGCTTTCAAT GCTATTCTTCATCATTTCAAGTAACTATATTTAAAATACGAATCATTTCG CACCTTACTTTAAGTACAGTCGGCGCTCTCTAATTTCAATTTTCAAGGGA GTTTGGATTTTCATCGAATGAGGGAACGCATCGAATAGTAGAGCTTCGTT TATGAGAGTTTCTTATCGACGGTGATTTTCAATATTATCGGATAATGGAT TGTATCGAATAGTAGAACGTCGAATTAGAGAGCGTCATTTGTAATTAGAT TAAAGATTTATAAAGGGTTGGCATGACAGGCTTACATCCCAAGACAGAAA GGTTTTACTTATTTTGTTGGCGTTAAATCATATTTATATGTCGCTAACAA GATCTTGGACCCTAAATAATGAAACTCGTCCAAGACCATGCTTCCCATCA GAACATTTCACAGATGATTTCTTAATAACGCGCCTGAATTTAGAATAGCC TGAAAAAACAGACATCTTAAGGCATAACCATTGAAATGATCTGTGATACA GGATATTTATAAGAACCATCTTTATTTAACCCTATTCGTACTAGGGGGGG GGGGCTCTTTCTGTTCGGAGGTCAAACTATTGGTAATAGGTCCTGAAATA ATAGAGCTTTTGCCTTGAAATTTTCTGTAAATTCCTAACTTTTATTTAGC TTCAAAATAAAAAAAAATTTGACACCTAAAGATTTTCACACCTTCAGCAT GATGACATTTCTGACAGTAAGGTGTCACAAAAATTGACACTTTTCCAATA CAAATTTATTTTTAATGTCAAATATATCGTTGAAACCGTAATTTATTGAA TATTTAGAATATTTAGGATAAAATAAGCATTTTAAACTCAGGCAACTTTT TTCTAAAACTTTTGTTAGAATACAATTGTTATTTTTAAGAACAAAGGAAA TTTCCAGTTTTTGCTCACTTTGGGCATGATGAGTGACGTCATCAAAAAAA TTTTTTGTCAAAAGTTACCTTACGTGACAAGGATCTTGTGTGCCAAATTT CATCCAAAAAGACCCACTAGATCAAAAGTTAAGGGGTGGTACAGGAAAAC CCCCCCCCCCCCCTAGTTCTGAACCGCCCCTAAAAGCCTAGGTTGAATAG GGTTAACTCCCCTAGTCCACAGGCCCAAATATCAGTAGGGAGTTTGCATT AAATCTTAAAATGATTCAGAAGGTTGATTTAGAAAGAGAGAAGTGCTTGT ACACCCGCTTGGCATTATCAATCAGTGTTTGAACAAGTGAATATTGGAAA TGTTTATTAAAAGATAATATTCTATTTTTCTATTCTTTTAATTTTCTATC TAGACCCAACTCTTTCGATTTTCAAAAGTTAGTTGGCAAGCCGGCTAGTG AAAATTTGGCACATGCTTTTGCAAAAGCTCAATCAGAATTCAATATACCA CCATTACTGGAGCCTGAAGGTTTGATTTTTACTCTCTCTCCTTTCTTTCC GTATAAGGGACCATGTTTGAGAAAAAATCTGATGAAAAAATGTTTTGTGG TTGTTGTCTGGATGATAGATTTCTTTCACCAGTACTCTCATACTTTTTTT TTCGTTTCTTCAAGGGGGTCCAAGGTCCGGGCTCCACTTAAAGCTTTTTT TAGTTTTACAGATTTTAGTTGTTTTTGGAAGGTAAAAACAGTATGAAGCA TTGTTTTTATTTGAAAATAAGTGATTGCAAATCTGTTATTGATGTTTGTT TCTCGTTTTTGATTGTCTTTCAACTGCAAGTAACTTTTTTGTTATTTGGA TTTTTAATATTTTCTCTCAAAATGGCAACCTCGCCAAACGCTTCACTGGA CTCAGCGTCATAAAAAATGATCAAAAAGTAAATTCCAACCAAAAGTAGAC TCTAGTCTAGGGGATCTGTGGTAAACCATGTTTGCTTCCTATGAAATGAA CGGAGTAAAACGGAATCGAACCGGGAACCCCTGGTTTGTTGCGTTTGCGC TTTAGACCGCTTACCCGTTACACCTTTTTCATCAAAATCAAAATCTCTAA ATCAAAAATCCTCTGTCCGACTTAGGAAAGAATATATATCGCTGAACAAT CCAAGATCCTTTTACCCAAAGGGTATAACTTCGTTTTCGTTGAATTATTT ATTACTTTATTTGAAGCAAGTATCAATCAATGTATCAAATCAATGCCATA AGAGTGCTCGATTAGTTAAAGAACCAGAGCCATATATCAATATTCTAAGA GTTATCTTCCATTAAAAAACTAAAAATTACATCACTCAGAGTTCCATGCT TACGCACTAATCATATGTACAGTAATGATTGAAAAATTTGAAATTCGACG TAAAAAGTTTAAAAAACTGGATAATTTGTGCAATAACCATTACTTTATTT GTGTAGATGTGAACACGGACCATCCAGACAAGAAATCCATTATAATGTAT GTGACCACGCTTTTTGAGACGCTGGGTAAAACCAAAGAAGGGGCTGAATC GGATGGATCTGAGCTGGATCAGGTATTTTTTCTTTTTTCTTTCAATTGAT CCTCGACCGAAATTTGAAATCATCACTATTCATGATCACTGACCTTTATA TATTCCTGGACCAAGTCACTCAATCCCAGCCTAATAAAAATCTTTGATCA GAGTTTTTTGAAAAGTGGTACCCTAATTGCGGCACTACTCAATAGCGGTG AAAATGCATCGAGAGCGCTAGATCTACTTTTCCTCGAATACTTTTTATGA TGTAGCGCCGTTAGACGTTAATTTTTTGCTGTGCAATGGCTTTTTCTCGG GTACCAATTCCAAAAAAAACTTCGATCAAAGATGGTGGATATAGCTTGGT CAAGGGATATATAAAGGTCAGTGTTCGTGATATGCACCACTGCAATGTCT TCTGACACTACATCACCGACCCAATAGCTGATTGGTTGTATATGACGTAA AATTGATCAATACGTCACTTTCAACCAATCAGCTGTTGGGTCCATGGAAG ACATTGCAATGGTGCATAGCATGAAGTACTCACAGATATCGAAATTTGAC GTCATTTAGCTGTGATACGTTGAGCTTGTGCCTTTGTGTGCATTCATTTA AAAGTAATGTCTTCTATAGCTTATGATTAATGGAGTTAGAAGTTGTTCAG TGTCTGGCTCACATTCCATCAGTATTTTTGGAGAGCTGAAACGTCTGTTA GTTAATGTGTACTGATCTCATTACAAATGACATTTTTGATCTCATTCCTC ATAAATCATAGCTAAACGAACTCTTCATTTTATTGAATTTCTTAAATTTT TCAACAAAAAAAACGTAGTTATCTGCTCATGTCAAAAAAGTCTAATGTGT TGACAAAAAAGGACTTCCTGTTCTGTCAGTCTAATAGTGCTATTTTAGTT ATTTTTTTTGGTGGAAACGAGGTAGTCTCTCATCATTTTAACTCAAATCA TTCTACCCTTTGCTATGCAAAATTTTTATCATGACTAAATCTCGGTTTTC TAGTTTCACTCTGTGATTTTTATGGGATGACACCAATTTATGCAGCTCCG AGTCTCCTTACAACAAAAATTTTTTTCGAACTCTCGAATTCTTGACATTG AAGCAGCAACTTTATGATCCAGATGACAGAATAAAACATCCATTGATTGC TTAATAACTTGGTATTTTAAATACCCTTTTAATTAATGTAATTGCCTGAG AACAATACTTAATGATAATAATACGTCTGTATGATCTTGTTTATTGGGGT TTAGAAGCACAAGTTTATTTTTCGTCTGATTATTTTTTATGTTCTTATTT CAGCTTTGTCCCTTGAGTTCTTAGTTAGAGTGCACAACATTAGAAGCCGA TGTCTTGGAGAAACTGAACAAGTTTGTACCAAACTTGATTGTTTTAACTT TAAGAATTAAAACAAGCTCCACTGAAGCTGCAAGGCCAGCCACAAATAAA CGTAGACCGAACCTTCAAAACCAGTGCATACTAAACTCTTATAATTAGAG CTTCTAGAAGAATGCAACAAGTCAACACGTACAATTCTCGAGAAGAAAGA TTGAGGAAAAAAAATTTCTTTGGAGAAGGCCAAGCAATCTTCTACTAATT GTATCAAAGTTAGAGTAAACAGCCAACAACCGTAGCCTAAATAGAATTGA CTTTCTGTTAACTATTGCAACACATCTAATGAATCTTTTCATGGACTTTT TAGGGTTATGAAAGGGAACCCTTCCCTTCGCATTTGCCAAAGTTTATAGT GCGATTATGGTGAAGCTATACCTTCACTAAAAAGTTAGGAACTGCATGAT CCATAGCTAGATTTCTTCTTTTGGTAAGAATCCAACATTTTCATCATCTC TCAGTTTGTTTTATATTTTCTTATAAAAAAGTCGATTGAAGGGGGATTTC ATTTGATTACTATGGCATTTCTTTATTGTCAATAAATAGTCGTATATTAA GTACATCACACACCACAAGAGCGTAAAGTAGGGGAGAGTAGGCTTTTTTA TGTTTATGAAAACATCATAAGAAGCTTTATAATACTCTGATTAAAATGTA TTAAAGTAGTTTTGGCATCGTATATACCACCATTTTGCTAAAAGGAAGAG AAAACAAGAGAAGGAGACGAGCTTTTTAATTTTCTTATTGTTGTGAAATA TGGAATAAAGGAAAAATAAATCTGTTGTCTGTTGGAAAGTCGTTTGATTG CATATTGTATTATATGTTTATATTTTGCTGCAGCAGACCGTCCAGTTGGT GAGACATTGTGGAAAGCTTTTTTTGACTTTATTTTGTCTCCACAAATTGT TGCTAACTTTAGCGCTGGAGGATTTTGAGACGGACTCGGAGACATTTATA GACAACAACCGAATCTCGAGTTACGCTAATTTTGTTATTGCTTATTTTCA ATCTGAGGAGGAGCTCAATATTTTGGTTTTTCGTCAAACCTATTGAGTAC GTCTTATTTCGGCACCTCTTATTGTTTTTGACGGCATATTACCGAAGAGC AGATACACAGATTCGATGACTGTATCCAATCGTGTTTAGATATTTTGACT CCATTAAAATAATCAAATACGAGCTGCATGTCTATATCCTGACACCGACG ATAAGGAATTTTCATCTCTTTGTGTTTGGTTTTAATATCCCAGTTAATAA AAGCAGTAAATTTTTTTGGTGGTTTTGTACAAAAAGGACATGCTGATTAT TAAAGGACATCCAGCATGGTTCTAGATCAACAAACTGTGAGTTTTATTAT TGTCATTCCAACCAAGTTTCCTCTTTAGATTTGATTTTATGATATGTTGC ATTTTTTTCTCAGCTTTTTTTATATTTGCGTGACACTTGCATCAAAATTT TTTTTGTAATAGATAATTATGTTAGTAAGATGTGTATGAATGATTTGTGG TAGCAACAAGCTAGCTTTGTCCACCCGTACCCGCTCATACCGAGGAATCG TTTTGTTTTCAAATAGTCATCGGTCTTAAGAAGATCTGCTACTGAATTTT CCTTTTCTGTTTATGCCATCTTTTGGTTCAGGAGAATTATGTGACGCATA ATGAGCTTGGTATGTTTCGTCTATGTTTTTTGGAATAAAATTTATACACT GTTTTCTTGTGTAGAGAGTGTTGTAATAACCAATCAATTAAATGAATATT TACGAAGAGTGGTCGAAACGTCTGCAGAGCCAAATATCAAAATTTTTTCT CTTTAAACAGGTCCCCCTAAGAAAAGGATTTTTAGAAAAAACAGCTTTTG AAGAAAATGAATTTCTTGGAATTCTTATAAATATTGCCCTAAAAAGGTGT GTTTAAAAGGTTTATTGCAAATGTATGGTGAGCAATACTCAGTGTTTATT TTAATACCAGAAGTTTGAATTAGAGAGATTCAACTGTACTGCAAATACGC TATAACCTGTCTCTAACTTGCAAACTAAAACATACCTACACATCTTATTG GAGATATTCTTTTTAATAGTAGCTTATTCGCAAGATTACTGGGTTTGAAG TTATTCTCTAAATAAATCATCTAAACCATCTAGGATCTCACACCATATTT TTAAATTTCTGTTAAAATGCTTTTGTTATGAAAGAAAAACAATCAACAGG CCTTTTTTCAATCCCTTGTTTTTAGTTAAAATGATTTTATGTTTGTCTTA TAAATCCTACGGCCATTACTATTCAATTTTTCTGTTCAAAATTTTTTATC CTTGTTTGTTGAAGTCAGGTCTGTGTAAGTTCCTATCCCTTTTTTGTGTG TAATTGTCGAACATTCATTTTTCGCGTAGACTGAAAGTGTGACTTTTTTG ACTTTGAGTTTTCCTGCACAAAGAGGTAAGACTGTTGGCATTCAGCAAAC CTGTACAGTGGAGTCGAACGCTCACGAGAAATGCTGACTTGTTCCAGTTA TTGAAAATTCGAGTTATATTGTGTTGTTGTTGCCTGAACTGAAGGGACCC TGAACCATGTTTGAATTCAGAAGACATTCAAGTTATAAATGTTCGAGCTA TGACGACTCTACTGTACTACAGTCATTGCGAGACTTGTTCAGGCAATATT TTTTATCAGTTGAGTGTTATGTCGTTGAAGTGATACGAAACTCTGCTATT TGTTACTTTGGTACTAATGTTTTGGCTAGTGATTTTGAAATTTAGGCTTG TCAATGTGAAATCGTTTAGATTCTTTTAACTGGTGAAAATTGCTATTTGC CAAAGCAAAGTATAAAACACTTTCTAATCAGCGTTCAGTTTGAAGTAGAG AGCATGGCAAGATTTCTTTTCAATTATAACGAATGCCTTCTAAATGTTCC TTAAAAGACGGTCGATCTAATTAGCAGACACCTTTACTTTTTCCATAATA CTGCCAGCAATGTTGGCTTAATAGTTGTTAACTGCGCCTCTAAGAATTTC CCTCATTTTTTGTTAAAGCTGTTCATATTTTGTCGTTGACCTTGGTTTAT CCTTGAGCAAGGTATGTGGGAATGTTTTTAATGATATGTTTGAAACACTC TGTATTTAATTAAACTTAAATGCTAGGCAGTATTTTCTGTCTCTTTCCAA TTTTGTTTGTAGGGAGGGTTGTTTTTGTCTTTGATTCAATTGTAAACTTT ATTGGATTGCTTTGCGGATAATGGTCACTGGGATGGTCAACCCAGTTGAC AAACAACCCCAAAGCAACGTCCTTTGGACGTTGAAACAACGTAGGGATAT TAGTTTTTGGAATCCTCTCATAGACTTTGAGGACTTCTTGCATATACCTG GTATTTATTTCTGGAGATTAATTCCTACGAAAAATCTCACTTTTTTGTAT CGATTAGTCGACTCATCTAAACGAGTCAATGAAAGGTTTTAGGATTTGTA TTTTAATGATGTTAAACTATGTACATAAGATGTATAGTGGACTAACAACC TGATTAGCATTTTGATCCTAATTCTCTTAAAGAGCATGGAANTTTAGTTT TTGGAGTCCATTGATAGACTTTCGAGGACTTCTTGCATATACCTGGTATT TATTTCTGGAGATAATTCCAACGGAAAAATCTCACTTTTTTGTATCGATT AGTCGACTCATCTAAACGAGTCAATGAAAGGTTTTAGGATTTGTATTTTA ATGATGTTAAACTATGTACATAAGACGTATAGTGGACTAACAACCTGATT AGCATTTTGATCCTAATTCTCTTAAAGAGCATGGAAGATGCATTATATCA CCTCATATGAAATTAATGCCTTATCATTTATTGATTTTAATAAGCTTAAA AATTAAGATTTTTCAAAACTTTCTGAGCATTTCAATTAATCTAAATCTTC TGTGAATCTCTTGGGGTCCGAAGACGGACGACTGGTGTATAAACAAAATA CAACATTACGCTAGCGATTTTACTTTGTTCCGATGCGTGAATTATGGATG TGTCAATTGAAAGATTCTAGTAGAAAATACCTAAAACATACAATAGCCTT CATGCTCATCATAAAACTCGTCTACTGTTTATCTGTGTTCTGTGGGTTTC CGTGTGGTTTCTATTGTTAGCAGTTTCGTGATCGAATTATAAATAAAGTA ATGCTCCATTTTGTAAACTTTTTGATTTTCGAGGTACCTTACAGTAGACT CAATTATTTAAATACCAAAGGATGAAAATGATAAAACAGTTTTTGATCTA TGGAGTTAGAGGAAAGTAAGTCAGTCGGTACTACTACATGAAAAAGGCAA CTATTGGGAAGGTGAAATAACCCGAAAAGGAAACTGTTTCCAGATTGAAA ATTTCATCACTTTTCTGTTTCCCGTTTTGGTCAAGAACTTTTCATCGTCC CCAAACGGGAAATAGAATTTTTGTGAACAAAGCAGATTTTTGTTTCCCGA TCGAGAAAAAGTTTCCAAATAGGGAAGTTTTCAATTGGGAATGGGGAAAG TAGAATTAAAAAGCGCTTACCCGGTGGATTTCTTAACTACCTGGTGAATA TTATTTATTTTCCCTCCTTTACAAGAGGGACACGTTTTAAACTTTACACA GGCAATACTGGAGTGCTCAGAGGCCACTTTCTTGATCGGTAAACTGGTAA ACTTCCCGATTTGGAAAGTTTAGCCATTTCTGGAATATTTGCTTTTCCAT ATAGTGGTTCCGACTGTAAGTGACTTTAGTTCAAGTTGTATAAAGTAAGC ATTAAGTTTGCAACTGAACGACCCGAAGGCAACTTTTTCTTTAACTGTCT CTAGCCGAAGGTATCGGACGCGACTCCTTTCCATGGATTTCTCCATCTAC TTTTGATCTGTCCCTCTAGTCGCTAAGCTGAGGCTGGGCGGTCGAACTTA CAACCTTGTGAACCGTAGCTAAATGCTCTAACTACCTTTATATTAGGGTC GTTCGAGTTATAGGGAATGGTTTAAAGGTTAGTTGTGTTTATCTTTAGGG TATATTGTTACACGTTTTCTTTTATAAGAATAAACTATATAAGAACATTA GGCTTTGATGGTCAGAATCCTAAAAATAAGTCAATAACATTTTAAGGCAT TGCGGACTCTAAAACACCCAATTTCTTAGGAAAATGAAGGCTTCAAAAAT TTTGGATGTTCTTATAAAAAAAACGTATTTACTTTCGTTTCTTGTCTTTA GATTAGAATTTAACGTTGCTTTTACTAAAAGTTCACTTAATGGAAAGTCG AAATAGAGGATGAAAGTTTAAAGCTTAGAGAAGTTGTCTTCAGTTAAAAA AGAACTTATTTTAAAATAAGATTGACTTAAAAATCACAGCCTTAACAAGC TCTCATAACAGAGAGTTTCTGAGTTTTGTGTTTTTAGTATTTAGCATATA AAAAGAAAGAAAAATATTTTGTGAAAACACATTTTAAAGTAGATGTCGAT TTGAATTTCAGGTTGTTGATATTTTTGGATTTTGAAATAATTCCTTTTCT GCACCTATGCCTGTAAGCTGTTTTGTAGTTCTTTAGAATCTATTCCTTTG CGGTTCTCCTCCGACCAAAAGGTTTCATCATCTGATACGGTGGAGTCTCT ATAACTCGAACACGCACGGGGAACACAAATATGTTCGATAAGGAAATTTC GAGTTATGGAGATTGTTTTATAAGGCATTGTTAACTGAAGGGACTGAAAG GACAATTGTTCTAAGTGTTCTCAAACTGTGCTCTTAGAATATTTGCATTA TCCACGATGGTAACAAGGGACCTGAAATTAGCATTTTCCGAAATATGAGG CTTTGATTAATTCTTTAAAACAAGCAATCGTGTATCGCCTTTATGTTGCA ATCACTTAAAATGTCATTAAGACTTGGTGCTTACAGAATATGACACTCAT GTCATATCATTCTATTTAAATACAAGTGCCTTTTAATCCCCCATCAATTC ACGTAGTCAAATAACAATACCCTTGGCTTTTAAATTAGGTCTGTAAAATA CACAATGATAATTTCTTAGGTCAATCCCATTATTCTTCTTAAATTTATAA AATAGTTCTTGTGGGCTTCTTCCAACACAATTTTATACAATTATTCAATC TAAGGCTGGAGGGAGCTCTGTCTGCGAACACAATTATACAATTAAATAAA CGCCTTTTAAACTCAAAATTTTCGAGTCCCTTTTTTACCGCTTGTTCCCT ACTGTGCTGTTACCCAAGCATACATGAATTCACCAATGTTTACTTTCTTG TATTGATGCTAAAATCTTTTTTGTGTACCTAAAATGTAGTATTTAGCTTA CTACTCTGTGCGATGATACCATAATATCTCTTGTTTTGTTACTAAACAAA CTCTAGCACAAAAATGTAAATCACGCAGTCTCTTCTCGCACTACTCTCTT TTCCTTGTCGCATACTGCACGTTTTTTATGAGAACATCCAAAAATTTTGA AGCCCTCGGATGTTCTTAAGTTTTTGGATTTTAAACCTAAAAATTTTATT AAACATGTTCTTTTATTTCCCGATTTTATGAGCATTTTTGCCTACTTTTC TAAGAAATCGGTTGATTTAGAGTCCACAAAGCCATTAAATGTTCTTAACC TGTTCTTAAGATTTTGGCCATCGAAGCCTTATGTTTTTATACAGTTTGTT CTTATAAAAAGACGTGTATACACCCACTTTTTGTGTAACTTTTATACTTT GAATGCTGTCAGTTTTTTGTTGTAAAAGACTTTACAAAAGTCAGTGCACG TTGAACTTTTTTGTTGAGTCTTTTTTACTTAAGTACGGATATAATATAAT GATATGTAGATAATGTTGGGTATTACATTTCAGATGGTTTTGTAGAATGA GTTTTTTGAGAATAAATGACCACCATTCTACAGAGGTAATGTTTTCGTTT TCTTTTTTGATACACCGGGTGAACCGGCAATAGTGAAAAATTTCTATTAG ATGGGGTCAGAATTCTCAGACCTAACGGTACGGGTCTGTAAATATCGGCT GATCTTTTTTTATGTCCGTGGCGCATTAAAGGTTAACTCATCACTCTCCC TAAAGTACAAGTACTTTTCTCTCTGCCAGTAGACTTAAAGTAGGACTCTT TCAAACTTCTAGTGAGTTTTTGATATAAACATTAGATTTTTCGTATCTAG GGAACAAAGATTTGTTCAAGTTGAGGAAATTTCGAGTTATGGAGTATGCT TTATAAAGTATTGTTAACTGAAGGGATGATAAAACTTGTTCGAGTTACAC GTTTTTTTTTTATAAGAACAAACTATATAAGAACATAAGGCTTCGGGGCC CAAAAATTTAAGAACATTCTAAGAACATACTAAGGCTTTGGAGACTTAAA AACATGCAATTTCTTAAGAAATTACATCAAAATTCTCAAAAAATGCTGAA AATAAGAACATTTTACGAACATTTTTAGGCTTCAAATCCAAGAAACTAAG AACATCCGAAGGCTTCGAAAATTTTTGACGTTCTTATAAAAAAAAAAACG TGTAAGGGGAAACTTGAGTTATAGAGACTCAACTGTTTATACTACATCTT ATTATCCAAAAGCTTTCTATTTCACCCGTCTTATTGAGAGTGCGATTCAA ACCAGCCTCCTGATGTGGGCCAAATTACCAAAAATGCCCCATTTCAAGAA GCCTCTTAATCCATTTCAAAGAATGACAGTACACACATATGTGTTGAAAA GTGAAGCAATTTGTAATTGAAGGTTTTGCGTTTTATCTTGGACTCTTATC ATAAGCTTAGTAGGATGACGAGTTAAAGCGTTACTGATAAAAAACTTCAA CGGTTGACAATATCCTAGACTGTACCAGTGTGTGTTTCTCCCTTTTTTCG TACATCAATATAATATGACTTGAAATCAAGGAGCTAGTCACGTGCTGGCT AACATTATGCTGGGAATTTTAGTTGATAATAAAACCGTCTAAAAGATTAT AAGATCTTTCTTCAGTCACTCACATAGACGTATCATAAGAAATTCACATT TTCACATTTTTTATATTGTCATAAACTGTGAACTGCGTGGACGATTTTTC TTGATAGAGAGAATCTCGTTGAAGCTTGTAGAGAGTCACAAGAGTTCTTT TGGGAAAGTCTTTCTAATAATCATCTTCGATCATTAAAGCAAACGCTCTT TGAGATTTCAAAAAACCTGGAATGCAAACATGTTGTACTCTAAAGAGGCT TTTGGTGTACCTATCTTCTGGTGATACTTTTGGATTAAAAAAGGTTTTGG CTTTGATTTCTAGGTAGGTTTAAAAACTAAAATTTTAAGATTTTACCATC AAAAGTTTGACTTTTTAATATTTGTGAGGAGTGCGATGTCATGGTGGATC TTGGTAGTTGCTAAATTCACGTTTGTGTTAGACAGGGTAGTCTATACTGG GCGTCAAGGCTTTTTTGTACGCAGAAAAGTCTATTTTCCCAGTTTTGAAG AGATATTCGCTAGAGACAGGGATGTTTGGGTATTTTTACAGCCGATTCGG TGCGTTTACACATCCTTGGCATTTGGCATCTACATTACTTGCAAGGGGGT TTTCCTTTTGTTTTAGCGTATTTTTCGTACATGGAGCCGTTTCCCCTTAA TTCCAGGCAGTGACGTAATCAACGCAAGCTGATGACTTGCACTTACTATT ATTTCCCCGTTCACGATCAATAATTGCAATGATTGGGCAAAGACTCACTA AAAGGAGAGTAACGCCCTCAACACCAACATCATATTCGTTCTCGTTCGTC AATAATTGCAATGATCGATCTCCATCACGTTCGACTTTGACAAAATCCTG CGCTAAACAAAAGAAATACTATTAAAACTATTCCAACTAATTATGATATA CCAAATGCCAGGAATGTGCAAAGACGCGCCCATTCCAGAAGAGTTCTTTT ATATGAGACTTTGGATCGATGTAATACGGTAGTTTTCCGCTGTATATTCG CATCAAAACCTCTTTAGATAAAAGAGAAATCAAGATTCAAGAGTGTATGA CATTGTGTTTGATTTGGATACAGGCTTTTCTAGACATCAACACAATCTCA CACATCTCAACATATCCCTGTTTTTATATTAATGGATGACTATGCTTTGA GGTTTATTAGGATTTATGAAATTTAAGTCTCTTTTTGATTTTTGGTTTTG TAACTTTCTATAAGGAACGCCTTATGAAAATAATTTAATGATGACCTCAC TCATCAGGCTTTCTTTTAAACATTGATTGATATTTTTATTACATTGGGCA TTTTTGATGGAGTTGATTCCACAAATATGGATGAAAAAGATAGGTCACTG AAGTTTTAAGTTTGAGTCGATTGGGTCGATCTTTTCTTTCAGAATTTGGG ATGTTAAAGGTTAGTGTATTGAAATTTTTGATACAAAACTTGAAATTTCT AATTTTCAATTTTAATGTTTTTTTTTTTTCCTCAAAAATATGGTGATAAG ATTGATCAGTTGATAGTAACCATAGTAACCATGTCACTGGGCTTTTTCCA TTTCATCATGGATATTCTTAACTTTTTGGGGAAAATCATCTAGAAGTATC CTTAAGGCTTTCTTAGGTTGGGATCCAGACCCAACCTATATTTGATATGT AATACATACTACAAAAATAATGCATCTTTGTGAAAATCTTGAGAATTGAT GAATAATTGGCAATTTGCAGTTAAAAAAGTCCCCAAAAAAGGCAGTTTTT AGTTTGATTTCCAAATTTCATGATGGTGGTATTCTTAGCATATTCTTAAT TTTTTGATCAATTTCATCATTAATATTCTTATGTAGTATAAAAAAAAGTG TGTTATTGGAATGTTTGGCAATCCGAATAACTTTGTATTCTCAAGGTATC TATCTGAGCTTGATGCATTATAATCATTTGTTTACTACATGTTTACTGTA TAGTTTGAGTACCAAATACCCAAAATTCAAGTAGTAAGTTTGCGATCGCG GTCAAGGGCGATCCGAAGGCTTAGGAGAGGGTGGTGCTACTTTCCCAGGA TTTCGCCATTTACCCTTGATCCGTCTCTCTAGTTGCTGAGCATCACCATT TTGGGAATATGTGGTATGACGTGGCTGGGGATCGAACTCACCACCTTGCG CACCCTAGTTTGATGTTCTATCTTTATGCTACGGCCGCACCTAAAATGTA CAAAATGTTTATGTTATCATTCTATAAAAATTCGTGTTAGACATCAGGTC TTATTTTCAACTCATCATGATTTCTGTTGTCAGGAGTTCACAAAGCCCTT GTTGATGTAAGTTATGTTGACGAATAAATCTCTCTATCAACACAACAATT ATTGTTATCCTTTTCAATGTGTAAACTAACGCTGTTTTTTCTACGTTCTT GAACTAACATTTTTTTTTATGAATAAAATTGGAGAGCTTGACTGTAAAGA ATTTTGGACCATTATTTTTTATATTGTCTGAGTGTGTTTGCTGATAAGAG TTGTGTCATCTTATCGTCTTGCAGAAACTGAAAACTTAACCTATACCTTG AAGATGTTTCACGATATATTTTAAGTGACTGCTGAGATTTTAGGACATTT TTACATTAGGGACAGTTTTTGGAAAAACTAAAATTGATAGAGGTTTGTAC TATTCATAGAAATTGAATTCTTATCGCTTTTTTTCACGGTGTCTTGCAGC GGTGTCTCTATAACTCGAACCTCTGTTTAGGTTCGAGTTATGGAAACTTC ACTGTATTATGTAAATCATTTTATCATCCGAAGACTTTGAAAGGCTAATG TGAAGTTAGAGCTATGATGCATCGAAAATTTTGGTATGACAATTGATATA CCCTTGTTGTATGTTGACATTTGTGATGGCATTGCAAATTATGGGTTAAG CGTCACGCATCTTTTGTTTTTTGTCATGTTTGTGGACAATGAGAGTGCAG AAAATTTTTGGAAGCTTCAGCGCGTTCTCATTTTTTTAAGAGAAAGCCTA AATTCTTTATAAAAAGGTTTTAAAATATCAATAAAAATCAACTTCTCAAG TCTTAGCAATCTAGACTCTAACTCAATTCGTAATACTCGTTTTTTTTCTC GTAAGAACATGCTCAGCTTCAGTTTGGAAAAAAATGACAAGAAACTACAA TTGTTTCCTCTTTTCAAGCAGTTTTAACTGAATTTAGGGATGGATTTTCT AAAATCGAAAGTCAAATATTGTCTAAATTTTACCAATTTTAAGTGCTCTT TATTTTGCATGATAATGTCGATGTAGAGTAGTCTGAAAAATTAAGAACCC ATTTAAGAACATTTTAGGCTGAAAATTTAAGCACAAAAAATAAGCACAGC CAAATTTTAGGTGTTCTAATAAAAAAAACGTGTTACAAATCGTGCTGTCG TGTTCAATGGCATTGAGAATGTATTGTCTTTGCTAAAGGAGTCAAGCATA AAATGGAGCTTGGCATGGAGAGTGTCCGAGTGCAAGAATTACAGCAAAAA TACTGTACTACAGTTGAATTGACGCTCTCTAATTCGATGTTCTACGTTCG ATAATACGATAATATTGAAAGCCACCGTCAGCTAAAAATTCTTCTAAATG ACTCCTTTATTCGATGAAAATCTAATTTGCCTTGAAAATCAAATCAGGGA GCGTCGACTGTACTTGGTTATCCGAGCTTCATCTGTCGTCCTTGACTACA CAGACTATCCACAATCCGAACAACTTTGAGTGTTCGCTGAAAGAGTGGGG CTTAGAGAACAAATTTATTGGCATTTTTCTCCATTGTCTATCCATTTTCT ATTTACCAATGGACCTTTTACATACGAGAGTCGGATTACACTCTTTACAC ATCATCTCTCGTATTTCACCAAAACTATATTTCACGTTGATTGGTGTATG TGTGTGTGTGTGTGTCTAATAGAGACATTTTTTTCCTCTCTCATCGTTCG CTTTAAATTGTTCAGATAGTGCTTTGTAAGCTTGTGATTGGTGACGAGTT GAAAAATGTAGTGTGTTTTTCTGTTATCAGTGAGATTTTGTAATAATATA TTTTGCGAAATGTAATGTCTGTTGACTTCATGGGCTTATCTGTTTTTTTA TACAGATGTATTTTTATGACTTTTCCAAGTTCTCCTGGGACTTTAGTTCT AATTTTGACGAAAAGAAACCAAAAAGTGATCCTTCGTTTAAGTCTTCCCG ATTTATCTTGAATCTGAAGAAAATCTCTTTCTTAAAAGGTTTTTTTTAAT TTTTAAGTAAAAAGTGTTTTACGTACTCAAAGTCTTCACTCTGTAATATC GTAGACAGTTCTGTTTAAATTTGGATTTGATCTTGCAAACAATCCGGGTA CATAATGGCTTTACCGTATGCATGAAAATAATATAACATCAAACTTAAAA TTAACTTTTAATTGAATTTTTGTCAACTTTGTTTTTCAACAAAGTCAATC ACCATATCTACAATGAAATATTTTATGATTTATACTTCATTACTATTAGA CGTTGTGCTATAAATCACATTATAGGAGAGATGACATTTTCTCTGATTTG TTTTGCAATGTGCCTCTTGCAGACTTTTTGAGGCTTCTTTTGCTTTTTTA TATCTGACTCAATAATTTTCAGTAGATAAAACCGTACAAGGCTTGGTTCG CTCTGATTAAACTGTTTTAGATTCTGAATTTGCCAGTAAAGTAGCTTTTT CTAGTGCATAAGAAAAGGAAGTTTACCTAGGTCCTCACGATAGCAAAAAA GTTTCGGACAACGGTTACTTCTTTAACATGATTCAACTTTAATTGCGCGG ACGGCTCCTGAGGGACTGGTATTGAATTTACAAAGAAATGACGTCCAAAT TCTATGTCTTCGAGGAATATAATGCAAAAACTTCAGAAATTTTGACGTCA TTCTTTCCTGGTAAATTCGAACCCAGATTCCTTAAGCGTTGACAGGTGTT ACTTACAATATGGTACTTCTTCTTAACCAAATTTTCTTCTATTTTTTCTA TAGGCTAATCGATCAGATAGCCCGACTCCGTCGTCCGTCTCCACTATGTC AGAATGGGACGATTATAATGAGACGCTAACGCAAGTCTTGACATGGCTCA TGCAAGCTGAAACACAACTCAAACAACAGGAACCTGTCTCTGAAAATGTG GACAAAGTCAAAGAACAATTTAGAGAACATGAGGTATTCTTTTGATGCTT ACGCAACTGTGATCTTATAGTTTGAATTTGTTCCAGAGCATTTTTACATT TTTTCACTTCTCTTCTCTAACTCGAACCTCACNTCTTACGCAACTGTGAT CTTCGAATTCGTTCCAGAGCATTTTTACATTTTTTCACTTCTCTTCTCTA ACTCGAACCTCCCTCTAACTCGGATTTTTTTTAACAAACCATTTCAAACG ATCATCTAATACAAGAAATCTCGCACAAGTTTATCTATAATAACCTTTAG ACGTTCGGCTCGAATTTCAGAAATCACGATTTAATCTATATCACCCTTGA GTACAGTTACCGCTCTCTAATTCGATTGTCAAGGGTTATTGGATTTTCTC GAGTAAGGGAGCGTATCGAGTAGTAGAGCATCGTTCGTGAGAGTTTTTTG CTGATGGTGACTTTCAATATTATGGAATGATGGAGCCTATTGAATAGTTG AGTGTCTAATAAATTTTAACCAACCATTGTTTCCTTACTCTTCTTTTACT ACAGGAATTCATGATGATTTTAACTTCACATCAAGCCAGTGTGGGAAGCG TATTGGAGTTTGGAAGTCAGCTCATCAACGAAAATATCGTCGTTGGTCGG GAGGAGCGTGAAATTAGGGAACAAATGTCAGTTTTGTCCGAAAGATGGGA AAATCTTCGAGTGTCCGCTATGCAAAGACAATCAGAGTAAGGATTTTAGA CTGCATTCCCTTTCTTTTTTACTGTCTTTTATGACAATTTAGTGAGGGAA ATTAAACCCTCCTGTTCAAAAGAAAACAGTTTTACCCAAATAAAGAGTAA CTCTGATTTTTTATAATAACAAAATATATATACATGATGGTTCGATGGCA AAAATATTAGGAACAAGTTAAGAACATCTTAAGGTTGTGCTGACTAAAAT TAAACAAAAATAATCACAAAAAGGTGACTGATAACATGTTAAGGATATTT GTAGCCTTCAAACTCAAAAAGTTAAGAACACCCGAAGGCTTCAAAAATTT AGGATGTATAATATATATGTATAAATGAAATATGTATACAGAAGAAAAAG TATGAAATAACAAAATGACATGATCACTATTGTCTTTTTGTAGATTACAT CAACAACTGATGAAACTTCAACAACTCCAACTCCAAGAGCTTGCAAACTG GCTGACAACAGCTGAAAACATCATCGAAACTACGGGACCAATCGGATCAG ATCTGGAAAGCGTTAAAATTCAAGTGGACGCTCACAAGACGTTTCAGGTA GAGTTTGTAATAATGATTTTGTAATAGTTGACGCCTTTGTATACTATTCT TGCTTGGAACAGTTCTATAAGAAAAATTTTTTTTACAATGTTCTACGGCA CGATTCTTTTTGACAAATTCTGCTTTGCAATGTATTATTTGCGAGCTATG TTCTGCAAGGTAACTCAAATTGACATTATCTGTGAAAAATGGAATATTGA AATAAGTATAACACGTCAGGTTGTTTTCTACCATTTAAAAAGCTAATATA AGACCATGTGGAGAAGTAACAGTTCCACATTGTTCCGAAACAAAACGTCC CCAAGAAAAGAAGACGTTACAAAGCAAAACAAATTGAAACGCTTTCGCTT CACTATTTTCATCAGAACGGATGCTCGATTCTCCGAAACATTCTGAAATC AGTATGAACACTTTCTAACTTACAATAGGGGCAATAAGTTAGAGTAAATT TGGTTTTATAAATATATAAGATAAATAATTGAAAACAATAACCTCTAGTT GCACTAGACACTGTAGCTAGCAGCAAGTGACAATGAGTCCTAACCTAGGG TCTAACGAAAATGACCGATTGAAAAAGAATGTAATAGCACAACTAAGCAG TTGCGCCGGGCTGTAAAGAAACAGAAACTTGAAAATTTCATAAAAACTCA ATAAAATTTATAAAAAAAAAAAATTAATTCAGAAACATTAATTATTACTA ACTCTTGAACGAGAGTTAGTCAGTTCAATATCATTTGTATTCAGTTCTCT ACTCCAAATGGAACGGGATCCACGAATACATAACAAAGACGATCTCAACA AGCTGAATATCATTCATTTTGATCGAATAAACGAAATTGATTCATGGAGA CGTACACCACGTTTTTCAGCAAGCATCACAGCCAATCTTTTGTAGAATGT TTGGCATTCACGTCCCATACCTCCGTTTGTAGAAAATACTAATGGGGTGA AGGTACCATTTTCGATACTGTTCACACGTTCATTGTAATGTCTCTTTTTC TCGTTTTCGTTTCTTTGGAAGCACTTGCTGAGCTCCAAACCCCTGTACCT TCGAGCGCTTAGGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNTATATTCAAAAGAGGTGTTATTCCAATTGCGTACACT GCCATACCGATCGGATCTCCTTGAGTGGTTCCTTCATTTGACTTAAGCTC GACACCACCGATAACGAAAACACTTTCTATCCGTAACAAAGGCCGTACCG GAGCGATGAGAAACCGTAACGTCTAAACATGGTCTAACCTGGTCTAACCA AAATTGACATTACCAGGAAAGATGAAATGTTGAAAAAAAAATGTAATACG TTAGCTTGTTATTCATGATGGAGAAAGCAAATCTAAAAGTACATTTTCTT TATACCTTACTTTCTATTCTACCAGGATGATTTGGAGAACCAGCAGATCC ACGTCAATTCATTAAGTCATATGGTAGTGGTGGTTGACGAATCCGAATCT GAAAACGCTACAGCTGATTTGGAAGAGCAATTAGCTTTACTTGGTGAACG ATGGTCTGCTGTATGTAAATGGACTGGTAACAGGTTAGTATACGTGATAT AAATGACGTGATGTTTTAATATGGAAGCGCCCATATTAAAAGGCCGGGTG TTTTTCACTAGTTCTGAATTTGAACAACAAAAATCTGCATAAAGAAGCAC CCAAAATTATCACGGCGTTTACCACTAGAAACGCCCTGGTTATTTTGGGT GCTTTTTTATGAAACATTATGTCTAAATATCAGGAATTTCTCCATGCCTA AATAATTGTTTCAGGCATAATACACGTTTCTTTCTTGGACCATCAAACAT CGAAAGGCTTTCATGTTTTTTTGCTCTATAAGTTTATAATGTTTCCCTAA AATACCATAAGGAAACGGCTTTTTCAACCCTTTTTCAATTATCTAAAGTT CGTGGTCGTCTAGTTTAAACTAAATTCCACCTTGCTTGACACTTTTAATA GGGAAAAATTTTCGAAATTAGTCTCTCAAAGGATCGGTTTTCAAACTTTG GCTTGTCCATATATCCGTCAACTCGCCAACCCAGTAACACCCCCCCCCCC CCGGAGGGGATTCTTGAGAAAATCGCGAGGGCATTTTATACACGATTTAT TTTCATTTGCTTTCGTTTTTCCCTTTATAGATGGGAAACTCTGCAAGAGG TTTTAAAAAGTTGGGAACAATACCGTAACCAAGAGCAACGATTGAACGAT TGGTTGTATGAGAAGGAGAAAGGCTTGAAAGATATCTCGCTCTTTGATAT GGGCGACAAAGAAGAAGTGCAAAAACAAATACAAAAATTAAAGGTATCAG AAACCTTTGCTTCTTTGAGATGTCGTGGAGTTTTTACAAGATACTTCACT TTTGGTCATTTAAAGTCATATAAAGAGATGACGCGTTCTTTAGAAAAAGT AATAAGATTCTTTTATTACATCTTAACGACCAACCAAATCAAATAAGAGC TTGTAAAAACTCCAGCTTGTCCCGCTTCTTTCGGTCAAAAGTTTCTAGAT TCGATGAAATGTTAGCGTGCAAAATTTGAGAGCCAAGGAGTCATTTGCAG TATTCTTATTTGCTAAGCCAGCCCACTATTCTTCTGAATAAGTTTGAGTT TATCGACCCAGTGATATTCATATTGGAGATGCTTCGTGGTTTGGATCACG AGGTAATCAGAAGGGCTTAGTACAATAAGAAGTGAGGAAAACGCTCTCTA TATTCCCCGGTAATGGGTGAAGGCTCTTTCAAAACGTTGCCAAACGTAAA TCTCGTGATCTCAACCATGATATACTTTCGATAAGCAACCTCTTTGTTGA ATGAATTTTAACTCGGCAATCAAATATTGCGAGTTCATACAAGGAACTTG GTTTTTCGAATACTTATCAAACTACACATTTAATTTTCACAGATATATCT TACGGTTGTGTCTTTATGTTATGTATGTTGTGTCTTCAAATTTATGTAAT TACAAGAGAAATTTTTGATTGCGGAAAAGTTGGTATTAATGGTTAATGGT AAATACAGTTGACGCTCTCTAATTCAACGCTCTACCATTCAATGCGCTCT TTTATTCGATGAAATTGAAAGTCACCGTCAACAAGAAACGCATAAGCGAC GCTCTACTATTCAATGCGCTCCTTTTGTCGATGAAAATCCAACTTCCCTT GAAAATCGGATCAGAGAGCGTCAACTGTATCTCAGAGTTGGGTCTTTTGC AAAAATTTTCACATTGACGTCATTTGAGAAACTTTGTTCTTTTTCTCGAC AGGATTTAGAGAACGAGTTGACACAGCAACAGAATTCTTTTGGTGATTTC AACAACGCTGCCCAGGGTGTTGCACAAATGCTTGACGAAGAGTCACCAGC CATCCAAAACATACAAGTAACAATGGAAGATTTCAATAAGAGATGGAATA CCATTGCTAGCATGCTGAATGCCAAAATGAAGCATGTAAGTTATTTGATT ATGTCTACTCCCGAGCAAATCTATTTTGTTGGTGATGAGAAACATTTTTG GTCACAGTACTAAAGTCTGTCTGCGCAGTTCTTCAAGAAGTTAATTTTTT TCTTCTTCATTTTTCATCTTCATTTTCCAAAGCTTTTTCAATTTTTCTCT ATTTGGGACTATTTCAGTTTTCAACAAGCACAAAACTGCAATTTAATTCA AATTCTACCAAAAGTTACAGTTTTTTGTCCGATCTCAGTCCTTTCGCTTG AAATAAGAAACATTTTTGGTTGCAGTAACTATGATATTCTCATGTATGGT CTCCGAAGCTCCATCATGTTATTAAGTTTTTTGCTTATCAGTTAGAACTG TCATTTCCTTAAGAAAGAGACGTTTTTATTAGCCAAGTATTAGATTCATA ATACCTTCATAGAATGTTTGAACTTACTCTGTACCAGAGTGTATCTCACG TTTATCGCTTCGTAGTACACTCTGTGCGCATTGTCTGTTTGATAAAAGTT TTTCCGTACGGAGACCTCTGCGATGAAGTATGATTTATGAATAGCAACAC TTCCCACATCGTCTCCCCTCTCTCACCAACACTCCATCGCAGCGGTCGGT TTGAAAAATCGACAATGAAAAAAAAAGACAATGACAACAGACCCTCTACG GCAATGAATTTTGAAATAAGCCGTTTATACTGGGTTTGAGCGTAGTCTAA ATGAAATTCTGCACCTTTATTTTTCTACAGTTCCGAAGTATCGAGAACAA CTTGACAGCACTACTCAAAGAAATCGATGACAATATAGAATGGATCACAG ATACAGAACTCTTACTTAAACCTTCATCGCCACCAGATCGCGAACTAGTC GAGGTAAATAAATATCTAAGATTTGATCATCGCTTCTATAGGGAGCTTTT AACTAACTAACCAAATAGTAACTGTAATTATTGTAAAGTTTTGAGTGTTC CGCTCTTATTTGGTCGTGCAATTTAGAAAAAAGGAATTTTAAAACAGCAT AATTGAATGACTCAGGCTAGTGAATCTAAAAACTTAGTTGTATACACAAA CATTAACTCTGAAACAAAAGTACTTGAAATTCAAAATGTCTTACGAGGTG TAAGCAACACAATTATCATTGTGAATATGTAATTTTATAGCAAACACAAT TATCATTGTGAATATGTAATTTTATAGCAATGAAATCTGTTTGAAAACGA GGACAACAATAAATTTATGCATCTCGAGAAGAGTGTATTCTACCTTGTAA ACTCGAGCTCAGTCTCCCCGTGCTTTTACGGTTAGAAGGTATGCATGACG AAGACCTACACTAAGCAGGTCGAAATATTGTTTATATAAAAAATCTATAT AGAATGACCATAAAAATGTGATTTATATTTTAAAATACTTCATTCGTATG ACACTAAAGACAAGGTACATAGGTGTAATATTGTGTTGTGCTTATAGTCT CTTGACCAAGCAATCAAGAAACGTCGCGATTCAATTATCGTCTTGACGGA GCAAGGCGAAACACTGATGACGGAAAGCAAAAACGCCGGACAGTCGGTCG TCGGCCTCGAACAACAATTAAACAATTTTCAAGAGCGTTGGAGCCAGCTT TCCCGCACGGTGGCCGAAAAGCGTGACCTTGTGGAAGACAACGAAAAGAA GAAGGTATTTGTAGAGCAAGTTCAAAAAATCTTGCTGGTCATAACAGAGA TTACCACTTATATTGAAGTCATTGTCATTGATTTGAAAAATAACCCAACA GAATTGCTAACCATACTCGAGGTATAACATTTTCATTTATTTATTTGTTT TGGTTCAATATCCTTTGAAATTTCTTCAACTCGGCGACGATAGTATNTTT TTCATTTATTTATTTCTTTTGGTTCGATATCCTTTGAAATTTCTTCAACT CGACGACGATAGTATCAAGTGGTTGTTTTATGCTATGGGGTCGAAAAACT TTGAAGTTCAAAACAGTAATCAAAATCAAATGCAATATTGGCTGTATGAG TTTTGCTTTCATGTATTTTTTGTACACGATTTTAGTTCTTTTCACTTTTT CGTTCGATGCAGCTCTTGAAAATGTAATATTTTTGTGTCAGTGGCCAATT GTTTTGAAAAAGCAATGCCATTGAAACAACCAATCAAATTTGGCTGATTC ATAAAGGAATTTAATCGATTTTTCTGTTTTCGTGTGGAGAAATTTTGAAG GATATTAATTTTCACTCGTTTGTATTTTGTTATCTCTCATCCGCCGGTTC TTTGTCCAAAATTCGACCAAAACCCCTCACAAACACACACGTTTAATAGT ATTATTTTGAGTTTACAGAAAAAAACTCCAAGGTCAATCTTGGAAGCTCT AAGAGATACAAAATACAACCTAACAACGACTAACCACCGCTAATTACCTT CTCTACTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCG TTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTT CGTTCGTTCGTCAATTCATTCGCTCGCCAATTCATTCGCTCGCCAATTCA TCCTTTTGGATATTCATTCGCTCGCCAATTCATCCATTCGCATATTCATT CATTCGCCCACCCATTCATTCGCTCATTCATTCATTCGCCCATTCATTCG CCCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCGCA AGTACGAATTGATGTATCGTAGAGGATACGAGAATCATGCATCATAAAAC CAAGGTGAGCTCCATTATGTTATCCCACTTCAAATGCTAAATTTAAAAAA TACTTTTTCAATATCCTTTTTCAGGCAAAACAAAGCGAAGTATCACAACA CAAGGCAGCCCTAGCTAACCTCTTATCAAAAAGCAATGAAATCAAAGACC CAGCCACACAAGCAGCTTTCCAATCCGAAGTGAATGCAGTTTCTGTCAAA CTCTCCGCAACAGAGAGCACGATCGGTGATAAACACAGACAAACGAACGA TCGGATAAACAGTACTCCTCCACAGGAGTTTTTGGATAAAATGACTAGTA TTAAGGATATTGTCAATAATATTTTCCCTTGTGTCAGTAAGGAATTCAAA TACGATCAAATCAAAAGCATGCAGACATTGGCAGACGACTTGAAGGTATA TGTCTACCCCTTGCTCATTTTTGAATAAATATTTTTAGCATCAGTAATGC CTTCTTTTGATAGTGTTTCCAAAGATTTTGCCAACTTGAAGCCAACGATC AGTCTATGTTTAAAGTCACGTGTCTAAATCAAAGCTCATTTTGTGATAAG CAATCTTCGTTTAGATATAGATTTAAAGGTCTTTGAAGGTGCAACTGTTT TACCTACTTTTCTGAATTGCCAAGTAACGTGTATGATTTTGTTTTGTCGT GAAAATACATCTTCCATCAATTTATAGTACACCTTCTTATTACCAGATGC TCTATATTAGAAAGTTTTCTTTCCCCGGCCGTTTCATAGAAAAATTCTTA TACAGTAGAGTCTGTTTAACTCGAATGTGTTCGTAACTCGAATAGGATTG CTGGTCCCTTCCGTTAAACCCTTATAAACTTCACTTCATAACTGGGAATT TCCTTAACGTGAACAACCTTTTGTTCCTCGTTTGTATTCGAGTTATGGAG AATCCACTGTTGTAATGAAAGAGATAAAAGATAAAAAATTTTCGCCACTT TAGTAGCAGACATTTGCCCAAATTGGATAAATTGGATAAATTTCCATTTC GTTCTTATTAGACGACATTGGCGAATGTTCCGTTGTTACTTTCTCACTTA TTAAGCAACCAAATTCGTCCATTTATAGGGGATGGTCAAGAACCTACAAG AACAAGAAGGTCCACTATCACTACTCAATAAACAATCGAAACTTCTTATG GAGACATTGTCACCAGAAAATGCAGAGAAATGTCAGAAAGATGTATCAGA ACTTGAACGTCAGCGTGCAGACTGTAAAAAGATCACGGAGGCACGATTGA AACGTGTCAGTGAGGCTATTTTACAGACTGAGGAACTGGAAACGGCAATG AAAGAGACTGTTCACTGGATGGATGATGTTGATCGTTTCTTGGAAGAAAT CACTGGCACAATTTCAGAAGGTGATGCAGAAACCATCGAATCACAAGTAC AAGAAGTCGAGGTAAGACCTCAANACGAACGATCGGATAAACAGTACTCC TCCACAGGAGTTTTTGGATAAAATGACTAGTATTAAGGATATTGTCAATA ATATTTTCCCTTGTGTCAGTAAGGAATTCAAATACGATCAAATCAAAAGC ATGCAGACATTGGCAGACGACTTGAAGGTATATGTCTACCCCTTGCTCAT TTTTGAATAAATATTTTTAGCATCAGTAATGCCTTCTTTTGATAGTGTTT CCAAAGATTTTGCCAACTTGAAGCCAACGATCAGTCTATGTTTAAAGTCA CGTGTCTAAATCAAAGCTCATTTTGTGATAAGCAATCTTCGTTTAGATAT AGATTTAAAGGTCTTTGAAGGTGCAACTGTTTTACCTACTTTTCTGAATT GCCAAGTAACGTGTATGATTTTGTTTTGTCGTGAAAATACATCTTCCATC AATTTATAGTACACCTTCTTATTACCAGATGCTCTATATTAGAAAGTTTT CTTTCCCCGGCCGTTTCATAGAAAAATTCTTATACAGTAGAGTCTGTTTA ACTCGAATGTGTTCGTAACTCGAATAGGATTGCTGGTCCCTTCCGTTAAA CCCTTATAAACTTCACTTCATAACTGGGAATTTCCTTAACGTGAACAACC TTTTGTTCCTCGTTTGTATTCGAGTTATGGAGAATCCACTGTTGTAATGA AAGAGATAAAAGATAAAAAATTTTCGCCACTTTAGTAGCAGACATTTGCC CAAATTGGATAAATTGGATAAATTTCCATTTCGTTCTTATTAGACGACAT TGGCGAATGTTCCGTTGTTACTTTCTCACTTATTAAGCAACCAAATTCGT CCATTTATAGGGGATGGTCAAGAACCTACAAGAACAAGAAGGTCCACTAT CACTACTCAATAAACAATCGAAACTTCTTATGGAGACATTGTCACCAGAA AATGCAGAGAAATGCCAGAAAGATGTATCAGAACTTGAACGTCAGCGTGC AGACTGTAAAAAGATCACGGAGGCACGATTGAAACGTGTCAGTGAGGCTA TTTTACAGACTGAGGAACTGGAAACGGCAATGAAGGAGACTGTTCACTGG ATGGATGATGTTGATCGTTTCTTGGAAGAAATCACTGGCACAATTTCAGA AGGTGATGCAGAAACCATCGAATCACAAGTACAAGAAGTCGAGGTAAGAC CTCTATTAGTATACCGCAATCTTGATAGATCTTTTCTTAATCACATTTTC ATGTTGAATGAATTAAAAACTTCAACACCCGGCCCTTTCTACGCCAGCCC TATTGGCGTTATTCTGTCGTCACTGGCGTAATCCGTAAAGGATTGGAATA AATAAGGGCCGTGGTAGAAATAGAAATAAGGGCCGTGGTAGAAATAGAAA TAAGGGCCGTGGTAGAAATAGAAATAAGGGCCGTGCTAGAAATAGAAATA AACCAGCCGAGGCTGGAAGGTCAGCCAATAGAGCTTAGCTAGATAGCTTT AATAAGTGGGTTAACAGATGTAAGAGATGTACTGAAACANNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAAATGAAAGT GAAAATTAGAAGCTCATATATGGCTCAAATGAAAGATATTTATCCAAGGA TTCCAAAAAATATCACAACATATACCTGAAAATCAATATTCGAGAAGCTA TGAAGGAAAATAGCTTGAAAAATGACGTCATCGATGACGTCATCGACAGT AAAAAAATCGTCGAAATCGAAAAATTTTCCTTTCGTTTGAAAGAGGACCA TCTAGTGAACAAAAAATATTACTACAAAAAAATCTGAATTACTCCTTAAA AGCCCCTGTCAGCAAATTTGTATTGTAATTCATTAAATTTGCCTTTGAAA GGTTAGCTTCGGGCACGCCCAGGAATCTTTAAAAAGCTTGAGAGTCAAGT CAAACGCATTTCACAGAATAATTTCCTATCAAGTGAAATTCAAGGTTTNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNAGGTTTTCAGTAGTAATATTTTTTGTTCCCAAGCAGGTCCT CTTTCAAATGAAACAAAAATTTTTCGATTTCGACGATTTTTTAATTACCG ATGACGTCGTCATCGATGACGTCATTTTTGAGCTATTTTCCTTCATAGCT TTTAAATATTGATTTTCAGGTATATGTTGTGATATTTTTTGGAATCCTTG GATAAATACCTTTCATTTGAGCCATATATGAGCTTCTAATTTTCACTTTC ATTTTCAAGCCCCAGCAAAAGTGCGTCACATGAGGACCAGCAAAATGGTC AAAATTTTTCTCACCACTTGTTTTTTTGATCTTATAGACCTAATTGATCA TTTAAAAAAGTTAGTTTGCTTTTAACAAGTCTGTGCACACGAAGAACATT GTAGCTCTCACTATTTGGTAGACTTGGTCAAATTACAGAAACCATTTTTC AGTTGTCTGCAAGGCCAATGAGGTATGTAAAAACTGACTGCTATTCAGTC AAAGCCAAAATTTGGCAAGGTCAGAAAAACATAATTTACATCCAGTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNCAAAGTGAGATCGGGAAGTCGGATTTTTTTTTTGTCGTCTTATGATG ATGGAACTGGAAAATTTTACCTATTTGAATGCTCAGCTTCGGCTGACCAA TAATCGAACTTTGGTGTATTAAAGGCCGGCGTGAAAGGTGCCGGCGTTAA AAGGGCCGGCGTTAAAAGGGCCGATATGGTATTCAACATGACATTATTAT AAGGCATAAAAGATATAAATAGGCACTGATATAAAATTATGATTCTCGAG TAAAAATTTCAAATTTTAAATCCAGAACTAATTGCGCTTCTAGGTACCCA ATCTATGTTTATGTTAGTGTAATGTTTCGGGAAGAAAGATACCTGAGTCA AAAACTATAAATGGGCATTTTGACACTTGTTTGTTTTGACACTTGTCATT TTATTTTTCATTTCTTACCATTATTTCCACAAAATATATTTAGAAATTAA ATATTGATCAGAGATCTGACCTCAAGAATTTACAGTTCTCAATATACAGT TTTTTGAATTTACTCTGACACCCTAAACACCAAACAAATAAAGATAACAT AACAATGGGCAATGAAATGAATTAAAATCGAATATTAATTAATAATGAAT AATTCAATAAATTATACACAACAACCACAGTGATCTATTTATATAATCTC GTGTTATTTTTCTTTCCAAGTCAAATTTATGTCATGGAATTCAAAGTTCT TTTGAGCATTTTTACTTTCAGTGTGTCCTTGTGTGCATAAATTCGTCATT CACACATGTCCAGGCGGTAATATCATCAATATCGCGATATCTTAAATCTT AGATTTCAAGAGGCTTGAAAAAAATACTGATTTTGCTTGCTAACATCTAT TAAAAGTTTTTGAAAAAAAAGAAAGAAATTTTCAACCAAACTTTATCGAT CAGTTTAAATGTACCCCTGTTGAAATTTCTCAACTTCCGGAAATGAAGCA AACTCTTTCCTTGCATGTGTTATCTTAGCCTGTACGAAACTCTTCTTTGT GAAAATAACCGCGAAGTACGGAAGGGCACCGTTTCATTTGTGCTCTTTTT TCTGCCTCTGCGATGGAGAGATGTTTTAATTTTAACATTCGAACTACCTT AAATAAGTGACATTGCCTTATCCTCCTCAATGCAATGGTATCTTTCGTTT TTTTAAAGAGTACGCACGTGTTTTTCGATAATTTAGTACCAGAAAGTTGA TACTAACCACTGACCTTTATATGTCCCTGGACCAAGCTATATCCGCCATC TTTGATCGAAGTTTTTTGAAAGTTGGTACCCGCAAAGAAGCAATTGTAGT GTTTGAAACTTTGCCTCACGACAAACGGCGCTACATCATTAGTGTAGAAG CAAAACTAGATCTAGCGCTTTCTCCGCGGGTACCAATTTCAAAAAAACTC CGATGATAATATTTTGCTTGGCCGGCATTGAGTAACTTTGTCCAGGGATA TATAAAGGTCAGTGGTACTAACGAGACACAGAATTTCTAACCGTAACAGA CCGACCCACGGTAAGATTCTTCTAAAAGGCAAAATACGCCCGTGGGCGTT CGAGTTTGTACAGAATAATGTTATCTTGGAGCACACCTTTGACTAACTTT TCTAATCCGGGACAAAGAAATTCCCTAGCTGCCGTTGGAAAGACCATTTG ATTTTGACTAACATCTTTAGAGCATCTCAAGTACCGGGTGTGTCAAAACA CCCCTATTTTACAATCTTTGACGTACATTTTTCTATTATAGAATATAGAA TATTGATTAATTTTCTCTAATCATTAAGAGAGTTTCTTTCAAACATTTAT TGTGATTGTTTCCGAAACGTTTGTACCAATGAATACCAGTTGCTCTATCA CAAGCTTCTTGTTGCGAGTAGGCTCCGTTCATGAAATCGTAGTGACAATC GCTAAACCACCAACCTTTAAAACAATAAGTAGAAATTGCACGTCAGGATT CACACAGCTCGAATAGTCGATCAAAAAGACTACCTTATCGGCCCTTTTTA CGCCGGCCCTAATTTAACGCCGGCCCATTAAACGCCGGCCCTTATTACAT CACAGCCTGATTTTGGAGTAAAACAATGGATAATAATTTTTGTCTTCCAA TCATACCTAAAATCCTTTGAATTGAGAAATAATGATAAAAAATTAACTCC GCTTTTAGGTTAAAATTGCAAAATCTTGGCCCTTTTAACGCCGGCCCTTA TTACGCCACAAGCCCAAAAATAACGCCAATAAGGGCCGGTGTAAAAAGAG CCGATAAGGTACCAGTCTTCGTAATAAACAGCGCTAGTAGGAAGGAAAAC ATGACGTAGCCTAAAAGACGGCCGTTTGTAATCCAAATTACGGCAAATAT CTTTTTTCGACACAAATTCAAAATATTCACCTACCCTAAGGTCTCGAAAA GAACGCACCCCTTCCCCCGTTTATTAAAACTTTATTAATATATGAAATTC TCCCCTTCTTCTTATCAGGACTGGCCCCGCCAATTAGGTTCGCGGTTCAA AAGAAATTTCGGGACCCTTCCCTTTTATCCGGACTCCCTCCCCTCCTACT ATTTGGGACCTTAGAGTATAATGCTTGCCTCCTGGAAACCTAATAGCACA AGTTGGAATTGGTGTGTACAAATCGTTGTCACGGGTCGGAGTGCTGAATT TCATGCCCTTCGCTCTTTCAAATAAACTATGATTGCTGTATTGAGTTCCA CTGTAGATAGACTGGAAGTCGAATTTGTATCTCTCCATTAACTCAGAGCC GATGGTAAAACCGGCGAATCTTTTGCTCTCCCAAACACCGGAAAAATCCA TCGCCCTCGCGTATAAGTCATATGATTGCGTTGATGTCAACTGATGAAGT GTTTCAAGACCTAACCAATATTCTCCTGTGAATTTGATGAAATAAGAAGA AAACTTTAACTCTGCACTATGAGTATTTAGGTTTCCTTTATCCTACACGT TTTCAAAATAAAAACAAACTATACAAGAACATAAGGCTTCGATGGCTAAA ATGTTAAGAACAAGTTGAAAATATGTTAAGGCTTTGTGGACAACACCCGA TTTCTTAAGAAAATTGGCACTCACACTCACAAAATGGGGAATTTAAGAAC ATATTAAGAACATTTTTAGGCTTGAAACTCAAAAAGTAAAGAACATCCGA AGGCTTCAAAATTTGTGGATGTTCTTATAAAAAAACGAGTACTTCTTTAA ATGCTGCGAATGTAAAATGAACATCAAGTTTGGTCTTGATTTTCTTTTAG TTTGATTTTCTGTTATTCATTACAAAAGCTTGTTCAGAAATATCTTACCT GACCCATCTCCAAATCCATCTTTGTACTCTGCCCATTCTTTATCTTCAAA TGAAACTGAACCATCATAACGCCTTTGAAACGCCATCCACCCTCCGCCCT CGCCTTCCATGAAGCAATAAACATCACGTCGTGTTCCTAACAAATCTACT TCGTAAACGCCATTTTTCAAGTGTCCTTTTTTTGAATAATCAAGACAACT TTTACATGTCGTACAAACTTTTTCTAACGGTTTCGAATAGATCTTTGACC CCACTTTCATATCCAACTCTTTGAATTTGGTATAATACTCGTACACAAAA TCAAACAATCGACATTCGACTTTTCGAGGAACTGTTTGATAAACCTCGAA TGAGAGACATTTTTCATTGTAAACGCATTGACCAAAACATTGTCGCTCAT CCATAAGAGATACTTCGTAAAAAGGCTGCCAGGCGTACGCCTTACCAATA GCAGCATGGTTCCAAATTTGTTTTGAACATTCACACCAGTAAATGCACAG AATACCTAAGAATACAGTTCTAAACATGATTCTCCGAGAATAGAATCCTT TTTTCCTCTTTGTCAGATTTTTTGTTGTTTATGATTTGTTGCTTGATAAA CTAAAATTTTCAATTTTTTTTTGAATTATTTATTTGAATTTTAAATTGGA AACTAAATACTGAATAATATTGAATGTTAAGTTAATCTAGTTTTCTTCAC TTCAATCTAAAACAAATGGCTTTTTTGTGACGTCGTTCAGAAAAATAATG TCATAGCCTCATTGTTTTTTGGCCTTATTTTGCCCGAACAATTATAAATT CCTCCTGGCCTTCAGAAGAACAGAACAATATAAATTAAAAAAAAATTAAG ATCCGTACAATAAACCTATTAAGTGTTGCGCCAATGGCAGAGTCTTGTTT GAGTTTACCATGTTTAAAGTGCTTAAATTGTATTAACCAACTCACAGATA CAGATATTTGATGCAATTCTACTCTGTTAAAGGGACATAAAAGTACTGAC AAAATTTGTAAACAAACCGTATGCAGCGGGATACAAAATCAAAACAAATG TCACGTCTCAAAATAAAAAATAAAAACAAATATGGCTGATTTTGATTGTT TCAATTGTTTTACAAGTTTGTTTTGGACACGTGATTTTAATTGTTCTTTT TAATTACACGTGGTTCGCGCAATGTTTACATTTTACTACTTTATGTCCCT TTAAACTTGAGCTCCTCAATCCCAGCAGGTTGNATGTTTACATTTTACTA CTTTACCTTTAAACTTGAGCTCCTCAATCCCAGCAGGTTGAAGTGTGATT TATTACTGTAGTCTACTCAGTAAAGACGGTGCATTATTTTGCTTCATCTG ATGTGGCTTGAGAAAGACAGAGTAGCTCTATCTAGTGTTTTGTATAAGAC ATCAGGACTGATAAAGCTTAGGATTTATTAATGCATTTCCGAAAATTCCT CGATGTTGAGGAAAGCCCGACTTTTTTCGGAATAGCCAACATTGAAAGGT GTGCCCTTCTGATAGATGGATAGATATTTTACGTGGATAGCCCAGTAAAC TAGGAATCTTAAACAACTTCTCTCTTGATTGTTTTCACGGGGTCCACGGC CAGCTGGTTATCAATGAACTGTACAGATCAATGGTAGGGAGTTTGAATTC GAACCTCTGGATTTTGGTGCTTTCACCTTGACAATTCTGCCATCAGGCCA TGAAATAATTAATCTCTATGAAAATTTCCTTCATTCAGGCATTGCAACAG GATATATCGACGGTGGAGAAGAAAGTGGATTCTTTAATCGAAACATGTAC CTTGATCACCAACAGAGCTGAAGAATCGTATGCTGAACAATTACGTCAGA GCTTGGATGGGCTGAAGAAACGTTGGTCTGGCATCATCGATAGTACTGAA AAACAGAAAGAAAATCTTCGAAATGCGGGTATTTTGATCATTTCTTATTC CTCGGGTTCTGTTAGCATGCAGCATCACATGAAATAATCAATTTACATTC ACCTTCGTTGACGGTGAAAAGATACAACCTATTGAAAGATTCGTTACCGT GTATTTCATCCAAAATAAGAGTTTTCACTTTTCACTCAATTGTTGACCTA ACCTAAGCCGAGTACGAGCTTTAGATCAATGGTAATCTTAGCAATGCAAC GAAGCTAGTCTTAATAACGAATAAAAAACTGGGAACTAAGATTTTTTTTC ACCAGCATAATGTTCAGTGGAGAAAGATAAAACCTTTACTATATTGAATT TAAAAACAAATGATACCACAATAAGTTTTTTTAAGAGCAGAAAACTTTTC GATTTTATTAAATCATTTTCAACGCTAAAAATCTTTTCTCTACAAGATAG ATGGTAAATTTTCGAAGATATTTACTTTATTGAATTTGAACTTGTCTATA AACAGACCCGGGAATTTTAAAAATTCATTTCCGTACTACAGCACGCTATA CGTGAGATACATTCTGGTGCAAAGTAAATTCGAATACATTCCTTCATTTA CCTTTAGGTGAAAAGTTCCAACAAATCGACGATGGCGTCAAAAAGATTAT GGAATCTCTTGGTCAAATTGACAGCGCTATATCGAAAGAAGACTTTAGTC TACTTAAACAAGACACGCTTTTAAGCAAAAAGCAAGATTATCAGGTACTG TCTCTCATATAGTTTTTTATTTGAAGTGGGAATTGAAGTTGAGTTCACTA TTGAATGTCACCAATGATTCTCGTCTTTTTCTTAAAAACTATACGTCTTT AAACATCTGGCGCTATTGCTGATTAGAAAAAAATACGCGAAATAATTTTT TTACAAGTCGAGTTTTGGCTATATCGACCAATAAGATTCAAAGAATGAAT CACTTTCGATGAACTACACAAAACTTTGCAAAATATCCTACATTTTAGTT GGAAATTCCTTAATTAAGACTTCGTCGGGGACAGAATCTCGCGTTACTTC ACCGAAAATTATGTCAGAGTTTTTTTTGAAAAATCCTCCCCGGCAAGGTA TTCCTCCCTTAAATGTACGATTCCTGTTTCCTTTAGACATACATTACACG ACTTGAAGAGCATGATCAACTTCTAACATCTCACACCAACACCATCAACG CCCTGATCACCACCACCTCCACGCCAACAACACCACCGCCTACCGAACAA CCACCCGTCTGTATTGAAATCGAAAAAACACGAAAAACTATAACCACTTT GAGAGGACGAATCGAGTAAGTTATTGTTGAATTATTTTCTTATGGAACGT TTGTGTTATGGTAAGTGACGTCATTCCAGCTTCCAAGCTTCGAAAACACC TTTTTAGAGAGTTTCTTCTGAGAGCTGACGTATTAACCTTAGCAAGTCCT GTCTGGAGATTACAAAGTATTTTAAGACCTTTTTAAAACCGGGAAGAAAC ATCCACAGGGTATTTGGATTCTAGGGGATTCAAAGGAGACACATTTAATC TTTCTTGGGGTTTTGTAAAAAATATGGTTTACAAAAATTTCGATTTAGAG TTTTATTTATGTTTTGCTTATAGTCAAGCAGATGCGATCGAGAAATAGTT TTGGTCGAGCGTAGGAATTTTCTATTTTTTTCTCGAAAAAGTCAATAAGA ACATTTGTTTTGAGTATTTGTTTTGAAAAGTTGGAAACGAAAATCGATGA AAATTTTCCATTGGAGAAGTAAAGGAATTATCGAGAGCTCAAATTTACCC TTCCTTCCTATCTCGGATTCGGATTTGCATGGCGTAGGGGAATTTTGAAA TCCTTAGTGCGTGAAAAAGCTTTTACAAGGTTTATGGTTGGTTGTTCGAA CTTTTTAATGTGAAGAATCAATCCTGTTAAAAAAATGATTCTGGAAATTT TGGAACGATTTCAATTACTTGTCTTTGCGTTCAGGTAAAGCAACATTTAT TGCATCAAAATTATTTTAATTACTCCAAAACGTAATAAAGGTGCACAAAG TTTGTACCCGGGATGGATTTCAAATTTATGACCGATTTACTTTTACATTT TAGAACCAATCTATCGAAATTGACGTCATTCAACACAGATTTAGAAGAAT TGAAAGCCCTGCTCGAGAATGTTAATAAACTTGCCGACCAACTAAAAAAT GAGATTGTCAATTTAACATCCAAGCAAGCCGGAGCTGATGAAGAAATATT AAAAGAATGTTTATCGGTTCGTTGATAGTCTCTGTTTGTCCTTGATATCA AGTCGTGTGTTTTGGCTTACTTACCACTCTTTAGAGATTAAAATATAGTT AATTAATTCCAGACATATCCATCCAAGTAAATATGCATTTTTTAATTTAG AATTGATTGTGACATAATCTTTTTTTACTTCAACCAATTAGACAATTAGA CTTATTTCTGCCCGTGTGCGTGTGCCAAGTGTCCGCTTATAGAGATGTAA TATAGTTACAAGGTACTTAAAGGAATCAATGGCAATCAATAAAAAAGCTT TCCCTTCTCAGCGAAGTAAATAAAGAAACATCTCCGTCTCAAAATTCGCA AAAACTGCAAAAATAAGTGCTAATTTCCTGTGTAAGATCTACACTTTACG TCTCAGACGAAAAACCTTGTTGAAAAAAAGTCAAGATTTCGAAATAGTGT TTTTTATTTCATTCGAACTTAACAGCTATATCTTTCCCTTTTAGAGTATA CCTGCCATTACAGCTATATCTTTCCCTTTTAGAGTATACCTGCTATTAGC GAACAAATCGAGACAGGCGTTTTCAAACAATTCGATGAAATGTCAACGAG AGTGTCCAAATCGAATGTTTGTAATCAAGTCATTTTGGATATGATTGATG AATACAAGTCACGAGTGGAAGGCATCAGAGAAGGCTGTAAAAAGGTATAA TTTATACCCAAAAGAAGCATCATTCGATTTACCATGTACCAGAGTATATC TCACGTTTATCGTAGCTTAGACCATGCTCGCATGTGACGGTTCCGTTTCG CTCCGAAACGAAATGAAGCCATTCTATTGGTTACATTCAAGTGTTACGTC ACTTCTAACCAATATAATGGCTTCCTTCCGTTTCGAAGCAAAACGAAACT GTCACGTGCGAACATGGTCTTAGTATGAGGATAATTTATTGTCTCTATAG CAATGTTTTTAAATCTTTCAGATGTTTTGTCTAGTACAGGACTCTATAAC TCGATCTTCAAGGATAGTTTTTTTTTGAACCAGTGGAATGTATAAAGATT ATCAAAGCTGATGTTAGGGAGAAAATTTTAGTTTGAATTTTTAAAAGCCA AAAATAGTAGAGGCTCTAATAAATGGAATTACTAAAATATTTAGTCCTGA ATCATATTATGTTTGGAGCCACAATTGTGTCAGTAGTCCAGGATTTCATC AATACTTTTTTCACTTTTTTTATGACGCCTAGGTTCAACTGATGTTTGAG GGAGAAATGAAGAAACATCAACAGCTAGGCGATGACGTCATTCGAATTGA TGAATGGGTTCGCAAAACATCGAAATGCGTACTTGATCGAATCGATGGAT CTGTCGACCTCGAGGATGACTACATCGAGGTATGAGATAAAAAACTTAGC AAGGTTAACAATGCGAATGGAATCTTCAAAGAATTTTTTCAAGGAAATTA AACAATCCTCATCGCAATGTCGGGGTCATAAGGTGTTCTGATTTTTTTAA ATGAAGCTTCCAAGATGAAGATCCATAGGTTAAAGAACTCATTATAAAAT CATATTAGTACTTTTTAGAAAATATTAAATTACACAAAATGGGTGCATGG TTAATTTTTCCCAAATTTTTACAGGGTCTAGAAGAGAGTATCTCACTAAA CGAGGATCTCATCACGTCTACACGTCACTCGATACAAGAAATCCAAAGTG CCAATAACCAATCGAAACTCGACCAACTCGGCAATCTCTCAACACAGATT GAAGAAATCAAAACTAACCTCGAGAAATTGAAATCTCAACCAAGTCGGAA AGAATTAGAAAGACAATTTGCGGCCCTCGAAGGGTCCGTTTTGACTGATA TTGATAATCTGAAGAGGAAAGCAAAGAAAGTGAAACTATCTTCTCCTGAA GTCAATGATATTCAATGTGCTGTTGAGAATTTGGAGGTAAGAACTGCAGA TATGTGTAAAAGGCCCGAAGGTCAGGTGCATTATGTGTGCCATGTCATGT TGCCTGACAGACAACCAGGGCTTCTTCCTCGACAACGTTCCGTCTCTGAT AGAGATAGGCTAGAAATTTCGCCGGTTTGAGGGGATCACGTTTACCGCCT ACTTGTCTTTGAAAGCTATATTCAATCTATCGGTACTAGATATTAAAGTT AAAAATCCCGCTTCAATTTTTTTCTGGAGAAAGGTTAAAGTCAAATCTAC ACCATTGGCAATGCCAATCTTTTTATTGTATGGATAGACGTTGAGAGAAA ATTGATCTGTATTCTTTTTTTTTTAATTGAAATACATCTTCTGGAGCTGT CAAAGAATCTGAAATCTTCCAGCTTTTCTGTGCATTTCAACAAACCAACT TAATTTGTATTACTAGACTTTCCTCGTATTTATTTGTTTAGGAGCTTGCA AAACAGTGTGATGAAGAAATTAAAGCGAATGCTGATAGATTTGAAGAAAT TGCAAAAGAGCTGAGTGGGCGAGACGATCGTGGACTGGACAAGCAAGTCC AAGAAGTTAAAACTGAATATGAAAAACTACAACAATTCTTGAAAGGTCGA GAAAAGGTATTTGGTTATTTCCTTACCCCTTGAGAGCTTAGTGTTTGCAA GTGTTTTTAATTTATCCGCCTTCATTTATTAGGCTTCTGCTCATCCTCCG ACGAGAAAGTTTCTAATATAGGAAATATATCTATAGAGGTCTGCAATTCA AGCTAGTCATTTATCAGTAAATTGATTTAACGTTCAAATCTATTCAAACC TGGAAGGTGACTTCTCAAAGCATACATAAATTTCGGATTTTTTTAGGTTT TTGCGGATGCGCTACCACTTTCTGAATCAGTATATGCTCACTTGGACACA CTGAACGAATGGTTGTCTTCAACGGTCGAACAATTAGAACAAGTATCCAC CAATCCATTGCCTTCAACGCCTGAAGAATCCGTCGAAAAAGTCAAGGTTT GACTTATATGATAATTACATATTTTGATTCTTGTATAACTGACTTTTACA TCGTAAAATATCGAATCTACTAAGATAAGTATATGATAAGGCTATCATTG TGTCTCACTAACATTCTGCCGATTGGTAGTGTGAAGGTTTCGGTCACAGA CTTGCACTGCAATGGACTGTGCTCGAATTCCAAGTACTTACAGGCAGTAT GTTAGGGAAGCATAGTGATAGACTCTCTACCTTCACTCGTACATCGAATC TGCTCTTTCCTTTTTTAGAGTGTCATTGAAGACGTCACGAAGAAAGCGGA AGACGTGCAACAGTTAGTCAACAATGCTTCGTCACTCGGACAAATGTCGG ATGAACCGGCTTTCCGTGCCATGGAGCAACGTGTTCGTGACGTTCACGAA GTCTATCAATCGCTTTTGACGGACGGCGACGAGAAATTGGACACACTGAA ACAATGGATACAACAGTTAGATGAATACGAGAAAAAGGTGACTGAATTTG TGGCGCTCATCTTTTTTTTGCTTTAAACTATCTATAATGGACTCTCACTG ATTCGAACTTCCTTTGTTCGAATTTTTTTATCATTCCAACAAAGTGGGTT CCCGACATTAGAGTTCGAATTAGCGAGAGCCAACTGTACCTAAAGTCTAT TCACGATAAGTGTGCACTCTTTTTTCTTTTACCTATAACTTTTGAAGGAA TTCTTCAATCTTTATAAATTTGGTATCATTGGAAAGATATTANNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNATCATTTTCACTGGAGAGATTCTTTGATCTTAGGAGATCATCA CTGTGAAGAAATTTCATTAAAATGTTTATTCAATATAAAGTTATGATACA AAGTTAATAAGTGATTGACCCCAAAAAACAGCAAAAAACTGCAGAAAACA GCGTTTTTAGACGTCAATCAGCTTATAACTTTGTTTGATATCTTTTGACT GAATAAATATTTTTGAGAATTTTTTTCACAGTGATGACGTTCGATGATTA AAGATTCACTTCAGTGAAAATGATAGTTATAGCACTTTTCTACAAGATCT TAATTTTTTTCTTCTTCTTTTTCATCTTCATTTTTAGAATTTTTTTAAAG ATTTTTTTATTTGAAATTGTTCCACTCACTAATATCTTTCCAATGATACC AAATTTATAAAGATTGAAGAATTCCTTCAAAAGTTATAGGTAAAAGAAAA AAGAGTGCACACTTATCGTGAATAGACTTTAGTTTATGGTTTATAGTTAT TTGACTAAAATTAACGTCTTTTTTTTCCCTCAAATAAAAAGTCAGCGTGC TCTGTTAAATTGTTTTATAATATCATTTGATATTTAGACTCACAAGTTGA ATTTTAACTAAATACGTCATTTTACCTTGTGCAAGGCAGAGTACCTAGTA TTGAACGATACTTTGAATTCTACTAATTTCCCTAAATGTAGTAGTCTACC ACTTGAAAAGTCACGCCGCCACTTTAGGCTGACTTGTTTTAATCAGTAGT GCGGTCACTCTTAATCACCTGCAATCATTAGAATATTAAAAATCTACCAA AAATATTTGTTTCATCATTTTTTGAAACCCGCATGCTACACACCGTGTAG AGAGTTGCGTGTGTTTTGGAGAAGTTTAATTTATGGTAAGAGAAGAACAT ACAACGTTAGTAATACTTTGTTATGTTTTGAAAAGTTTGCAAATTTACTC TGGAGTGTTCTTTATATAATAGTACAGTTGAGTCTCCATAACCCCTGCGG GGAATACACAAATTTTTTGCAAATTTTGAGATATAGAGTAAGGTTTTTTT TATGGCATTGTTAACATTGAAGGGACCAAAAAACTTGTTTGAGTTAACGA TACAAGTAATAAATAGAAGTTAGAGTTAGAGGGACTGTAATACAAGTCAT GAATAAAATACTGTCTCCCTTTGATTTCCGTTGCCATACCCTTTGCATTC GAAATCTAACTTGGAAAATATTATAAACCGGATTTTGTTCTCTAATATCT CTAATATCTTTAAACACAAGGTTGACGATTTGAACACGTGGATCGATGGC CGAATGAGCATGCTTGAGAGCATCGGTGGAGTCACCAACAAATGGGAAAT TGAAATGGAAACACAAAAATTCGAGGTAAATCATGTAAATTTAGATTGAT TTTGGGTTGTAACCTAAGAATACCGTATGGATATCCATGATGAAATGGAA AAATACCATTCTTATAAAAAATAGCGTGTAATCACTTCGATCAACTTCGA CGATTGGATTGTTTGATCAACATCTCTTGTTTCGAAGGGTCCTAAACTTA GGAATTATTTTTGAGTTGAGGCAGCTTCATATATTCTTGCACTTGAACCT TTAGCTTAGGGCAAAAAATAAACTCTCCTATAAATCGAGGCTTGCGTCTG CTTATCATAATAGTTCCCTTAATTAGTTTTTACGTGTCACTTTGTCAAAA TCTAAGGTTCTCAAGTAAGCATCTTATACCTAGATATAGTCGCTTATAAA GATACAAAAGGGTATTCTGATAATTATAGGGTATTAACAACTATCATTAA TGGATAAAAAAGTAGGATCAATTTGTTTACTGAAAAATAAATCATTAATT GATAAAAACAACATTTGTCTTTTATAGAAGAGCTTACCTTTTTGCAAAGA ATAACGCTTTTAATGATTGATTAAAAACAATTTTTTTTGTAGAGCTTGAA ATCCATGGTAAATGCAAAGGACGCTGACTTAGATCAATTGAAAGCTATCG GCGACGAATTAGTTCAAAAGGGGCGTTCAAGTGTTGTGGAACCATACGAA AGACAGATCTACCAACGTTGGGATGATCTGGAGAAGAAACTGACCAGTAT TGACGTCATGCTTAAATTGAAATTGAAGGTTTGTGTGGNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNGTCGAGTCTCCATAACCCCTGCGGGGAATACACAAATTTTTTGAAAAT TTTGAGATATAGAGTAAGGTTTTTTTTATGGCATTGTTAACATTGAAGGG ACCAAAAAACTTGTTTGAGTTAACGATACAAGTAATAAATAGAAGTTCGA GTTAGAGGGATTTGACTGTAATACAAGTCATAAATAAAATACTGTCTCCC TTTGATTTCCGTTGCCATACGCTTTGCATTCGAAATCTAACTTGAAAAAT ATTATAAACCGGATTTTTTCTCTAATATCTCTAATATCTTTAAACACAAG GTTGACGATTTGAACACGTGGATCGATGGCCGAATGAGCACGCTTGAGAG CATCGGTGGAGTCACCAACAAATGGGAAATTGAAATGGAAACACAAAAAT TCGAGGTAAATCATGTAAATTTAGATTGAATTTGGGTTGTAACCTAAGAA TACCGTATGGATATCCATGATGAAATGGAAAAATACCATTCTTATAAAAA ATAGCGTGTAATCACTTCGATCAACTTCGACAATTGGATTGTTTGATCAA CATCTCTTGTTTCGAAGGGTCCTAAACTTAGGAATTATTTTTGAGTTGAG GCAGCTTCATATATTCTTGCACTTGAACCTTTAGCTTAGGGCAAAAAATA AACTCTCCTATAAATCGAGGCTTGCGTCTGCTTATCATAATAGTTCCCTT AATTAGTTTTTACGTGTCACTTTGTCAAAATCTAAGGTTCTCAAGTAAGC ATCTTATACCTAGATATAGTCGCTTATAAAGATACAAAAGGGTATTCTGA TAATTATAGGGTATTAACAACTATCATTAATGGATAAAAAAGTAGGATCA ATTTGTTTACTGAAAAATAAATCATTAATTGATAAAAACAACATTTGTCT TTTATAGAAGAGCTTACCTTTTTGCAAAGAATAACGCTTTTAATGATTGA TTAAAAACAATTTTTTTTGTAGAGCTTGAAATCCATGGTAAATGCAAAGG ACGCTGACTTAGATCAATTGAAAGCTATCGGCGACGAATTAGTTCAAAAG GGGCGTTCAAGTGTTGTGGAACCATACGAAAGACAGATCTACCAACGTTG GGATGATCTGGAGAAGAAACTGACCAGTATTGACGTCATGCTTAAATTGA AATTGAAGGTTTGTGTGGTCTTTTTTACATTTCCTTCATAGTTCAACTTA CTTTTTGATTTGCATTACTGCAACTGTAAGTGTGCATTTTTTTGTTGCTA CCATAAAAAAACCATCTTCAAGGGAATTAGCAATCTTTTACCCAGAGCCA CTTGAATCACTTGTTAATTTTATTAATTTCATATGATGTTACAACCTTTC GTGAGCAATCATAAAAAGCGAACTAAGGGACTGGTTTTGAGTTTGGGGAA TTAGACTAATTACGCTGGTATGGAATGGCCTTATTTTTTCTGTTGATTTC TGACGAAATTTGCGTTGACGTAAAATGATGTGATTTCCTTCTTTTGCTGG TTACTGTATTAAAACTTTAACTTTATGGCTACGTAATGGTTTCTTTGCCT TATTGAACGCTGGGAGTCCTTCACTCTAAGCTACCTGTCTGAACAAAGGT GTCACTCACAAGCATAGATATTTTATACAAACATGAGATGGAACTTTTTC GTCTCGAGCTGAAGCAAAAAAATGCAGGTCGTTTGCTTTGATTGAAAAAA TCGTCAGTCTATTCAACAAATATGGTGCATTATTTTTCTTGACTGCTTTT GATTGGTAAATACAGAGTAGTTCTATCTAGTGTTTTATGTAAGATATCTG TGGTCACAAGGCATTTTCTATTCATGATTCTTTTTCTATTTTCTTTAAAT AGGAGTTTGATGACAAAGAAAAAGAACAAGAAATCATGAGATTGCAAGAA GAAAAGAAACGACTGGTTGCCGATGAAGAGGTACGATTAACTTACAGTTG ACGCTCTCTAATTCGATTTTTAAGGGGAATTGGATTTTCGTCGAATAAGA GAACGTATCGCATCGTAAATGAGAGTTTCTTGTTGACCTTAACTTTCAAT ATTATCGGATAATGGGGCGTAACAAATCGTGGAACGTCGAATTAGAGAGC CTCAAGTGTACTTTACTTTTTTCATCGCAAGTAAACTGAACCAAAAAGAA TTACAGTTAACATTCTTCCTAATTATATCAAAGGATCGAGGGGATCATCC AATGATTTTCTTTGAAATAGAGGAAGGTTCGGATTTGATGAAGTTCAAGA CTTTCCAAGCTGAGGTGTGTCCAAGTGTGTCAGTTGTGATATCTAAACTT CGATCCACAAGGCTTACTAATGAATCCTTAGTGTTAGTTAGCTAAAGGAT TGTGTTTGTTTTTCTTGAGGAAAAGAATATACCGGTTCAAGATCGTTCGA AAATCGTTCAAATTGCGACAAAGACACATTGATTTCCAATGCTAACATAC ACGTTAGATAATTAGTTTTTTAGAGGATACTAATTAATAGTAATAGCTTT TCGAATGCAACCAGCTAATTAAGAGTATATAGGTTTAGCATTGAGATGTA AATTTTTTGTATCTCAGAGAGAAGGTAGTTGAAGAATCGAGTGCATTTTT TTTTGTTTTCTGAAATTAATTTTGTTACATGTAGTTGTTCCAATAATGGT TTGGATTGGGTTCTGGTTTTCCTAAAAATTTCAGTATTATTTGGACGCAA CATTTTAGGGAGCTTTTCTGAAAGAATGGAAAGCCTTTCGGTTAAAGGTA TAAAGGTTAAAGGTTATTTAAATTAATGGTGGGGGAGAATGGGCGAATCG ATTGTTACTTGTTATTTGGTATTTGAGGTTTTGAGTTTTCAAGTATAGTT TGATCTGCGTGGATAACTTTCTTTGCATTCGAATTAATGGTGCTACAGTC TTCTTGAAGAAAAACACACACTTTTTAAGCTTTTTTTACGATATAATTAA CCAAGATTATGACATTTGTATGCAAGCAATTTCCGTGAAACAAGTTTGCA TTTCCTTTGCGAAAAAAAACAATGAAATTATACTCGCACAAGTAAAGNAA TTTCCGTGAAACAAGTTTGTATTTCCTTTGCGAAAAAAAATTGAAATTAC ACTCGCACATAGCAAGTAAAGAAGTGAAGGAGTTAGAAAGTTAATCCTCT CCACTTCTCAGGACACAATATTCATTCAGACAGCATTTTTAATTTCGCTT AGCGAAAGTATTACGATAGCCTTCCGTGTATGTATGTATGTGGCGAGACA TTTTTTGGGGCGCAAATTATGGCGTGGNCGTACAAAGGACATTTAGATCC AGCCCACCATACACCACTGCACAATATGCAGCAGTCCCTCTTTAAAATGA TGACAGTTTTTTATCCGATGAATTTTGATTGGTGCTAGATGAGTTTGGTT AGTAAAAGTTCCAGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTATCACAAGTTCCTTCAAA GCACAAAACGAGGTTTCTGGCATCAAAGAATGAAAAGTTCATTTTTTCTT TTTCATTTTCAAAAAAAATTTTAATTATTTTTCTCAAGTATATTGCAGTT CTCTGAATTATTCTGAATTGAAAGATCTTGTTTACGCTTTATAGTATGGA ATTCTTTAGTCGCATTTTTGAAGGAATCTTTTTTTTAATGGATTGAGATT TTTCATTAAAAAAAAACAGGGTATCTATGACCTGTGTGTACAATATATNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNTGTGTGTACAATACATTGTGTATATTTTGTGTAACGCTTCATTCA AAATGCATAATGCTGCAGGAGTCACGTTTCACGCGTCTTCGTCGTTGATG TTCGAGTATTATGCGAAATTTTCGACTTCAAGTCGTCTTGTTTGTATGTC AACGAACGCTTATAATCCTGTCTTTTTCAAAAAATCTTTCTTCTGGGATA AGCAACAAGATTTTCGAGTTGTCCTAAGTAGCACTTAATAAAAATAGGAT TTCAGCAGGATTTCAATTTTAAAGACTGTTTGTCTGCGTCTTACACGGGA GAAAGTAAGGTTTATTCATTTTATGTTTTTTTTATCATCTACAGTGGCTC GTTTTGTATGCTCTTGACTCTATGACGAATAATAGTAACCACTTCTGCTG ATATTTTCTCCAAAAGTATTATAAAGTTTAGTTACATGGTTGGACTTCGA CAGTACGTTAGACGCTAGTACAGTGGAGTCTCCATATTCAAAAATTTGTT CGAATTATGGAAATCTTGAGTTTTGGAGATTGGTATATAAGGCATTGTTA GTTAACTGAAGGGACCAGAAAACTTGTTCTAGTCAAGGAGACATTCGAGT TATAGAGGTTTGAGTTATGAAGACCCCACTGTATAAAGATTTTGAGGTGT ACATTTGAATCGTGCAATCTTTCCGAAGCAGTAAAAAATTGTGTTTATTC TGTTGTTTGCTTATTTTTCCTTTCATTGGCAGTGTTGTACTACAACTAGT TGATATTAATGTGTTATTTGCCCATTCAAATTTTTGTACCCTAGTTGTTA CTAAAAAAAAACATTTTGCAAATCTATTTGAGGGTTCATTTTTAAGGCCT TGTTGCAAATCATTTTTAGAATGTTTTGATATATTTTTATATATTTTTTT AGCTTTTTCTCATTGCAGCTTGTTCTGAACTGAAAAAATTTCTTTTACAC GAACATAGTTGAAATCTCTTTACAACAGTACTGGTATCTCCATACTTGTC TTTTAAGATTGTATTTTGAGGGATAAGAAGCATAAAGTGAAAAATTACTC TAGTTAATTACAGAAAGTTTTTTTCCCTTTATACAGAAAAATGTCCTTTC CCTAAATGGTAGCCAGGAGAAAGATCAAAGCAGTTGATGATTATGATTTT AATTCAGTAGAATAACTAGAGGTTCTTCATTTTGCTTTTTTAGGTCATTC TAACACAATCTAGTCGTGTGGTGGAAGTCCACGCAGGCGTTGATATTGAC TTCGACCAATTAGATTCTGGCTTACCCCAACCCGAAACTAAAACCGATAT TTCGATTTCTTCAACTCCTACCGATGTCATCATTAGCAAGCAATCAACAA ATGTTTCTGTTTCTGTGGTAACAACGACAACGACGACTAAACGATATGAA CGAGAAGAGAAAGGTTGGTCTTTTTAACATTTTTACTGTTCCCCTGTTCT GTAATTCGATCACATGCTAAGAGTAGTTCGAGATATGGAGAGCTCGAGTA AAGCTATTTTCGGATGCTTAGTGCAAATGATAGTTTACGAGTCTAAGGGA GAGTTCTACTTTTTTGGTTGGCATGTTGTCACAGTCTTTTTGGGGGACAC AGGGCCCATGCCACCAAGGCAACAAGGGCTATGTTTACTTGGAAGGGACT TGGAGTAAGTTCGTTGCTTGCAGTAGTAGAGTGTCTACTATAGAATTTAG AGTCAAAAGGATGGCCCCAATGACAATCATCTTCAGGAGGTATTAGGCGG GACACAATTATGAGAAAGAATCACCCAGGTTATTTACAAGAAGGAAAAAT CACTTAGATTTTTTGGTCACCGTTGGAAACACTTCAAGCATTCATTGAGA ACAAAAAAGTATGAAAAAGGAAGAAAGAAAAAATTGAAATCCTCAGTCCT CCTGTGCTTTGGGTTTAATCCATATCAATGAATGAGATTTATTAAGTAAG CAAGCAGTGTAATCTCTCATCTGTTTTCAAATGGTATCTGACAAGATTAC ATAAAAAATGGATCAATACGATACTTTTTCATGTTATGTTTGTTAAGGAT TCAAAAGGGATAACATACGATTATAATTTAGCTTCAATAATTTAATGAAC AAGTTTATTGCTCATTTGGCTCTCCTTGAATGTAATATCAACTGTGCTGC ACTGTCGGGCTCAATCGAACTTGCTTTCGTTTTCAAAAATAAAATGGACA TACCTATCTATAGTACATTTTTCCTATAAGAACTTTAATCAAACATTGAG GCAGATTTTTGTCAATGTAACATTGAAATGTCGATACAAGTAAGGTGAAG AAGTAAGCTGGACATGTTTTGGATAACCAAATTGATTATTTCGAAACTGC AAACTTTCCTTATTCCTATACTGGAAGGTGTCATAAACCTTCATTATCCC TTAGGTTGTTCTTATAGAGCTAGTTTTTTGTGTTTTCTATCCTTTAACAT TGGACAACTGAGTGTCAAACTGTTCAAGAGAAAGTCTCCCAAGAAACAAA TTTTAACAAAGTTTATGCTATATGGGCTGCTCGTTTTTTATTTTCATACT GTAGTTCTTATGATGAGATTTGGAGAGATGTATTTCTATCAAAATAGAAG ATTTTTAATGAAAATTTTTTTTATATCAGTGCCGGGAGACAGACAACATA TAAGTGATATTTTTCATACGTTTATTTCTGTTCATAATAATCAAAGTTTT ACTATGTTATTATTACACACTGATGATTGAAAATGAAGAATTTCGCATTG GTGATTGAAAATGAAGAAGAGAAATTTACTTTACTTTAGAGATTCCAAAA GCAGAATTATATACTGTTATTGAAAACAAGAAATCGTATGGAATCATTTT TTCACCAGTATTATAGTTATAGATTGGTGTTATGACGTGTTATGAAAATA TCGAAGAATTTTTTCAAGAGGAGATTATTATGATATTTTGAAAATAAAGA ACCCTAGAGAACCTCTTTTGCTATTTGGGGACCAACAAGGACAGAAATAA AAAGGGGAAATTAATTCAAGAAATAGAAAAGAATTAAAAGGACAACAATA AAAGGACAAGGAAATCTTAAAACAAAAATGAAAATCTTATCGAAACGTAT TTTCAACAAAGTCTTTCAAGCTCATGGTGTGTTTCGTTCTTTGTTCGATC TCATTTCTTACAGTTGACTCTCTCTAATTCGATCTTCAAAGGCACCAAAG ATTTTCTTCGAATAATAGAGAGTATTTTGCATGGCTTCCCCTTGACGGAA ACTGGGAATCATTTCGAATTACAGAAAGATTCGAATAATAGAATTTCGAA CTGGCGAGAGTGCATTATATTTCTTATTGAGTACTTTTTCTATACACAGA AGGTCTTATTCGATGGGCAGGGCATGTTGTGCTGCATTTTTCCAAGGAAC TAAGTGATTTAATCAAGTCAACTAAAACTCCCTGAGCTCTCTCTAGAAAG ACCCGTCGTTTGTTAAACCTAATATTTGATCCATTCTCATAGAGACCCCA AGGTAACTTATAGATGCTTTCTCTAGATTTTAGCTAATGCGATGGAGAGA AGTTAATACGATAGTCCACCTTACTCCAAGTCAATCTTCTGCTTTTTGCA ATAAGTTTTAAACCGAACTCTGAGGTCAATGATATGGCAATGTTGTTTGG GAACCTTGTCACAAACTCGTTAACATAGTTGTAATAGTTTTATCCTCTTT CCCTTTCCCCGAAACTAAATGGTGGTCTAGTCGAAAATATTCTTAACAAC GTAAACTCAACGAGATTGTCTCCTCCACAGATAAACTTCATGATTTTTCA TGCATCTTTGTTTGCTTTTCTTCATTGCAGTGAGCGTCGAACGTGACTTG GATGAGATGATCACAGAAATCGAATCCATTGAAACGATGTTGAAAGATTT AAAAGCTAACGATGAAAACGAATTCAAAACTACAGAAGAAAATGCACAGG TATGTATAGCCTAGAAATCTAACCCAGATTGATTCAGTCACTTAGTAAAA TCTGATGGTAAATTGTGACTGAATATCTGTTTTTCGAGGCAAACTTAAAA TTCCGTACGTATCATAAAAATCATTAAAGCGCCGATAACGCTATATTGCC TTCAGCCGTATCTTAGCCTTATAGAAACTGGCTTGGTTAACCAGGCTAAG GTATATAGAGAAAAGAAGAAAGGAATACAGTGTTTTTTTTTCACTTTTGC ACTTTTAAATAAAAGAGACAACATTTATTGTCCACTAGTTTTCCCTTCCC TTATTCATTTTCTAGAAAATTCTATACCCCTCATTGTATTCCTTGACAGT ATTTTCAACAAGTCTATAGCCCTCTTTACATTCTTTGAGAGGATCTTCCA CACCTTGATACTTTAATCGCCATCCATGAGAAGCTTCTTTATTTGTAATG CAAATGACTTGNAATCTTCAACACCTTGATACTTTAATCGCCATCCATGA GAAGCTTCTTTATTTGTAATGCAAAAGACTTGCTTTATTCTGCTATCTGG CTATGTGTCAGAGGTTTGGTACAAGGAAATTTGAATTCTCCTAATAAAGT CAGCTTAAAGTCGATTTATTAACATATGAAGCTAGACAAGCTGGCTGATG TTTTTAAAATGGTATCTTCCTTTCATTTTTTATTCACTAAAGCTCTTCAA AAAAAATTATTTTAAATTTACAAAAAAGTCTTCTATGAACGAATAAAAAA GAAATTTTTGATATGTGCCCTAGCAGACTCTCATGATACTTTTAGTGGGG CTTTGGGATTTTTTGTGATACAGTTGGCTCTCTCTAATTCGATTTTCAGG GGACCAAAAATCTTCTTCTAGATAAAGAAAGATTCGAATTACAGAGAGTA TTTTATACTATTTTTCAGCTGAGGGAACCAATATTTTAGTTCAAATTGTA GAAAGCTTCAAATAGTAGAGGATCGAATTAGAGACTGTTGTTTGTAATAT CAAACCTGGTTATTTATAAATTTTGAGCGTCAGAGAGTATGAATTTTAAA ATGGATCGCAAGTTCGATTTCATCTTTAAATTAAAAATGATGCTTGTCAT CTACCTTAAGGTACCTTTGTAAAATGTTTTCTCTTTTTCAATTATTTACT TCATCAAAAGCTAATATTGCATTACTGCCGCTTTCTGTGCGATTACCTGC TAGTAGCATCCCTTTGCTAAGACATTCCTTCCGTCCGCGCGTCTAAAAAA TCATTTTGATAAAATACTTCCGCGCGTGCGAAATTTGATTTCAAATTTTG TTTCACGAATAAAATTCTTAAGCAAACAATTGATGTTTAAATGTTGCGTT AGATTAGAATATCGTGTTTGGCTAAGAAAGAAAAAAAAGAATAAGATATT TTTGAAAGTAAAAACTCACATGAAATGAAAATATTTTAATGTTTTATCGT TTGTCAAAGGTCAAAATGATAATTGTATATTAAGCCTCGTTTTGATGTAG CCTCGTTTTAAAAATATATAAAGAATGCCAGGAAGTGAACGTCCGTGCTC CATTGATCTCTATTTTCAGAAACTGGAAGACCAACTCAACTCGTTGCAAC CCGACTTTGAAAGTTTAATGACAGATGCTAAAGAGCTTATCAAACAGTTA GGACATATCGAAAAGAAGGGACCCATTTTGGACCTGTCACGTCGCATGAG TGGTGCTCACGCCAGTCTGGCGATCCGCAAGAAAAGCTTAAGGAACGCAG ATTCCAGATATTTCAAAATGAAGAATGACTTAACAAACGTACAAGTTTGG TTGGAAGAGACCGAGAAAGCGTTGAGATCAGGAGACCACGATCCTAATAA AATGAAGGTATGCCCGTAAACACGTGTTTGCGCTTGTGGTGAGCGGAGAA AAATAGACTACTCCTCAACAGGGTCTTAAGAATAGACCTTTTCATAAATT ACTTTACGGACATCACTTGCCTCGTTTTGAAATTATTGCCATGTATGGTG ATTAACTCCCGGCAGATTTTATTAAAACTACTTTCTATCTGTTCATTAAA AAAATCGTTTATGTATCATGAATACGAGGCAAGTGATGAAAAGGTCTATT CCAAAGAACTAAAATTCTGAGCGTTACTTCTATCCGCAGACACGTGTTTC TCCCTTCCCAGTACTCATCAGTGTGGCTCCGGTAAGCGAGAACATATATA AATAAACGGATCCGTCCCTCGTAACTTTTGGTTTGACAAACTAAATAGTT CTCTAAAGATATCTTTTCCTTACCTTAAATTTTCCTGTCCCTTCCTATCC TATGTTTGAGTTTCCCCTACAGTATTCATCGTTGTTCGTTACTTATTTTG TACACAAATCTTCATTCCAGTTCATTGAAGAAAACATTGAAAGATACGCA GCCGAAATGGAAGGTGTTAACATCCGTGCTGAACAATTGTCAGACATATG TGCCGATTCTCTCATCCCCAAACGACAAATCTCATTATTGAACAAAAAAT TCAAATTGGTTTCTTACCAGTTGGAACAAGTACAAGCACCAGAAGAAAAA GGTTTGGAAGTGTTTTCGTCTATTTCCTCCATGCCGTAGATCACTGACCT TTATATACCCTGGACCAAGCAAAATCTTTGATCGGAGTATTTTGAAAAGT GGTACCCTAATGGCGGCACTACTCAATAGCGGTGTAAATGCATCGAAAGC GCCGCTAGGTCTACTTTACCTCTAGACTAGAGTCTACTTCTGGCTGAACT TTGCTTTTTGATAATTTTTGATGACGCNTAGGTCTACTTTTCCTCCAATA CTTTTGATGATGTAGTGCCGTTAGACGTTAATTTTTAACATCGGGTACCA ATTCCAAAAAAACTTCGATCAAAGATGGCGGATATAGCTAGGTCCAGGGA TATATAAAGGTCAGTGCAGTAGACACATCCTTAAGGGAATTTTGGTTTAG TATTTTTACCCTTGTATCTCTCAATATATTCTTTCAATGATATCCTGCCT GGAACTGAATGGTTGGGATAGAATTGTCTAGAAGTTGATCAACATTTCTG ATGGTTGTTGACAGAAAGGGGACCGTAGATTTCACTTAAAACTAATTTTC AAAATAACATTCTTGCCCTTTACAACATATTTCAAGGCCTTTTAAATTGA TTTAACTTTTTTTTCTCCATAGAAACCACCTACAAAATCAGCGTCGAGAC AGGAGACGTCGAGAGCGCTGACACGCGGGCTAGTGTCAACATCAAATTAT TCGGCGAATACGGGAACAGTGATCAGCTCCAGTTACGTCAATCCGAAACA AAACGTAAAAAATTCCAACGCGGACAGGTGGATTTGTTTACGTTCCGTTC ACAACCATGGCTTGGAAAACTTTCCAAATTACGCGTCTGGCATGATAACG AGGGTTCAAACCCTCAATGGTTTCTAGCCAGTATTTATATACTGGATGAA CTGTCAGGACGCTTGTTTTGCTTTGTCTTCGATTCATGGTTGAGCAAAGA CGCAGGTGCCGTTCTACGTGAAATCCCTGTTGGTGCTATGGCCCTTTATA AAGAAACTGGTGCGTTACTTTANAGGTGCCGTTTTACGTGAAATCCCTGT TGGTGCTATGGCCCTTTATAAAGAAACTGGTGCGTTACTTTAAGATTCCA TTTTTCAATTTTTTTTTAATCTATCACAATGTCGAGTCTCTTACCTCGGA CTACAACTCGAATGTCTCCTAAACTCAAACAAGTTTTCTTGTACCTTCAG TTAACAATGCTTCCATACTCCATAACTTGAAATTTCTATAACCCGTGTAA ATTTGTGTTCCCCGTGTGGGCTTGAGTTATATAAACTCAACTTTATATAC GATGGGCGTGTATTAGTAAAATACCACAGGGGATATTTTTTAGAGCCCCC TTCAAGGTCTTCTAAAAGTAACCGTAATATTGTTACAATTGCTTCCTCTA AAGAATGCATTGTTTTGAAATTGGTCCCTTCACCGGCTACAGTGACGATT ACTTTCAACAAGTTCGATCATTTCTTTTCAGCTCCAGATATCTTGGCCCG TAAACACAAGTTCACAGAAGTACAATGGTTATTCGACACTTTGAAATTGA CCTCATATGAGAACAAGATGAGAACAGTTGAAGAACTTGTACAGGATATT CAAGATGTGATCAGAGAAATTGAAGAAATTCATGCCGTTTTCAATGACGA GTGCTTCTCAAAGAAACCGTTCGACCAGTTGGCTCAACAACAAGAACTTT TAAAAGTAAGATGATTTTTTAACATAGCATGTCGGGTCTTCCCTTATCTA GCCCGGGGCCACTTATAGCTTTTTGATTGACTTGAGAGATCCAAATTTCG GTGGTGTTTTCATATTTTTACTATATTTTTATAAACTTGGGGTTTAAGAT TACTATTTTATTGCTTTGATTGATGTTTTTATATAATTTTTGAAAACGAA AGTGAAAAATTCCAAGATGTCGATATCCTCTATTCTACTTAGCTGGACCC GTTTGGAGATTCCTCGAATCACCAATATTTGAGATGAATTTTTTTCATTT TAAATTTGTTCTTAAGGAAATGGAAACCCGTATGGACAGTGTCAGTCCTT CGGTGACGTCACTAATGATGGTGCAACAAGCATACATTAACCAAACCACG CCTGAAGAAATGCATAATATTGATGTTCATCTCACTACCATGTGCGCTCG ATGGAATGCGCTGGATAAAGAGTTTCGTCACAGGTATGAGTTCAAGCCAT TTTGGTCAAACTCAGCTTTAAGAAAGCGCGGAGACAAAACCCTATCTTTT TAAATCTACGCTTTCTGTCTGCATACTTCTTATAAATTTCAAAAATTGGA ATATGGCAAAACCATTGCGTTCTAATAGATTTAGAACGCCATGGGCAAAA CCAAAGTTTGGCCTTTTTAAAAAGACATTCAAAATTTTTGAAACCTTCGG ATGTTCTTCTTAAATTGTTTTTATTTTCACCAGTTTTGGTGAGTATTTTT ATATTTTCTTAAGAAATCAGTTTTCAGAGTTCGCAAAGCCTCAAAATGTT CTCAACTTGTTCTTAATATTTTGGCAATCAAAGCCGTATATTCTTATATA GTTTGTTCTCATATATAAAAACGTTTACTAACGTGTACATTTCTTTCTAG ATACGTATCGGTGGAGAAGAACGTCGGTGAATGGCAACAGTTTACGGATG ATTGTAATTCACTCATGCTATTTTTAACCAAAGCTGAAAACCAACTACGA GAGAATCAAAATGATGATGTTGAAAAGGTTTGCCAACTTGTTTTGTTCTC TTTTTCAGATGGATTTCCGATTCAGCGAAGTAAATAATTAGGCTTTCCCG TCTCAAAATACTGCATAACTAACTCGCTCAAGTCTCAAGAATATATGCAA ATTTGCTGTGCAAAAACCATTTTTCGGGCTCAGACAGGTAGAAAACCCTG CTTTGACCACTGATTGTGTTTTCCTTTTTTCATTATTTTATCTTCACGGT AGGCTAGGGGCTCAAGTTGTGCTGCTGAATCTGTAACATCATCGAGGAAC CATTAAGATAGTGACACCATTAGATTCTCTGACTACTTCTAAAGACTTAT TTTTAAACAACAAAGTAATTCAATAAAAGTTTTAACAGTGATGTTTCAAA ATATCAAAAGAGACTTCACTTTCAGACTACAATGCAATGGCTGAACTTGT TTCAGAAGTAGAAAGAAATCTTAAAACATTCTACGATTTCATTGAGCTTC ATTTGGATTCAGAATATAGTATTTTAATAGTCTATAATATTAGCGGGATG CTAGTTATGGAAGCTTATTTCAGATCACAAGACTAGACAGAGTCTTAGAA CTAAAAATCATCTTGTCTAATCATGATTCACAAAGATAAAAAAGAAAGCT TAAGATGATGAATTAATCATTCTATAGACTAGAAAGAACCGAGAGGATGA TCACTACTTTGGTCATTAATTGTCCATTCTGCAAAATTTAAATCTCACTT TTATATCTTCTACAGCACGCGTGGTTTGCTATTTTCTAAATCAAATAATT CTCAATTCATACGAAACAAAGACTTTTAAAAGTCGCCGGTTTTAAAAATT AAAACAAATCGATTTGGTCCCAAAAATGCAAAACTTTAAACTTTTAGGCT CGCAATTTGTTAACTTTGTTTACCATTATGTAATTGCAATAATTTGGCAT TAGTCAGTTTAGAAAATTTCTATATTCTTATAAAACATGTCTACTCTATA AAGAATACGATGACATCATTTTTCATTAGTTTTGTTTGTTTGTTTATCTA CACAGGACCTCTATGATGAGATCAATCGCAATGAATTCAAACTGAATAAC CTCAATAATACTGGCACGACGCTCATAGCCTTGTCCACAGACTCAAATGC TGAGCTGAAAGATAAATTGGAATCGGTAAACAGACGTTGGAAAGAAATCA TGAGTGGATTGAATAGCAGGAAGTTGGGGTAAGTCAGTTTCATTGTTGTA TATTTTGTATTGATATTTGAACGTTTGAAAAAACTTGTGAACTAAAGATA AGCTAATCCATTGGTTTCAACTGATGATTTTCAACAAACTATCTTAGAAA GAGAAGAAAAAAGTTTTTTTGAAGTGAACCAAGAAACATTCTACTAATTA CTCAAGTATAGAATAATTTAGGGATCGGGCTATTCCAGAAATAGTCTGTA CCCCCTATGTTGAGGTCCAGGGCAGTCTGGGAAATGAAAAATCTAGGGTT TTCTGGTTTTTTCGAGTTTACAAATCCAGGGTGGTCCAAAAAATAAGTAC AAAAATCCAGGGGGTCACCTTCCCCAAAAAAGACCTCTTCGACATAGGGG GTACAAATCTTTTCTGGAACAGCGAATTCCTAATTTAGTATTGGAAGTGA CGCCACGATTGCACTCTCTTGTCATTGACCTAGAAATTTTTATATGTCAA ATTTCCTTTCAGTTCGCTACTCAAAGCTGAGCTGATCAAGTGCTTTAAAT ACAGCAAAGTGAAAGCTCTTAGAGCTTTGTCCTATATAGTACTAGCTTTA CTCGTTAAGCCTATCATCAGCTAAAATATATGTAATGGTTGTAAAGAAAA AATTCTGAATATTTTTATAAAAGTGATTTTATAAGAACAATCTTATAAAC AATATTTCAAAGGTTTTGATTTAGTTCTTTCAATAAATCCTGAAGAAATA TTTCTGGAAATTTATGTTTGGTAAAATGTCACAAATTCCTAACTCTTATA TCGTATAGATTATTAGTTTAAAACCAACAAAACTATTCTTGGGCCATTCC ACATTAAGTACTTACATACCTTCATGACTGATATACGTCAAAACCTTTGG CAAAATGCGGGGGCGAGCTTATTGTTCTTAATCTGCACTTAAGAGTGTTT TCTCCCTGCTTTTTTTGATTTTGTTGTTCTTGCTCGAGAGCTTTTTTCAG CTATGCAATTTTTTTTGTAGAGTACAATTTTTTTAGTAGAGTTCACTTTG ATTTAGCTGTATACACATTTTTACTGGAGAGGACTTTAAATTAGTATTCG TTTAGATCTTGTTGGTATGCGAATAAAGGTTATTATGATATTTGTTCGTT TTTCATTGTGTTTAATCACACAGATCGGCATTCTTGACTACACTTTTTTT TACAAGAACCAGGAAATTTTGACAAGGCTCGTTTGTTCTTATTTTTTGGT ACTTTCAGCGTCAAATTGTTCTTATCCTGTTCTTATTTATAGTGTGAAAT TGAATTATTTCATGATGTATACCCAATGTTTACTACTTTGACCCCTAAAT TGCTTGAAATTGAGTCAGTGTTCAAGCATTGTTCTTAAATTGTTCTTATT TTTGGCGATTTTGAGCCTCGTTGTTCTTATAAAATTGTTCTTAAAAAAGG AAAAAAAAGTGTATTAGTAACATATCATATATTTCATATTCATTAACTTT CATCTCTCCCTTTAGATCCCTAATGGATGACCCAAAGATCAAAGAGTTTG TTAATAAATCGGATCAAATCAAAACGCAACTGGACGCCATCTTTAAACTG GTCTTCCATACTAAACCACATCCAGTGGATGCTGGGTCACTACAAAAATA CAGGGATGACCTCAAGGTATGTGCTTTTGTACTTTTAATCTTTTGCTGTT GTAGATCTTTTGCGGAAAACCTTGGACAGCCATCCTATAGAACAGGATGA CTAAATCAAGGAACTTTAATAAAACAGATTAAATTGGAAAATAAGCTGAA TTTTGCTCTTCTTTTGTCTAAAATGATTTATGATAATTTCAAAGTCTGTT CTCGTTAACGGTGTATTTCTTTATGGCCTTCATACGAAAACTTTGTCAAT GCCAGTAGACTAACACCTTCGAAAGTGGTTAATATGTGGTATGAAGAGAA ATACACAATTTGTGAATAGACTTAGCTACTAGCTAATATTTTGCGATTCT TTTTCTCCTTGCACAGAAATGTGAAAATGATTTGACCGATAGAAGGGATG AGATAGGACGTTTAACAGATGATGCCGATCGATTACTTGAACGTCCCGAT TTGTCCGCCAACCAACTTGATGAGATTAAATCACGTTCGACTTCCATGCA AGCTCAAGTACAAGATCTGACCACAGGACATAGTATGTCTCTTAGTTTTT TGGTTGTTTGTTTTTTCTGGTCATTTTGAATGCATTGCTCCCTTTTTTTA TCCAGTAATTCAGTTTTCAATTCCGTTAACCTTAGAAGATCATTTCCTCT ACTTTACCATTACTGAATTCAATAATTCCAAATTATTTTAGTTTTTTTAT GTTATTTTGATTCATGCCGTCCGTATGAACTAGAATTATCAGCCAAAACT TCTAAAAATTCAGAAAATTGATTTATCAAAATATAAATGATTGTTTTCTC GAGCATTCAAAATTTCATTCATTGTTTTTTTTCTTCAAACTTTCAGGCAA ACGATTTGATGTTGTTGAGAACAACCTAGCACGTGCAACACGCTTCCTTG ATGAACTCGATGGCCTTTCCAGTTGGATGAGCAAGACAAGAGATTTATTG GAAGGCCACAAGGAAAACAAACCGGGATATAATGTCGACCCTGAGGTATT GTTGACATTGTTTTTTTTGACTCGTAACTCTTTTTTTTCTGATGATCTTA TAAATTTTAATTAACTCTGATAACTGGAGATATTGGTCGTGAGATCTTTC AAAGAACCATGAATTTTCTTAGTGTTTTTAATTTAAAAAAGGAATAAGCA CTGTATTAAATGAATGAACCTGAGAAATATTATCTCGCTCAATTTACCTT GATTACCCTGATTACCCAGATCACAGCGATCCGCCAGTCTCTCGTATCTT ATCGCATCAAGCCTTTCATAATCTCAACAATTTCTCTCATCACAGATCAT GAAGAAATCATTAGAAACACGTAAATGCAACGTTCTTTCCATCAATGACC TTTTGAAAGACTTCAAAGCTGAAGGGGAGCTGGCGTCTGGGAATTTCCCA CAAGCCGTTGGCGAGAAGATCGGACAACTAAATGTCGACTGGCAAATCAT TATACGTCTTGCGCTAGCGCTTAAAGAACGACCAGTGTCGGAAGAAGTCG TCGTCGCAGAGACTGTTCAAGAACGTCAAGACGCTCCCGTCACGTTTGAT TCGTTACAAACCAGTTTATCTTTCACAACGACTGAAACTTCAAAATACAA ATATGAAAGTAAGAGAATTTTTCCCAAAGTGAGTGTCTAGGATAGGAAAT CTTGGTCAAAATTTTAATGATACCCTCGGACACCCTATGGTTTTGATCAT AATTCATGTTATGCACTATTGCAATGTCTTCTGGTATTATATCACGGACC CAATAGCTGATTGGTTGTATACGTAAAATCAGTCAATACGTCACTTTCAA CCAATCAGCTATTGGATCCACGGAAGACATTGCAATGGTGCATAGCATGA ATTCATTCAGTTAAGCCGTCTGTAATATTTGTACATTATATTGTATCAAT TAATCTGAGTTGCTCGTATTGTCTCTTCTTAGCAGATTCATTGGTAAAAA TAGAAAAGCCCGGGAAACAATTAATCTTAAGTGATTTCCTAACAGTATCC ACTTCCAGAAGCAATAACACCAGGCCTTCAGCGATTCGAAATAAATGGTG GTGGCTCGATCTAATACGCTTCATTGGAACTCTGCGATCCTTTCTTGGTA CTTCAAATTTGGTTACCCATGAGTCTACATGGGCTACCTTATCTTTGAAA AAAATGAAACGATAGGTCGCTTTTGTCGTAGTGCGTTTTATTACCTAGTA TTATATATGCTTATAATAAAAATCAACAAAAAGTCATCTAATTAGACCCA TCATTATCACTTAAGATTGTTTTCAACGGTAGGAGGTAGTTATAGTAATT ATTTAAAAAAATTTTTTTCCCTTTTACAGTGTATTCTTCAACGAACGAGA ACAGTATCGGTGGCGAAGGAGAGACGGCTCAACTACACGATTGGTTGAGA TTGGTCGAACAGAAAATCAAAAGTCTGAACGTTACCCTTGGTGATGAAGA TGAAATGGCGGCTGCCGTACAAAAACAAAACGTAAGTTGGTGCTGATTTA TGGGATTGAAGAATTTTAAAACCCTTTTTCATTAGGTCTTGTATTGGTTC AGTGGATCCTCTCTGTGTCAAAGATTTTTATAAATTGAAGTTTGGAATTT CTCTTTGAATCTACCTTTCAAAACAGTCCTTTCTATGGGCGAAAGTTTAA ATTTGAAAAGGTATTTCAGCTGACAACGTTCTTCCCTTTTTCGTTCTCTG CATTTTAAAGACTATCATGTCTAGTGTTTTTACAAGTTCTTTATAAATCG AGTCTCGTCGGTTTGTCAAGCCCTGCTGTGATGAACCTACCGAGTTAAAC TATCGGTCCTTGATGAAATAGAGAGAGATCACTGTACAAATATTTGACCA ATCAAATTGGGTTTAAACTAGTCATAGCTTTCACTAAATGCCCACGCAGA AGATCATGTCAAGCACTTAAAGCTTTTAATGCTTTAAAGATTAAAGTAGT AAAAATAATCAGGAATAATTGATTGATTTAATTATTGAATGATTGATTAA TTAATTGATTGAGGCATTGTTTGAAAAAAACATTATATTCCATTAACACA ATAGACCTTTTTTTAAAGAGGCAGCCATGTTGAATAATTATGTACTCCAG CATAAAAACAATGATACAGCCATGCATAATTTTTGAAANNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAATATATTT CAAAAATTATAGTATCATTAGCTTACTGGTTTTCACATCTTGTTTGTTTT TTTTCTCCCAGTTTCTTTCTTACAACAATATATGTCATTATTATTATTAT TCACAATAGACCTTTTCTGATAATGCCGCAGACATCTTAGATTGTAGGCA AAATATATAGCGGTGACTGAATAAATAAAAAAGGCAACCAATCAGAAATA GCTTGTTTTTTTTTTCATTGGCTGCTATAGTTCAACATTTCTCTGTTGCT ACTTTGCCTAATAAACAATAGTCAAGAATACTGCGTATAAAATTTATCAA AAAGTTCTGCGCCATCTTAAATTGGGTGAAATAGAAACCAATCCTAGTTA AGGCCCGGGCTCCACTTGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTAAATTACAGTA GTTAGTATTCAGTTTCAAAGACAAGAAACTAAATTTGACATACCAAACAC TTTTTCCAGTCAATGAATCAGCTCATCATTATAACCTTCCATTATAACCA GTCTGCCATTTTGTTTGTTTTGATTCGCACAAGTAATATTGTAATTTGTG TTATATCATACACCTGTTATAATTTGCATTTATAACACTNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNCTATGAGTGCCTCCTCGTCGCTGCGCTCCTGCGGGGGCAAAAA ATTTAGTCGGAAGAAAAAACTTTAGAAATTAGTTAAAGAAATTGAAAAAA TTTGTGATTGTGGTGACTTTTTATTTGGTTTTGAACATAAAGAAATGGTA CGTCAGCAGCCCTCCGAAACACTTCAAACATCAGGTAAAACTAACTAAGA ATCAGAATATGTCTTTTCCACGTCTCTATAGAGGACGTTACCAGTCAAAA ATAAAACCTCGAGCTTATGAATCTTTCTTAATTCTATGCTTGCGTCGATT ACAGCATCTCAAATTCTTCTGAAATTTGGTACGAAGATTTGTCAAGATTT TAGCTACTGTATTGAAAAAATGTTTTTAAAATATTTCCGGGACACCTACT AATGGTTGCTAGTCATTTTAGGAAAATAATGATAGCATGTACCAAACTTT TCTTAATGTCGTAAAGGAATGGTCAAAAAATCTAATTTTTTTTTAGATTC TACACGTTTTTTTTTTTATTAGAACCCAGTTTATAAGAACATTCAGGCTG AAATTCGTCGAAAAATTAAGAACGTCGCAAGAACATGCCCAGCCTCAGTT TGGAAAATAATGACAAGAAACTACAATTTTTTTCTCTTTTCAAGCAGTTT CAACCGAACTTAGAGATGGGTTTTCTAAAATCGAGAGTCAAATATTGTCC AAATTTTACCAATTTTAAGTGCTCTTTATTTTGCATGATATTGTCGATTT AGAGTAGTCTGAGAAATTAAGAACGCATTTAAGAACATTTTAGGCTGAAA ATTGCTTAAAAAAAGCACATCCAGGCTCAGCCAAATTTTAGGTGTTCTAA TAAACAAAAAACGTGTACTCGATAGCCTCCCCATAAACCAAAAGTAACTG TGAATATTTAAAATATTATTACCAAACGAATCTTTAAAAATTAATTCTTG AAAAATATCATTTTTGATGACGCAAGTTTTGATACTATTTTCATTCAGTT TTCAGTCGATATAAAGATTTTTTGACAGGTTACACGCAGTGTCGGTTTTT CTTAACTCCCCTGTCACGTAGAAGGATCATTTTCTTTTTTGGGTATCAAA TATTTAAGAAAAAGATTGAAGAATTTTGGAGAAAAAAATACTTTTGGGGT TTATCCATGCAGAGAGTTTTAACAAAAATATCCATATTTTGTGGGTATAT GTTAGTTTTAAGGCGGTACCAAAAGCAAAAGGTGTTTTTTTTCTTTTAAG TTTTATTTGGATTTTTCTCACCCTTCTCCAAAAATCTTTGACGATTCTTG TATTCATTACTTATTTGTTCAATCATTAAATATTGAAATCTTCATTTTAT TTGTAAAAGAATTTTGATAAAATATCATTTTGAAAAAAGGTTTATATAGC TGTCTGTTGTATGCCGGAGAAGGTTGTTTTTTTATTTTGAAAAGCTAAGC TTTGGTTTATGAGCGACCATAAAGCTTTATAATTGATCGATCGGTAAGAA ATCGGAATCTGAGACTTGGGCCATTGGAACCTTATAAGGCTCTAAAAAGG ATTCATGACTTGAAATCGATGGAAAATTACCAATTTTATATTTTCTTCCA AAAAGTACACCAAAAACTTGTTAGGGAAAAATTGTCTGAAACCTTTAGAC TTTGACACTATAAATTTCATTACTGAACTTTTTTCATACCATAGTCCATC CAATTGGAGATGTCAAACCGACGTAAAGAATATGACGACGCTATTTCCAT GGCAACCACGTCACCACAAGACGACGAAAAGATTAACAAGTTGAAAGAAC ATTGGGAAGGAGTATGGGGCAAAGTCTTGAACAAGAAGTCACTTATTAAC CAAGCTCTGGGTAAGGCATTCTTACACTTTTGATTCCGAATAGAACTCAT TCATCCGTTCGTTCGGCTACGTCAAATGCACCCCTGTCTCACAGCCTCGG TAAAACTTTTTTCCTCACTGGGGATAAATTCCTTTTGAAATCCCAATGGG GATAGAAATTCTATTGTAAAAATCCAGTGGATATGATTTTGGAGTACAAT TTTCAAACATTGAAATTTCGAATAGGGATAAAATCAAAGTCAATTTCCCA GTAGGCTAAAATTCAAGGGTATCTTCCCACTGGGGACGAAATTTTGCAAA ATTTTCCAGTGGAATTTTCTTGGGTCCCAGCGGGGACAAATCTTCCTTTG TTTCAAGCGTGACTCTTACTCTAGTAAGGCCTAAAAGTCTTAAGCTGTCN CGGAGAAGGTTGTTTTTTTATTTTGAAAAGCTAAGCTTTGGTTTATGAGC GACCATAAAGCTTTATAATTGATCGATCGGTAAGAAATCGGAATCTGAGA CTTGGGCCATTGGAACCTTATAAGGCTCTAAAAAGGATTCATGACTTGAA ATCGATGGAAAATTACCAATTTTATATTTTCTTCCAAAAAGTACACCAAA AACTTGTTAGGGAAAAATTGTCTGAAACCTTTAGACTTTGACACTATAAA TTTCATTACTGAACTTTTTTCATACCATAGTCCATCCAATTGGAGATGTC AAACCGACGTAAAGAATATGACGACGCTATTTCCATGGCAACCACGTCAC CACAAGACGACGAAAAGATTAACAAGTTGAAAGAACATTGGGAAGGAGTA TGGGGCAAAGTCTTGAACAAGAAGTCACTTATTAACCAAGCTCTGGGTAA GGCATTCTTACACTTTTGATTCCGAATAGAACTCATTCATCCGTTCGTTC GGCTACGTCAAATGCACCCCTGTCTCACAGCCTCGGTAAAACTTTTTTCC TCACTGGGGATAAATTCCTTTTGAAATCCCAATGGGGATAGAAATTCTAT TGTAAAAATCCAGTGGATATGATTTTGGAGTACAATTTTCAAACATTGAA ATTTCGAATAGGGATAAAATCAAAGTCAATTTCCCAGTAGGCTAAAATTC AAGGGTATCTTCCCACTGGGGACGAAATTTTGCAAAATTTTCCAGTGGAA TTTTCTTGGGTCCCAGCGGGGACAAATCTTCCTTTGTTTCAAGCGTGACT CTTACTCTAGTAAGGCCTAAAAGTCTTAAGCTGTCTATTGAGTAGACTAC TGAAGGCTTTCTTATTCATTTGTTTGGCTAATCTCAAACGCATTATGCTT TAAAAAGTCAAAAGCAAACTGATTTCAACAGCGCTTAAGAGAATTTCCTC ATGGAATTTGTTAATCCGAAAATAGATTTCTGAATTTTTTGCTCCAGGAT TAATCAAACGAGGCTTCTGTAGACTCCTATGTCGTCTTGTTTGCATTTCT ATTTCCGCTTTGACACCACAGGCTTGTATGTTTAGGATTAAGGCTTTCAA CGAACGAATAGCTGAAGTATAAAGTTTGATATTCTGTCTATCCATTGATG AGTTGAAATTGTGATCTCAGTGATAATACACAAAGATTTTTGTTGCTGTT TTTCATGACTTGCATCATGTACTAATTTCATGCTAAATCAAAACCAATGA GTTGTTTGTAGTTATACCTGATTGATTGCCCTTTTAATCGTTTGGGTAAT TTTTGATGAATTGATTGAAGCTAAACTAACTAATTTTTTTTTTTTTTTTT TGCTGATTTCTCTTAATTTCTTTTTTTTCTCTCTCTCCATACCTCTAGTT GATTGGCGTCGTTACAACGAGTTGCGTTTACAACTTGATAATTATGTGTA CAAAGCCGATATTCAATTGAACGAAAACCAACAGATTGGTACTACCGTCA CCGAACTAGAAGCACAACTTGAAAAACACAAGGTGAGTAATTTTGTACTG CACCCTGTTTTTGTTCGGTTTTTGTGTTTTTATAGCGAGTTTATGTATTT GCACTTTCGAGGACGGTGGCAAAGCGACTGAAGCGATTTAGAATAACCTA ACCCGGTTCTGACCCATAAAATCGAGGACGGTAAAAGTGCTGATTTACCA TCGTCCTCAGTTCAGTTGATCAGGATCTAAACAAATCAGAAGCTAACCGT CTCTATTGCAGAAAAATATACAAACATAAACTCGCTTACATCATCAGGCT GTAAATTAATTCTGGATAAAGATAAGACTTTTTTTTCTGTGGAGAATCAG TGCACTCTTACCTTCTTGGTAAGCTTAATATAAAACATTCCAAAAATAGT TATCGAATTATGACCTAATGCACTCGTGTCATTTATACTGAAAGAAAAAA AACCACAAAGTCTTAATATTAAAGAGATCTGGGTCTGAACTACACTTCTC TATCTTTCCAAGCACACTCTTCGGTAAAATCAAGTTTGGAAGAGAGGTTA CTACCAAGCAGTGTTGAAATCTTCTCTATCTTTCCAAGCATACTCTTCGG TAAAATCAAGTTTGGAAGAGAGGTTACTACCAAGCAGTGTTGAAATCTAC TCTATCTTTCCAAGCATACTCTTCGGTAAAATCAAGTTTCGAAGAGAGGT TACTACCAAGCAGTGTTGAAATCTAAACTTGATATCTTTCTATCTGATTC ACTCAGAATTTGTTTTCCTCAGGACGAATTAAGAATTTAAGAGTTGTTGA TGTCTTTAGACAAAGTAATGCTATGATGGTAACCTTTGGTGGATTTGTTA ATTATTGCATTTCTTGCGTATTTCCTGCTTATTGAGACTTAAAATATAAA AACTTGCTTTTAGTATTTTGGCAGTCGAAGCCTTACATGTTCGTGTATAC ACTTTTTTTAACAGAACCATTAACATTTTGCTGCAGCTTGGCTGTTCTTA TTTTTTTGTCACTTTGAGCCTCAAATTTTTCTTATCCTGCTCTTATTTTT TGGAGATGTTGAGCCGTATTGTTCTTATGAAAAATAAAGTGTACTATATA TCTCAATGTGGGGGTCCTATTTTGGAAGTCCTTCAAATGTGTTGAGTCAT TTTCTGAGCAAAGATACCAGCTATTCCTTTGATTTGGACTATGTATCACC TCTTTCGCAGATGCTTTAACTATTATCAAATGTCATACCAGCAGACAAGA TTTTGTTCGGAAACTCGAACTCCCTTATCATAATCTTGAGCTCAGCTATA TCAGTTTCATTGTTCCAATTTTTCGTCTCCCCTATTATTAGTATAAAGTN CTGATTTCAACAGCGCTTAAGAGAATTTCCTCATGGAATTTGTTAATCCG AAAATAGATTTCTGATTTTTTTGCTCCAGGATTAATCAAACGAGGCTTCT GTAGACTCCTATGTCGTCTTGTTTGCATTTCTATTTCCGCTCTGACACCA CAGGCTTGTATGTTTAGGATTAAGGCTTTCAACGAACGAATAGCTGAAGT ATAAAGTTTGATATTCTATCCATTGATGAGTTGAAATTGTGATCTCAGTG ATAATACACAAAGATTTTTGTTGCTGTTTTTCATGACTTGCACCATTTAC TAATTTCATGCTAAATCAAAACCAATTGAGTTGTTTGTAGTTATACCTGA TTGATTGCCCTTTGAATCGTTGGAGTAAATTGTGATGAATCGATTGAAGC TAAACTAACTAATTTTTTTTTGCTGATTTCTCTTAATTTATTTTTTCTTT CTCTCCATACCTCTAGTTGATTGGCGTCGTTACAACGAGTTGCGTTTACA ACTTGATAATTATGTGTACAAAGCTGATATGCAATTGAACGAAAACCAAC AGATTGGCACTACCGTCACCGAACTAGAAGCACAACTTGATAAACACAAG GTGAATAATTTTGTACTGCACCCTGTTTTTGTTCGGTTTTGTGTTTTTAT AGCGAGTTTATGTATTTGCACTTTTGAGGACGGCAGCGAAGCGACTGAAG CGATTTGGATAACCTAACCCGGTTCTGACCCGTAAAATCGAAGACGGTAA AAGCTGCTTGTTTACCACCGTCCTCAGTTGATCAGGATCTAAACAAATCA GAAGCTAACCGTCTCTGTTGCAGAAAAATACACAAACATAAACTCGCTTA TATCATCAAGCTACCAAACTTATTCTTGATAAAGATAAGACTTTTTTTCT GTGGAGAATCAGTGTACTCTTACCTTCTTGGTAAGCTTAATATAAAACAT TCCAAAAATAGTTATGGAATTATGACCTAATGCACTCGTGTCATTTATAC TGAAAGAAAAAAACCACAAAGTCTTAATATTAAAGAGATCTGGGTCTGAA CTATACTTCTCTATCTTTCCAAGCATACTCTTCGGTAAAATCAAGTTTGG AAGAGAGGTGTTACTACCAAGCAGTGTTGAAATCTAAACTTGATATCTTT CTATCTGGTTCACTCAGAATTTGTTTTGCTCAGAGCAAATCTAGAGTTTA AGAGTTGTTTTTTGATGTCTTTAGACAAAGAAATGTTACGATGGTAACCT TTGGTGAATTTGTTAATTATTGGGTTTCTTGCGTACTTCCTGCTTGAGAC TGAGCTTGAGTGGCTGAAGGAGGAAGTGTTTCTATCATTAAGAGCTGATA TTTACACCCTTTAAAGCATGGCGTTCTAAATCTTAGAACGCTATGCTTTA AAGGCATGCCATTTTACCGATAGGCTTGCATCAGTGTAGTGGTTTGTTGT GTCTAGTACTACTGATTTTTATGTAATCATGTTGGTTTTTCTGAGAATAG AATGAATATTATATACTCTATTTCCTATAAGAACATCCAAAAATTTTAAA ACCTTTGGATTTTCTTAACCGTTTGAGATTTAAGCATGAAAATGTATTTA TATATTTATTTTTTTATCATAATGTATAAAGTGTTATAGGTGTAATTGTG GTGTTTTAAGTGTCCATTAAGCCTGAAAACATTCTTAACTTGCTTTTAAA GTCTGTCCAGATATAATTGGCAGTGGAAACAAGAATGCCTGTAACTTTTG ATAGTCAAATATAATTATGGAAGTTTTTTTTGCTTGTTTTAGAGAATCAA AAGCGCTTTATTTGAATGTATTTTTGGTTGAAAAATTCGCGATTTTTAGT GGTTAAATTTGCGATTGCAAAAATTGAGCTTTTTTTCTACTTATGCTATA ATGTTCATTTTTACACCAGTGGTAGTCCAACCTTAGGTTAAGAAGTTTGA CAAATTTCAAGGCAAACAGAAAAGTCCTTCGGAAGATATGGGACCCGAAA TACCCCTTGGTAGCGCTTTTCTGTGAAATATCAAATCTCCAACTTATTAC TAAAAACGGGGGTAGTGATATGATTGATAAAACAGTTTTTCGATCCTAAC ACATTTTACGATCTTTTTAATGACCTCATAGCCAAACTGTGTTTAGTGTT TTGGGAATTAGCAAAGTTCTTTAATGACTTAAAAATAACAAAGGCAATAT AAGTTCATGCTTATCTTTTCAATAAAAACAATTATACTGTGATTTCACNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCGTTTAGACCAGCCTGGCAT TTGTAATTACTTGCAGTATTCTTTTGAATTCTATTGTTCCGTGCAATTGT TCGGTTTGTCAAATGCCTAATGATGCCAGCTTGTTGGTATTTCGTTGGCC TTTGAAATGCCATTTTGAGCAAAGGAATCCCCTTTTCTGGCATTTCAAAT CAAACAAAGGAACCAAAACAAAGAGAAAAAATGACATTTTTGATTTTTTA NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNGGAAATTCCATGCTTTTCATTGTTTGATCTGTCAAAGTTGAACTTG AGGGAATCACCTTTTCAGTAATGACTCTAAAAAGACGATTCCTTAAATGC CATGACAGAAAATACAATGGAAAAGCTATTAAAATTGAATCCCTCATGAG CAAATGCCAAATTACAAATGCCAGTTGGTCTAAACGCAGCCAATGCAACA CTTAACATTTTCCAACTTTTAATTGCATTGTTCAAAAAAGATAACATATA ACCCCCGTTTTTAGTAATAAGTTGGAGATTTGATATTTCACAGAAAAGTG CTACCAAGGGGTATTTCGGGTCCCATATCTTCCGAAGGACTTTTCTGTTT GCCTTGATATTTAACAAACTTCTTAACCTAAGGTTGAACTACCACTGGTG TAAAAATGAACATTATAGCATAAGTAGAAAAAAATCTCAATTTTTGCAAT CGCAAATTTAACCACTAAAAATCACGAATTTTTCAACCAAAAATACATTC AAATATAGCGCTTTTGATTCTCTAAAACAAGCAAAAAAACTTCCATGATT ATATTTGACTATCAAAAGTTACAGGCATTCTTGTTTCCACTGCCAATTAT ATCTGGACAGACTTTAGTATTTTGGTAGTCGAAACCTCACATGTTCGTGT ATACTATATCTCGATGTGGGAGTCCTATTTTGGAAGCCCTTCAAATGTGT AACTTTAACAAGTCATTTTCTGAGCAATGATACCAAATATTCCTTTGATT TGGACTATGTATCACTTCTTTCGCAGATGATTTAACTATTATCAAATGTC ATACCAGCAGACAAGATTTTGTTCGGAAACTCGAACTCTCTTATCATAAT CTTGAGCTCAGTGATATCAGTTTCATTGTTCCAGTTTTTCGTCTCCCCCT ATTATTAGTATAAAGTGTAGTATCATAGTCGGTATAATTTTCTGATACCG TTTTAGAGTCACTATTACATTGTGGTTTAACAAGAAAAAAAGTTACGTTT GAGGGAGCTTATTTCATTAAAAATACCTGTGATTTAGTTATGATTTGAGT ACATTTATGGCTGAAAACATTTCTTGCTATTGGGCTTAGTACTAATCTGG CTTTTTGATGCCATTTTTGCAAGTTTGTTTAGGTTTCTTTCCTGTGTTAA GTACTAATAGCTGTCTCTGCTTTGTCACATCAAGTCAAATGTTATTTTAT CTGCAAGTTGCGAATATCTTTCGTTTTGTCAAAATTTGATTTTGCATTCA ATTTTTGATCTCCTGTGCCAAGGTTGCTGTTATCTTATTCGACTCGCTAC TATTTCTATCGTTCATAACTCAAATAGTTTCTAGGTTCATAAAGAATTCT AGTACAGTTGACGCTCTCTAATTCGATTTTCAAAGGGAATCGAGCTTCAA TCGAATATCCCTATACGTATCGAATAGTAGAGCGTCGTTTACGAGTGTTT CTTGTTGACGTTAACTTTCAATATTATCGAATAATGGAGCGTATCAAAAA GTAGAACTTCGAATAAAAGAACATCAACTATATCTGCAAACCTTCACTGC TTCTAAATATAACAGGAACAAAATCATCTAGCTTTTCTCTCTCGGTTTAC CCAAAACATTATAAATTGTCAAGGGGAATGATTTTGAAAATTCGCTTTTA AGAAGCAATGGCTTCAGCTCTAAACCCTGTGTTATGCCATAAAGTTAGCA TTGCTTCACAGATCAAAATGCTTCTGTTTTGATGTTTAATGTTAGTCGAG ACATCTTACTTATACCTAATAAAACATGAACTATGATTTTTAATACATTA CTTTCCTTATGCTAATTTAAAATTGAGTGATATACAGCTTAAAGTCATCT CACAAAATAGGTTTTTAATACGCGGATCAAATAAGCCTTTATAATGTGCA TTGATTTCGAAGGGCTTATCTTAATTCGATTTTTGAGATATGTCCTTCTT TTGTGTGAATGCTCTCTGATTTCAGTTAGTACGCATTTTAAAAATCTCAA TTTGCTATTTAGAAAAACCCTTGATAAAAAGGTTGTCTGGTCAAATAATT GATAAAGACACGATTAAGTCGTTCTGTTGAAAAGCTTACGAGGAGCTCAG TTTAGTTTTAGTGGATTTCAAAGATCTCCTTCTCTCATAGATCACTTGGT CAAGTATTGATCAAGAGCTTGTCTTGTTCGCCGAAAGGTTCTTTTTTGTT GTGAAATACTGTCCATCGCAGATAGTTGTGCAAGAGTGCAACAGAAAAAA AGTATTAGCAGACACTCAGACAGACAGACAGACAGACAGACAGATAGACA CAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACA GACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGA CAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACA GACAGACAGACACACAAAATGTTCTGTTATGGTCTGCGAAAAGAGTGTTG TGGAAACTTGTATTCATATAACTTTATTTCTTTTCCTTTTCAGAAATTCC AAGGCGAATTATCAACTTGGGCCAACACTTACAATACTTTACGACAACTA GCTGAAACCATTTTGTCGACGTACGTCAACGAGGATTTGAACGACTTCAA AACGACTGTCAACGAGACCAATACTCGGTGGAATAGCTTGGAAACTCGGT ATGCATCTTTTATCCTTGTTTATTCTATCTTTTTTGAACAAATATTTCCT TTAATATGGAGAAGGTATACCCCTTTTATGAGGCTAAGATAAAATGTTTG GAGTTTGAGAACCCAGTGGCTTCAATTGTTGAAAGATCATTCTGGATTGA GGTTTTCACTAAATGATTTGTGTGACACTGAATTTCGTCTCCCTTGCCCG GTACCGTTAGTTGGTCTAATGTCGACATCCCTCTTCTAATTCCGACACCC AGTTTTCGAGATAGGAATAATAGTAAGGTCTGAGTCACTGATAGATAAAA GATATTTTCCTCTCTGGTTGCTAAGCAAAGAAATATAGCTTCTATCAGCG ATTCCAACCTTCCTACTATTCTTACCTCTAAAAAAGGGTGTCAGGATTAG AAGAGAGATGTCGACATTAGACCAAGTTACATTACCCATCCTGGTCTTCC ATTCGCTAAATAGAAAAGCCTCTCATTAATCTTCCGGATTTATGTACCTC TACGTGTATAAAAATTCCAGTTATCAAGTGGAGAAAAAATAAAAATGTCG GAATCTCTGACATGAATCTTTGCAATCTTGTTAGATACGAATATTTAATT GACCTTCTGTCATTTTTAATCCGTGTAGATAAACCATTGTCTAGTTGTCT GATCGGTTCTTGGACTTAATGTTTTTTATTATAATTTTGATTTTTAAAAC AACATTTTTGGTCTTTCTTACCCGTTTCAACTTTTCTCCTTGCCGATGTA TGAACTTGAATTGATACTTTTGAAAAAAGCTTGTGATAATTCTATTGCAA AATTGCGTGTGCAGCCACTTGAATTCTCAAAATAGTGAGTGAGTGTTCAA AGTTTTTTCAAATCTCTTTCTATCACACCGAAAAAGCACTAGAAACCTGC ATTTTGTTGATTCAACATATTCCGTGACTTCTCAAGAGTTCTTAACAAAG AAGATTAGCCTGTACCTAACCAGAGATGGTCACGACTTAAATAAGATTCA TCAAACAACGATACAGGCTTGAGAACTTTTTCAAAACTTGATTCGCCTTT TGCTGACGGGTTTACTGATTGACACAAAGTCTTTTAAACATTCATAAAAC GTCCATACGAGCCGTAAGGGATTTAAAACTTCACACAGAGGCTGTTAACA GACTACATGTTTTCTCGGCAGGCAGTTGTTTTCTTTGATGACAGGTACAT CATCACTGGTTAATTGAAACACGATTTCTCAACTTTTCGATTGATTGTTT AAGAGACTTGGTGCGAAAAGCACGTGGTTCATTTATTCGTCCGCCTCGTC TAAATTTAAAGTCTTTTCACGATATGTAAAAAACGTGAATTTCAGTTACG GTTTGGCTTTCAGTTACAGTTTGGCTTTTAAACTTGCTGAGTTTTTTCGG AGATACTTGGAAAAATGAGTAAACATATTATTTATGAGTTGGCTCTCCAC AAAGATTTTGACCCTTCCAAAATATAACTATTATACTGGTTTGTGAAGGC TATAAAACTAAGTCTTAAAAGCTCTCGATATATTGTATATGTTTTGTGTA GAGAATATATTTTGTTGGACTACTGTAATTCGACGTGGGCAGAAGATTGA CTGTATCGTGAGAACGTGAACCAGTTTACCGTGAGAACTTTGTGAATTGA ATCACCGCAAACGTTGCCAACTTCTCTGATGAAAGTTTACTTTATAATTT TGTAGAGTTTGCAGAATTCCTTTTGGAGTGAGGACAAAAATGACTTCGTG GTTTTGTTGTGTTTTTTTCCTTTTCTTACAAATGATACAGACCTCTCGAG TCTTTTGGCATCTGATGGTATCTGAAAGAGTTATTTTTGCGTAATATCGG TTGACTTTTCCCTCCCCCTCTGCTTCCTTCTAGAGGTATTTATATATCTA CTTGATAGACATTGGAAAATTGGTTTGAATCAAGTTTGAAGTTGAAATTG AAGTCGTGTACTGTAATATTGTTTCAGATTAGTTTTTAAAACATTATGTA GTTTTTAGTTTGTTTTACTAGAGTTTGGTTTGTGCTCAGGTCTCAAAGTC TTTAAAATATTTTCTCATGGTTTTTCTAAGATCCATGAGACTTACAAAAC CTGTATGAAAACCACAAAACTAAATACCAATGGTTTTTCTCCTACTTGTG TTTCATATACCATATAAAGGATCTTTGTCTTTTCTTTTTGAAAGCCAAAC ATTCTAACTTGTTAAAGTTTAGAAAAACCATTAAATACTTTAAGCTTTGG TATATACAGTTTCTCTCAGCCATACAAAAATGGTAGTACTTGGCTGCTTT CTGGACTTTTAGTTAACTTAATCTCAATTGGTCACCTAATTTTTCCTTTA TCCTGGAAAAATTAGGTGCCAATTGAGATTAAGTTAACTAGAATTACCAG TTAGTTGATCAATAAGAGAAACCGAAAATCAGTTTATGAATTTTTCTTGG GAGTGCGGTACTTGCTTTTACAGAACGGGACATCGGAAAATTCCACCATG CTTCCCTGTTATGATAGTTTTACTTAACTTGGTTACTTTCCGCTTGGTGC TGTAAAAATCTTGACGGGAAGAATGACGTTATGGAAATGACGTTTATTGT AGAAGTGGTACCCTCGAGAAATATTTTTTTCGTTGAATTTAGCATTGTTT ACTTTTCACTCTAATAATTGATTAGATTGACATTTTGATGTTATGTTTAT GTTTTGTTTGTAGTAGTAATGTATTTATGTTTCAAAAGGTTGCATTGTTA TATGAAATCTCGGCAAGCACCGTTCTTAGTGACTCGATTGCTTGTTAAAC TGGGTCCAGTTGTCTCTACTGATTATACTTTAACAAGAATAGTTAAGTTT GTGGAAGAAATACTTTTTTCAGGCAAATAAATTGCTTTTCTTATGATTCT CAGTATCTTAAACTACATCTGTTCACTTTAAGAAAATTGTGGTTAATTTA CTATCCAGTCAATTTTTGTCGGTCAGCCGGGCTTTGTAACGATATGAATC TTGATGACATTATAAGCTTTAAACGTATTAACCTTTTTATGATCGTCGTC TGGAAAGTGATTTCATTTTAGTTTGTATGAATTTTTGCATTTTGTCATTT CTGATGATGCTTTTTATCATGATGCCCTTCAAAAAGCTTTTATAATACAG CTCTCTGTGTAATTTAACTTTGCAGTTATTAGCATATTTAGAAATTTTCT TCATCGAGTTTTCTCTTCCAGTTAGAATTCAGTCAGTTGACCAAGAAACA CAAAACGTAGAAAAAGCTCGAATGTCTTTAAAGGTTCTCCCGGTGATTGT GTAACTGAACCATTTTCAATTTCTGGTATTTGAGATGTTCAATAGCTAAA GGTAGATAGTGATAGAGAATGTTGTAGTAAGCACTGGGAAAGTGAAAGTA TAGGGAAATTGTTATGTCGTAGTTTGTTTTCAACTCAAAAAATTATTGTT GGTGGTTTTTACACTTTATACCTGGTGGTTGTTGGACATAAGTTTTTGCA AAGAGAAAGATATCAAATTTTACTGTAAAATAACCATTTCTCAACAATTA TTCCATTCTATTTCAAATGGTTTTAATATTAGTATTGCGGTCATGGGGTC TTATAGATATAAAGTGTAGTTTTAGTACAAAAAGCTTATTTTGTCTTGGT GAAGGGCTTAATATGCAAGGTGCCCCAGTTTTGCTTGGATATAAATAATG AGTGATTCTGATAGATGCTTTAGAATATCTTTTAATGATTTTAGTTTTAG ACTGGAAAGTGCGAGGTTGAGGTAACACCATTTTAAAAGAAATGTTTACT AGTCATATGCAAAAAAATGTTTCAACCTTTGGTAAACATTTTTATATTTG AAAGTTCAGAAGATATTTTAAAATAATATTAAAAAAAGAAATATATAGAA TTAAGATAAAGTTTGCGGAGAATCTAAACAATGGGTGAGATGTTATTGGA TTATTCAATGGACCAATCACAGAGCGGTGATACCTCAATGCATGACGGGA AGACTCCGTCTCCGTTAATGCCCGGTACACACTTTGTCATGTTTCTATTC GATAAGTAAGTATCTTCGCCATTTTCTTTCAAGCATTGACAGGATTTTTC TCATTATTTTTGGACAAAAATTTCGATTTCATTTTTCAGTATTCTCGAAA TCGTTCGTTCTTTCCTTCGTTCGTTTCTAAATCAAAAAGCGAATCGATTT TTTATGGAAACCTTAGACATTCCTGTGTCTAATTATTTTGTAACATTTCA ACCAGCAGCTATGGTTGATACTCTAAAAGAAAACTTTGTGGTTTGATTTG ATTTATAATTCAATTGAATAATTTGTCACTTTAAGATTCCCTCACACCAC ACTGTCTTATTTATTTTTTAATTTTATAATTTATTAGTACTATTTTGACT GATTGCTTTTCCCCTAGAATATTTCAACCAGCCCTCATGTCATACATCGG GAAAGTTACCCACATTCTTTAAAATCCTAATATTTTTTTAAATTAGACTA CTGACCTTTAAAAAAGGACAAAGCTATATCCGTCATTTCTGATCGGAGTT TTTTTTGTATTAAACGGTGCTAGATCATCAAAAGTATCCAAGGGGGGGGG GGTACATCTAGCGCACTCGATGCATTTACACCGTTAGTGAAAATTGCACC TAAAAAAACTACAATCAAAGATTTTGGTTGGCCGGTATTGAGAAAGATCA GTGAATTAGAACCTTAATTTCTTCAATGAGGAACTAGAGTGGTAAAAGCG GTGTTGTTTTTTCGCAAACGGGTATCCTGCACAGGAACACATCTTAACCT GTTCCTTAAGGTTTACAACAAAAAGAGATTAATCATAGTAAATAACATCC TTATTACATATCCTTCAGCGTTTAAAACCATAGATTCCCTTTTTCTGGTT GTCAGTCCTCATCCTTGATGCACTTCCCGAAAAAAATTGAGACTCTTCTC TTATTCGACTTATGTTTCTTGTAAGCATGCAGATTTCTCACTAACTGAAG TTAAGGTGAATATGTTTGATATAGATGTACGGCCAATCTTAGCTCTGATT GGTAAAAGAGTGACTTTCAGTATACGATTTTTAAGATTCAGGATATGGCT TTTCTTGTTAATATGGCATGTTTCTTATAAAAGAGATGACAAGTATTCCT GTCTTGAAGTCCATTGTTATTTTAAGTAAACTCTCTGAATAGATCATCGG AAAAGTGTCTCGGTTATTTTTTTACCGTTTCATTACAAACTTAAACATAG ATGAGGTATCTTTATCGGGAAATTATTAACAATAGAACGTCAAAATTTGT TTTTCGCGTATTCTTTCTTATAAGAACATACTCACAAGAACTAAGTTTAA GACTACCGAGTGTTGAGTGCCATACTTTTTCGAGTGGCGTTTTTTAAGAA CTAAATTTAGTAGTATTACAATTCACGCTGCATGCCTTTAACATTGCACT AACACTAACTGTGTCCCGTGAGCCCGTTTATGGATTGAATTCTCTGTCCG CAGGAAATGTCAATGTTCTTCAAATGTTCTTATAAAGTTCTTAAATTGTC AAGACTCGACGTTGTTGCTTTTCCATAATGAAAACAAACTTATGAATACC CCGGTCGTCGTCAACTTGTTACACCTTCATGTTGTTGTTGTGTCGTTTTA ATAAAAAGAAGGGTCATTTATTTTCGTTTGTTGAGACTTGACTCTAAGAG TAGTCTCTCCTTAAAAGTGAAATCAAACCGTTATTTAAAAGGGCATTTTA AGCAAGGCATTTTTTGATAGTTCGATTTTAATGTTGGTTTTGATTTTATT GATTGTATGAGTCTTAGTTTTCACTAATTCGTTTCTCTTCGTGATATCAC CATTGCTGACCTTTTTGTTATGAACTGATTGCGTAATTATTATTATAACA CACATACAAAATGAAGGATTATGACGTTTTTCGAAGAATTTAATGTGGTA ACACAGTGGCATCGATAATATGAGATGAACATACTCATCCGAAATCTAGA AAACTCTTTAAAATTTTATAAACCGTTTTCAATCAAGTTTGTTTTGAAAA GTAACTTTTTGTTCTCCTTTTGCAAAATATGCGTGTCTGCTGCCTTGCTG AGGCTTCTTGCTGTGAAGAAAAGAAAAACTTCAACCTTTTTTGCCACAAC GACAGTGAATAGAAATAATCTTAAGATTTTTACTGACATCTTTTGTCTTT TACGAGGTGTCATACTTGTTAAATTGCCTTACGATACTCTTTCTCATATT TGCAAGAATTATCGTTTAAGCCAAGTTTTTTAAAGTTTAAAATTTCAATG AAATAGTGGTAAAAATCGCCGTAAATTCAATATATTCATCTGTCGTAAAT ATGCAACTACTTGTCGATACCTTCGTACAGAAAGTCGTAAATCGAGTGAC CAAAACTCGATATGGATTCAAATTCTCGTAAGTATTGAAAATCTTCGTTT GAAATCTGTTCATCATTGATCTAAACAAATTTTGCTGACAATCACTGTTT GATTTTGTCTCTGACTTAAGGGCTCTGACCATAGTCCAAAAATTGATTTT GGTATTTGAACATAAAAGTTATATTTCAGGTTCCTTAACACTTTTAACAA AGAATTGCCTTTATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNCAAAAGTCTTCATTTTCTTCTTCATCAAACTTTT TCAATGCAAATTTTGAATTTTCAGATTCAGGAATAGTTTGTCTAACAGAA AATGTGTAACATGCCATAGTTTTGTTGGTTACATCAGTCAGAAAACACAT TTTAAACACGGCAATTATGAAAAATTCACTATGGTCAGAGCCCTTAATGT ACTCGCGTATATCTTCTGTCTGCTCTTTCTATCTATATTATGTTTGTGTC CTTTTCATTGATTTTGTATTGGTATTATTGATTATGGACTTTTACCATTG ACTTCCAAACCCGAAGAGCTAGACTTGAGACTCCTGGATAGGAAATGAAG CCACTTATTTCCCATCCAGAACGCCCGTGCGTGGTTTTTACTCAAACGCC GGATCGAAAGTAAAATATATCACTAGATTTCAAAAAATGCAGTCCTCAAA AACAAAGGAACCGCTAGTTACAATCCTCCGTCATGATAGCGGCGCGTTCT AGACGCGTTCTGGATGGGAAATAAGTGGCTTCACTTTTTCTTGCCACTCT AGCCCTTCGGGCTTCAAACTCAATGACTTTTACAATGCTGTTTTTTCGAA GTTTTTGTCATGCTAATGAAAATTAGTGAATCTTACTCTTTTCGACGTGA GTCAACGCAAAAAGAATCTAAATGTAGTGTGTCTTGAATGATATGAATCT CGAATAAGGGAAAGTCTAATTGTTATGTTATTTTGCTTGATCGCAGTTTT TTAAGATAACATATTTTTCGTGTTCTTAAAACAGTCGACATAAATATCCT AAAAAAATCGTCAGTTTTCTTATTTCCTTGTTCTAGTTTTTGTAATGATG TGGTTGTGGTGGTTAGAAATGTCAAATTTTTTTTTTATATAGATACGCCT TTTAGGAAAACTTAGTTTTCGGGTAATTTCAAGGGGATGAAATTTGGTGA TCAATCAAATGTTAAATCTCTTTTAGGGTTTTTAGGATCCTTAGACTTTC AGTATTGTTATTTAAATAACGCTATTAATACACTGCTAATTTTTTTAACG TATTTTTTGAAGTTATTTTTAGCGAACGGAATGGTTCAATTGCCTGCGAA CTAAATCGTTTTGAATTTTATTTTGCTGGTGCTTTTGATTGATTTGATGA AATGTTAAATGAAGTATTTTTGCTTGTTGTTCTTAGTTGGTTTGTTACGA ATGACAGTTTCAACAATACGAACGTTCACACTTCATAATTTGATTGTCAT ATTTTCGGCATCGGTGTTGATGAAGCGTGACAGCCCTTGATAAATCAAAA TGAAACGTCTTTTTAACCTAAATCTTGCTCAATCTTTTTATTAGTCGGTC TATAACCAACTAATGTCTAGCTGTTATTTATAGAATCTGTCTTTTAGGCC AAGTAGCTCATGAGGAGCGACTTATATTCTATATTATTCGTACTACAATC TACCTCAGGGTAAGAATATTAGAAAGTGCGTTTTTCTCAGATTTTTTTGA CGTTTCAAATACATCTTGCGCGCTTTTTGATGAAAGTAACTAATACCCTT ATCTTTAAAATTCGACGAAAATAAATCATATGGTATGTTACCAAATTGGA CCGATCAAAAAGAAAATACCTAATAAATCATATTACTTTTCAATCATCCC ATGAAAAGCAGAATTGGTATATAATTGGTCAATTTTATGTAGAAGGAAAC TAAAACATGCATTGCACGTTGAACTTTGAGACAGATTGATTTACATTACA GACATTTTGTACGTTCTCTCGCTTATTGGTGGAGATTAAACGGATAGACT TTTTGATGTTAGTTTATTGACTGCAATATTCTATACTTGTCGGGCTTTTA AATGTTGTTTTTACGTCACAGTCTATTTTTATTGTAAATCTGGCTGACTC AAAGTTTTGATCATTTATTTTTAAGATATTTTTTTTGCTTTGGATCCTCT CTCTTCGCGCACTATCCGGGTTTTGGTAGTTGAAGTCTAGAAAGCATTTT ATGGTGCTTAGAAGGCGCAAAAAGTGAAACATTTTCTTCGTGGCTAAATC GTGTGAACGACAATTTTTTCCATCCCTTCAAACGGCTAACCGGGACCCAT GATTTTGAGTAAGATCTTTATACAACTCTATATTTCGGAGAAACTTTAGC ATATCGGTAAACGTTTAGGAATCAAAAACTTGTGTGTATTCAATAAATAC CATCGTGACTGACTGACTGACTGGCTCTACACGGGTAAAAATCACTACCC GCGTCATAAAATGTGATTCTCAATGTATGACCTTTAGCCCGCCTCTAGCT CGATCAAAATAAAGATCTGCTGAACTCATTTTATAAAGTGATAAATACAA TTTTAAAAAGGAAAAAAAATATTGAGCTTTTTCGTATCTTGTTAACGTAC AAGCCACGTTTTTAATAGAAAATTTTCGTGCGCATGTGTCGAAATTTCAC TCACGACTTATGTCCATTCGTTTTTTGACTGATAGTGGCGAATTTGAAGT TACCTTGTTGAGTTAGTCAAAAACCTGGAAAAACCGTGCTCTAAATAAGG TTTAGAATTCTAATATTGTGAAATCTCTTAGTGTTTGTATGATGGAGGAT TTTGGGTAAGGTTTTTCTATTGTATTCACGTCTTTTTTGTCCACATTTTT ATTGGTATGTTTTCGTTCATAAAGAGCACTTGATAATATTTTTGACGGTT AAGAAGGGGTTGTCTTTCTTTGGTTTGTTTTGGTCTAAAGTTATCTGTCA TGAAACTATCTAGCTCTTGAATTTGTTCACGCCAAGGGTTTAGACTGAAT TTTAACCGAAAAAAGTCTTTCGGAAGGTGGTTACGCTGTGTACTGTTCAG ATGACTAGCTTTCGTTTTGATCAAAAAGTTGCGAATTGCTCGGGGGGAGG GGGTTCTTTTTGTGTCTGTCATCCATGTTATTTTTGTTTTGTTTAACAAA AAAGAATGAGTCAACGTTTGCGCTTTAAGAAATGACCTATTTTTGAAGTC ATTTATCATCGATATTCTTATGTATAACAATGTCTTTTTGTGCTTTAAAT GACCGAGTCGAATGTTTCGAGAATTTTGGATTTGAGTTCATTTATAGTAG TTACTTTTTGTAAAAGGGGTTAAGCGGGTTTTACTTAGGTAGATAAGTTC TGTCACAAATCGTTGCTGATATCGGGCGATGAAGAGAAAGTGCTTATATG CTAGACTGCACATATTGTCGCATAAGATTATGCCTTGATGGTCGGTGTTG TGTCTGTTTTTGAATTTGAAATTGTTATATTTTTCCGTTGGAAACGCCAA AAATGGTGCACCTACCATGGTGATCCCACTCTTCGCATCCGGTCGAAAAC GTTGTATGGCTTTGTGACATGTTTGAACAAAATTGTAATATTACCTACCT ATAATAAACCTTCTCTCTCCACAGCTCGAACGCGCACCAAGATTCATTAC AAGAAGCATTGGATCGCCTCTTACAATTTCACAAGAACATGATTTCAGCA TTGACATGGTTATCTTCAGCAGAATCGAAAGTTGCAGAACTAGATTCGTT GGTGGAGTCATCGCAAGCTGAGGATACTTCAAACGTGGATGAACTACAAG GTGAAATGCAGGTATGCCACTATCCTTTTTGTTTCCAGACTACTGGGACT GGGTTTCAGATTACAGACAGGTTAGGATCGACGTCAAATATCTGAAGTCG TTACATTGATTTTTTCATTCTTGATATGCACAATTGCAATGTCTTCCACC GACCCAACAGCTGATTGGTTGAAAGTGACGTATTGACTGATTTACAGAAC GGAATGTTCACGATTGACGATTTGTTACAATTGCNATCAGGTAGATAAGT TCTGTCACAAATCGTTGCTGACATCGGGTGATGAAGAGAAAGTGCTTATA TGCTAGACTGCACATATTGTCGCATAAAATTATGCCTTGATGGTCGGTGT TGTGCCTGTTTTCGAATTTGAAATTGTTATATTTTTCCGTTGGAAACGCC AAAAATGGTACACCTACCATGGTGATCCCACTCTTCGCATCCGGTCCAAA ACGTTATATGGCTTTGTGACATGTTTGAACAAAATTGTAATATTACCTAC CTATAATAATCCTTCTCTCTGCACAGCTCGAACGCGCACCAAGATTCATT ACAAGAAGCATTGGATCGCCTCTTACAATTCCACAAGAACATGATTTCAG CATTGACATGGTTATCTTCAGCAGAATCGAAAGTTGCAGAACTAGATTCG TTGGTGGAGTCATCGCAAGCGGAGGATACTTCAAACGTGGATGAACTACA AGGTGAAATGCAGGTATGCCACTATCCTTTTTGTTTCTAGACGACTGGGA CTGGGTTTCAGATTACAGACAGGTTAGGATCGACGTCAAATATCTGAAGT CGTTACATTGATTTTTTCATTCATGATACACGTTTTTTTTTTTATAAGGA ACACGTTTATAAGGAACTCGAGGCTGAAAATGGTTCAAAAAATAAGGAAT TGTTAAGGAACTGCTCAGGCTGAGANNNNNNNNNTGTGGATTTGAAAATA ATGTACCTTATTGGGACTTATTTGACCAAATTTNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNAAAAAAAAAAACGTGTATGCATCATTGCATAATGTCTTCCAC GGACCCAACAGCTGATTGGTTGAAAGTGACGTATTGACTGATTTACAGAA CGGAATGTTCACGATTGACGATTTGTTACAATTGCTTCGAAATTTACACT CACTTTTTCATTCGAAATACTTAAAAAATTGGTTGTCTTTTTTAGGGGGT TCTTCATCACTCATTGTCAAACTAGCAGTTTTTGCTGTAACTTTACCCCT TTTTTTATTTAAAGTAAAACTTTACGTCCAAAACACAACAGTGATTCCAT TGTGAATTCTGGAGTCTCTAACCTACAACCCCTACGCGATCCTCATAAGT CACCAAAGCCAATATTTGATCATTTCATTTCCTTGTTTGTTTAAGAATCT GATTAAAATCCTAATTTCTTAAAAGAACGAAACAATTATCAAAATGTCAA TTGGAAACATTCCAAATCCTTAATCTCTATAAAAAAACACGATTTTTATA AATTCACAAAATGGTGTTTATTTACTTTGTCAACTTTTTTTGTATTTGTT TTTTAATATTTCGACGAGCTGCTTTTAATTTTCCATGTACTTTGAGTTAA AAAAATTGGGTAATCCCTCACCCATAAGTTTTGGTCATCTGCCCTCGACT GTTTCCAAAATACGGTTAAGTTTCTTTAACTCGGACCTTTATAAGTCGGA CCTTTATAACTCGAATGTCTCCTTAACTCGAACAAGGATTATGGCCCCTT CAGTTAACAATGACTTATAAACCTTACTCCATAAATCGGAAATTTCCTTA ACTCTAACAATTTTGTGTTCCCCGCGCGTATTCGAGAGTTATTGTGACTC CACAGTAGTAAATTTGATAACCTTCTATTTTATCAATCACTTGGTATAAT TCGAACCAACTGGGTCACATAATCACCCTTGTCTGTCACAATAAGATAAA CTGTTTGCGCTTAGTTACAACTTCTTTCAAACATTCGCTTCATCATCATT GTTCAATGTCCTACGCCAACGCAAAAAGTCTTCAAATTTCACGCTGATAT TATTGGATTCGTTTATTCTTAATGAGACTTAACGAACGGAATTGGCTAAT TAGTTAATTAATTCCGGAAAAGGCTAAACCAAAAGTTTTTTCTGCACCCA CATTTTCGTCACATTCAGCTTGTGTGCCCCATAAAATCAACTAAAAAGTC TGAGGTTACGGGCTAACAAATTGACTTTTACACGTTGTTATAAGAACAAA TTATATCGTTTGCCAAAATATCAAGAATAGGTTAAGAACAATTCAAGGCT TCGTGTCCTTCATGGACTCTAAAACACCAAATTTCTTAGGAAATCGCAAA ACGGTCAAAATAAGAACATTATAAAACATATTTTTAAGGTTTAAAACTTA AAATGTTAAGAACATCCCGAGGCTTCAAAAAATTTGGATGCTCTTCTAAA AAACGTGTATTTGTGACTCTTTATTATTTCTATAAATCCCCGTTACAGGA ACTCGAAGATGACATTGCATCACATCAAGCCATGTTTAACGGACTCAACG AAACTGGCAAACAAATTCTCATGGATCTTGAAGTCGGCGAAGTAAGGACA GCTCTCCAATCAAAGTTGGATGATATGAATGATCGTTGGAATAGTTTAGG TGTTCGAGTCGTCGATATCAGGGATAGGTAAGACTTCAAAAATGGCAATT TCAGTAAAAACCTGGTGGTTTTTTTTATCAATTCATCGATTCTAGGAGTT AAGTATTGTGCTTTGGAGTATAAAAAGGCGATCTTTTTAGGCATACATGT GAAGCTTCATTTTGAACGCGTGCGAATTCAAGTCTCGTGCAGAATAATGT TCTGCTAATAGCCATCACTCCTGTGTGAAAGATGATACAGCATTTAAATC ATTATTGAACCAAGCACCTTCCTGTTGGATGTTACAATGTCTTCTTCTTA TCTGATCAAACCACATATATTAATAGTAGGTTAGAGGTTGCGGATACCTC AAACAACATAAGTACAGTCTATGTTTCCTGTTTCATGTTCTGATATAAGA TTACCCATCTTTCCCTTCTCTCCATCCAACAACAGAATGTCATATGGTAC TGGTGAATGGCGCCAATTATTATTGGACATGCAAGAGATTGTTGATTGGT TATCAAGAGCTGGACAAGAACTCATGTCTCAACAACCAATCGCTTCTGAT GTCGAGAAAGTACAACAACAGAATAAACACCATCAGGTACCATTTTGAAT TTACCTCATCACTGAAGGTCATATCTTATTCTGTATTTTTGGATACTCTT GACTTGATTTGATTTGATGTTTCAAATTCGCATAAAATAACGAGAAAATG TTTTTTTTTTTGCTAATATAGGTATCAACGACATGTTTTTTTTCGAATTT TCTTGTAGAGTTCTATTTAGATACGATTACAATAAGGTTATCCAAATACA TTTATTAGTCGCTGAAACTTACCAAATCTTTTTGCACTTGCAGGAATTCA AAGGCAAGCTGAACGCGCGACGTGTAGTCATCGAACAAGCTTTGGAACAA GGTCACAACTTCCTTTTGAAACATCAATCTGCACAAGACGAATCGTTCAT TCAAAGAGGAGATAAATTGGTCGTTCGCGTTGCAAGTAGTCTTCGTGAGC AACTGACCCACATACAGTCGCAATGGCTCGATTTACAGAATAATTCGGAT AAGTGGGAGAAAACTATCAGCCTTGTATTAGAGGTAAAATCCATTTTTAT TTTGCTATTTTGCCAAAGGTTGACTGATTATCTATATGTTAGGTGGTATT TCAAATGCTTAATCTCTTTTGACAGCGGGTTTTGTACACCTTTAAACAAT TTTATAAGGTATTTTCTTTCTTACGTTGTAAAGACGAGATTAGAAAAACT AGAAAACGTTCCTTAATAGTTCTCATATACTCATCAACCTTATTTTTTTG GCTTCATTGCCAAAATATTATTGGACTCGATCCGATCAATCAGTCCATCA TATTTAAAGATTATTCATGATCATTGTAATGACAATGTAATTCTGCATCC TTCCAGCAATCCCAGGCTAAATAAACGAATCGTAGTTCCTTTCCCATCAG TTGAAACAGCATGTTAAAATTGAACCAGACACTTCTATAATAGATTTTTT CGAAATGACCGTGTACACACATCACAATCAGATTAAGAACTAGTTTACAC TGTGCAGAGAACAATTAGATGACAGCGAAAATGTTTTATCGCGATATAAA TAGGAGATTAAGGAAAAATAGATGATATACTCTTTAAGCTCTCCCTTATG AATCAGTAAGCTAAACAACTAATTTATTGATGGGTTGTTGAAGAAAAACT AATGAGCTAGTATTTGTTGTCCTGAAGGGTTTGAAGTGTAAAGTTGTAGA CAGATCTAATTGTTTTGAAAAAAAGAAATGGGTACTACTGTTAATTTGAA TAACGAGGTATATCACTTTGGAACTTCTTTGATAATTACCGATATTTGGG GTTACTTTCATAAGAGAGGGGTTGCTTTTGTGACCCCCAAACAGCTGACA CTTTTGGTCTACAAGCTAAAAAAATTTCTAGCTGGTTGGAATGGACTGAA ACTATTTTCGACTTGAAGGCTCTGAAAGTTACCTACCTTAAGGGAAGAAA TTTTCGCGAGAAGAAATTTTCGCGGAATTTAATTTCGCGAATCAGAGTTT CAAAATGGCAACTTTCGCAGAATTTAATTTCGCGAATGAGCCGATTTTAA AAGTTTCACGGAATTTAATTTCGCGATTGAGAAGAATTTATCAACTTAGA TTAATTTTTAAGCATCACAGAGTTGTTTATATTTGATAAAAAATACACGT TATAATGCTTCAAAATCAATTGTTCATGATTGTGTCCATCTTTTTTGGTA ATACCTGGTCAAAAACAACAAAATAAAAGAAAGAGAAAAAAAATCGAATT TCGCAGAATTTAATTTCGCGATTTAACAATTTTGGTGTGTTTCGCGGAAT TTAATTTCGCGAATTACGCCCAAATTCGCGAAATTAAATTCCGCGAAAAT TTCTTCCGCGGAAATTTCTTCTCGCGAAAATTTCTTCCCTTAAGGTAGCA CTTATGAAAGTAACCCCAATCGTGACATATATTGGAGAAAGGTGTACATA GTAGCTCAAAATCTTTTCACTTCATTTTGATATATGAGGGTGATATTGTT TGAACTTTTTTCAAAGCTTTCGTGGCCTGGTGTTACTATAACTTCAAACT ACAAAATATACAATACACCTTTTCGACCGTAGCCGCCAATTGCCGTGGGG GCATATTTTTTCACACCTAAAGACAATAGAAAAAAGTTTGAAAAAGGATT GGCTCGAGTTTAGGGTGGTAAAACGGACAAAAAAATGCCCGCGTGGCAAT TGGCGGCTACGGTCGAAAAGGTGTATTGAATTAAATTAAAAAGTGACGGC TACATCCTCGGCTTATCATCTATCTGAAGGAACTTTTCTAATCAATTGCA TACTGTGAAAAATTAATCTTAGATTCTGATCTATTATCTATTTTTGTTTA AAAACTTTCTTCACTGGTTTAATTAACAAGCTCTAATGGTTACCTTACCT ATTAAGTTCGACAAGCGTAAGTTCAACTAAATTATTGGAATGGAAGATAA AAGTGAGAGTAAAGGCCAGTCTCCACTTGCGCGTGCTGCGATCGCACTTT ATGTAGCAAAGCTTCCACGCCAAATATTGCCATCGAAGCGTGCGTAAGTG GAGACCGGCCTTAAAGTTACTTTTAGTCTCTTTAAAAATCGAAAGAATAC CAAAATATGCTTAAATTACGTGGAGAGTCCCATTAAATATAAAAAATCTT CTCCTTTTTAGCTGGTGAACAATCTGTTGGAGGACATCGAAAAGATCAAC AAAACTTTGAACGAATCTGAAGAAATAGTGAACCATTGGGTACTCACTCA AGATATACCTGTTGATAGTGTCGCCTCTTATCTTGGTGATACAAGGGTAT GTTTTCGATTTGATTCTGAATTGCTTTATACTATCTGTGAACACATCAAA CCTTAACAAATTCTACATTTTGAGACAACGATATTTCGTCCCCTCTCCGC AGAAATAAAGTAGACGGTTTTCCATTATGTGAGAGCTAGGTTGACCAAAT ATGTCTTAAAATATTTTAAATTATTTTTCTTTGTAAATTATATCAGAGAA TGCAAGAACAAACGCAATCCATGGAAACACAATTTGATTCGATGGATGGA ACAGTCAAAGAATTACGTCATATCCACGGCGTCCTATTGGCTAAACCGAC TGAAGGAGTGATCGACCAATTACATGACAGATGGAAACATTTGTTGAATG ATTGCCAGATTCGACAGGAGAATTTGCAAAATTTGATGTCTGGTTCGGAT GCAGGATCAGTTATGTTACAAGGTTTGAGAAAAAAGTTTTCTTAGGATTA CTTTACACTTTTCAAAACTTCAGAATAATCTTATTTGGAATACATTGACT TCGTAGGCTTCTGCTCACCCTCCAACAAAAAAGTTTCTTATGTGAAGGAA GAGTGTACATAGAGTATAGAGTTCTGTTTTTGGGTTGGAAAGGCATGACA TATCTCTAACTATTCTAACCCTACCAAAATTCTTGTTAAATGCGAGAGAG AATAGCCACAAAAGTTATATTTTAATGAATTGAAATTTCATAATTCGTTA CAGAAAGCGTACCGACACCATGGGAACGTGGACAAGCATTGAACAAAGTG CCATATTTCATCAAGTAAGTGTGTAGCTCCCAGTCCCCTTTAGTGATGGC CGTCCGTAATTTTCTTTTTTTATTCTTTTATAATTACAGTGGAGTTTCCA TAGCGGAAAACTCTGTTCGAGTTATGGAGTAAGGTTTATAAGGCATTGTT AACTGAAGGGACCAGAAAACATATCCGTCTCAAGGAGACATTCTTCGAGT AATGAAAACTCTACTGTACACGTCAATAGCAATTTTCTAACTTTAAAGAT TGAACAACACTGCCAATTGTGTCTGGCTCTTTTGAGTTTGAATTTTGTAA GCTGGACACTAGATTTTGATGTTTGAGCCGTCTCAAAATCTTTTACAATC GAAAAATCCAAGTCTTATCGATGCGACGTCACCTTGTATCATATTTATCA TCTCCTTAATTGTTTTATTTCAGTCATACCACAAAAACGACACAATGGGA TCACCCAAAGATGACGGAGTTATATCACACGTTATCGGAATTAAATGACG TCAAGTTTGCCGCATATCGTACCTCCATGAAATTGAGATGTCTGCAAAAG GCTTGTTGTCGTAAGTTTTTGTTATAATTTTGAGAGAGAAAAAACCAAAA GGAAATTGGAATGAATTTTTTTTTTTAAATCGCCAAAATTTGTTTTTGCC AAAATTGAATAAATCCTAATTTTTATCTCAAACGCTCATTAGTGGCTGAA AATAAAAAAAAATTGCTACTCGTGAAAATAAGTTTCTTGCCAAATTTGAT TTTTCCGATCTTTACTGTTCATCAAGATTCTTGTTCTTTTAAGGTCACCT GCATCTTACCTTCCCTTATAGTTGACTTGTGTGAATTGAACTTAAACATC AAGAAAGCATTCGAACAACACAACCTTCGATTGAGTAACGATAACTTGGT CGATGTCGGAGAAATCATCAACGTTTTATCGACCATATTCGAAAGTATCG ATACGAATCGTAAAGAATCGATAAATGTCTCACAATGTATCGATATGACG TTAAACTGGTTGTTAAACGTTTACGATAGTGGTCGTATCGGTAAATTACG AGTTTTATCATTCAAAGCGGCCATTACTTTGATGTCACGTGCTAAACTAG AAGATAAATGGAAATGTAAGTAGGGTTNTATCACTTTGATGTCACGTGCT AAACTGGAAGATAAATGGAAATGTAAGTAGGGTTAAAATTCATCCACTTT AGACTTTAACTAATCTTTTAAAATTAACGTGTCAACTTTCTATAATATAG CAATTAACACATATAACAGTTTCTTCACTCTTCTTTCGCTACCAAGACGT ATACATTCCTAATTCAGAATCTTTACTTGATTTTGATGCAAGTGTACAGT TCAGCTCATTTTATGACTTTCGTTTGCTATTTTTTCCTAGATTTATTCCG TCAAATTTCGGATAACACCGGCCACGCAGACAGCAAAAAACTTGGTTTGC TATTACACGATTGCGTCCAGATTCCTCGACAACTTGGTGAAATCGCTGCC TTCGGTGGTAGCAATATCGAACCTAGCGTCAGGAGCTGCTTCGAAATGGT AAGTTCTTTGTTTGTTATAAATCCTGTAAGTGTATTCAGAGTTGAGGTTT TTTATTTACTTTTTTTAAGAGGCAAAATTTACAAGTGAACGAGAACCGGA CCTTGAAAACTGCAGAAAAATAAGCTTCAAAAAATTACTGTTTTTGTATA TTGTTAGGGTTAGATTTTATAAATTTTCTAATTTTGTCATTCGTCTTCAT TTTCTAGGCTAAAAACAACTCAGCGATCGATTCCAACAACTTTGTAGCCT GGACGAACGCCGAACCACAATCATTAGTCTGGATGCCAGTATTACACAGG CTAGCGTCCGCCGAAACTGCGAAACATGACGCAAAATGCGGTATTTGTAA AGAGTACCCGATTGTTGGTTTCAGATATCGCTGTTTGAAATGTTTTAACT TTGATCTTTGTCAGGTAAGGAAAAGTTTGAATGCTGTGGCGAAAACTTCA TTCAATAACATTTTCAAAATGATACAAATGATATTTTTGTTCACAAAATA TCTTTTGCCCAGATATAGTAAAACCCTTTAATTTAAATCAATTTAATTTG ATTAGAGAATCCCACCTAATTTCAACAAATATTTGAAAATCATTAGCTCG TTTGAAGTAGCAAAGCAAGCTTGACATTCTCAAATGCTACTTTCACCATG TCTTTATAATAGCCGTTAGCTTACGCTTGAAGTACTAACCTTTTTTACTT TTGTTCATGTGGTTTGATTACTATCTACCAATCAATTAATTATTTAGACT TGCTTCTGGTCTGGACGTGTCTCGAAGAGTCATCGTGTCACTCATCCTAT GCATCAATATAGCTTAGCGGTAAGTCTCATTTGTGTTCCACGGAAGCTCC ATAACCCCAATTCTTCTTAGCTCTCTATGTTCCTCGTGCGTGTTCGAGTT GAAGGACTCTATTATAGGTTCTATTAAGGTTTTTCGTGAAGTGACCTTAT CACGCCCTTTCCCGAAAACGAACATCGTCTCTAGCGGATATTCTTTTATG AAGGTCACTGTGTTTCACACCGTATTTTCCATCGTATTTTCGATATGATT TATAAAGCAGGAGCCTTCTTAAGGTTATTTTGCACCAATCATATCCATGG TTTCCTTGGTTTATCGTTAATAATTTGTGCTGTGCGTAAAGATTGGACTT ATTTTTTCTGATGCACGTACAATATGTTTTATTCTCCTCTTTTTTCTACA GACGACGACGGGTGAAGATCTTTCCGATTTCGTGAAGTTAATGAGAAACA AATTCAAATCTCGAAGATACAGGAGTCGCCCACCAAAGAAGCTTGGTTAT CTTCCAGTGCAGACCATCATGGAAGGAAGTTCCATTGAAACGTATGTTTA CTCCTTTGATTTCACTCTCCACTATCATCTACAGCATGGCTTTTAACAAA GCTTGTTTCGAAAGTGCTTCATTTTCATGGCTATTGGTAGGACTTATCCT TACCAAGATGGTAGTGGGTGGACCAAATCCATGATTCCGAAAAAAGGTTA TTATCCTTCTGACGTGAAGCACATTACGCAAAATATGTTGTTTTTATGAA GTAACGGTTTCTGATGAACGACTTGCTTTGATGGACGATGACCAAATGGT CTAAGGCTTCACCAGTGCAAACCAGGCGGCCGTAGTTCGAATTCTTGTTT CTTCCAATGTTGTGTTCAGCTCATAGATTGAGCTTGCCGACAGTGGACCC TGTGAAAACAATCAAAAGGGTGTCTAAAAGTCCTAGATTACTCGGTTATC CACGTAAAATATCTATGGGATTATCTCCGTGCAACTTTTTATTACTTTTT ATTTTTCTTAACAGGCCAACGGAACCAACGACACCTGATCTATCCAACTT CACTTTCGACTCGGCGTAAGATCACAGTTGTTTTCCTATTCAATCGTGTT GTTTTTCTATTCAATAGTTTCAATCACCATGTTTTAGTATTTTACCTTTT AACACTTCCTACATTTTCAAGATGCAATTCTATCTAGCCTCAGAATAGAC TGGAGTCGTTTATAATGTGTGTAATACAGTAGCATAGGTATTATATGATA ATACGATTATTGTTACAGGATTTAGCTATATTTAGTATAAACTAAAAACA TTTCCCTCCATCATTTTTTGCTTTATTTTTACCATGTCTAAATTAGTCGT CTAGCTTGCTAGACCAGCCTCAGAATAAAATAGCCTATTTTACACCAGGC TGAATAAGTCAGAGATCTTACAAATCAGCATGCTGAGATTCTTGTTTTGA AAATCCAATTCTACATTTATATTATCCTCCAGAATGAACGGTCACCACGA TTCGACAGACTTCCACCCCAATCACCATGGTAACGATGAGGAGATTGGTA ACGAGGAACATCATCTGATCAAGCTCATGTGTCAATCATTAAACGGTGAA ATCACAAACAATAACACAACGGTGTGTAATTTTTCATGCCTTTTTTGTTC ATCATTTTCACTTTCGATTTTCGCTCAGACAAGTCTCCTTCATAGGTTAT CTCCCGGTGGATAGGAGTCATGGGGACAAGCTGGAGTTTTTACAAGCTCT TACGTGATTTGGTTGGTCGTTAAGTTAATTTCATTACTTTTTCTAAAGAA CGCGTCATCTCTATTACTTCAAATGACCAATTAGTGAAGTATCTTATAAA AACTCCAGCTCATCCCGAATCATGGGAAACATGGGGAAAATGCTCCCTTT CTATTGGTCAAACCTTTTGAAGATGACTAAAGGGACATCATTATTAGAGG GCAGTCCTGATTACCCATGATTCATTTCGAATCATGGGTAAAGAGAGATT TGCGAAATAAAAAGTATCAACTAATCGTGGTTTGCAATCAATAATTACAT TTTGCTTAAACCCTGAGCACGCCGTTTTTATCCTGTATTTCTCATTTCTT TCTTCAGCCGAAAAGTCCGTCACAAATTTTGGCGACGTTAGATTCATCAC AACAAGAAGATATCGGAGAAATGATTCGAGGTCTTGAAGAGGAACACCAG TAAGTAATGTTGAATTTTTTACCTATCAGTATTGAGTTTGAGACATTTAA GGAATCAATATTTGATGAGCTCATCCCGAATTTAAGCACTGGATTTGTAT TATTTTTGAATAAAATCTGTCTAAAGGATTGCCAACGTTTTTTCCGATAG TATGTCTATAATCACTTTGGAATTTTACTTATGCGAGATTTTATATTCAA ATGAGATTTTAGAAATATATATGTTAAATCTAAGATCTGTTGAAATTAAG CCCGTCAAGTTGGTGATCTTGATCTTGATATGATTAGTATGTTTCTCTTA TATATTCTCTTTGCTTTCTTCTCTAGATCTCTAATGGAAGAATACACCCG ACTGAAGGGAATCAAACCAAGTAACTCATTCGAAAACGGACAAATCGTTC CGGAAAATACACAAGACACGGTGTTGATCGCTGAAGCGAAGAGTTTACGC GAACACAAAGGTCGTTTAGAAGCTCGTATGCAAATTCTAGAAGACCATAA TCGACAATTAGAATCTCAATTACAACGCTTACGACTTCTCTTAGAACAGG TTAGTGAAGTTCCATTCTACTTGTTACCGTAAGTTGGTCTAATACCGACA TCCCTCTTCTAATTCCGATGACACCCTTCTTTACAGATAGGAATTATAGG AAGGCCGGAATTGCTGATGGAAACTATTTCCCCTTATTGCTTAGCTATCA GATTGGAAAAAGTCCTTTGTCTATCAGTGATCTAGACCTTTTGACCATTC CTATCTTTAAAGAAAGGTGTCGAAATTAGAAGAGGGATGTCTACAGAACA ACTTACGGTATGATTCTCTAGCTACTCTGTATCAGAGTGTATCAAATTTA TAACGTAGCGTAGTACAGTAAAGTGCGTCAAATGGGCGAAGTTTTGTTTG CAGACAAAACTGAACCGTCCTGAGTTGCATTATGGGCTTCACATTTAGAA TCAGGAAAGCTGTATGTTTGTATATGGGAGTTTCTAATTAAAATCTATTT TCTTTCGTTAAATTATAGCCGCCCTCCGAACGTGAACGACATAATTCAAG CGGAAGTACGAATCCACCCTCACCTAAAGGTCTAACACCCGCTTTAACGC CCTCATCGTCTTATCACGGCTCGCCCGAATTAGGGCGCCGTCAGAATGGA TATTCAGATGAGCGTGCGATGGATATACATCATGTGACCGCAGAAATCGA ACACGCCTTCCCAACATCAAGTTATGAGGATTAACGGAGGAATGGAAATT TTGTTCTATTAGTGTATTGTTCTGCTTTTTCTCTTGTGTTAGTAGTGTTT ATATGAAAGATTGAATCTTTTAGAATTAGCGCTTTATTGTTAATACACAA AGAAATAATGTCATTTTTCTATCTACCCATTTTCAGAATCAGAAATAAAG TTCTAGGAACACCGGACGGTTTTTAGATCCCTGGAGGACCTAAAGAAAAT ATCCGAAACCTTTTCTGCTACTGAAGGTTTGGTTTTTGTAAAATAGAATA CCAGTCTGGACAATTAGGTTGATAGATACATGAAATTATTTATTTTGAAA TTTAAAAGAAATATTTATAGCTTATATATATTTTTATATTGTACCTTGTC CATATAATAATTTTTTTTGTCTTTTCTGTTGTCTTTCCTTGTCCTCCCTG AATTCTATGTTGTGTTTTTGTTTGCCTCCAGAAAAAACGAGGTCGCTTTA TTTTCGCGTATTATTTTGCTTTTTGTAAATAAGTTTTTTTTGTTTTGTCT TATATTTTTTGACAGAAAATCTTTTTTATGGATAGAAATAATTTTATACA ATTGAAAATACCTTTGCGTTCATTATCAT
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001461TCONS_00001461Clytia hemisphaericatranscript
TCONS_00001460TCONS_00001460Clytia hemisphaericatranscript
TCONS_00001459TCONS_00001459Clytia hemisphaericatranscript
TCONS_00001458TCONS_00001458Clytia hemisphaericatranscript
TCONS_00001457TCONS_00001457Clytia hemisphaericatranscript
TCONS_00001456TCONS_00001456Clytia hemisphaericatranscript
TCONS_00001455TCONS_00001455Clytia hemisphaericatranscript
TCONS_00001454TCONS_00001454Clytia hemisphaericatranscript
TCONS_00001453TCONS_00001453Clytia hemisphaericatranscript
TCONS_00001452TCONS_00001452Clytia hemisphaericatranscript
TCONS_00001451TCONS_00001451Clytia hemisphaericatranscript
TCONS_00001450TCONS_00001450Clytia hemisphaericatranscript
TCONS_00001449TCONS_00001449Clytia hemisphaericatranscript
TCONS_00001448TCONS_00001448Clytia hemisphaericatranscript
TCONS_00001447TCONS_00001447Clytia hemisphaericatranscript
TCONS_00001446TCONS_00001446Clytia hemisphaericatranscript
TCONS_00001445TCONS_00001445Clytia hemisphaericatranscript
TCONS_00001444TCONS_00001444Clytia hemisphaericatranscript
TCONS_00001443TCONS_00001443Clytia hemisphaericatranscript
TCONS_00001442TCONS_00001442Clytia hemisphaericatranscript
TCONS_00001441TCONS_00001441Clytia hemisphaericatranscript
TCONS_00001440TCONS_00001440Clytia hemisphaericatranscript
TCONS_00001439TCONS_00001439Clytia hemisphaericatranscript
TCONS_00001438TCONS_00001438Clytia hemisphaericatranscript
TCONS_00001437TCONS_00001437Clytia hemisphaericatranscript
TCONS_00001436TCONS_00001436Clytia hemisphaericatranscript
TCONS_00001435TCONS_00001435Clytia hemisphaericatranscript
TCONS_00001434TCONS_00001434Clytia hemisphaericatranscript
TCONS_00001433TCONS_00001433Clytia hemisphaericatranscript
TCONS_00001432TCONS_00001432Clytia hemisphaericatranscript
TCONS_00001431TCONS_00001431Clytia hemisphaericatranscript
TCONS_00001430TCONS_00001430Clytia hemisphaericatranscript
TCONS_00001429TCONS_00001429Clytia hemisphaericatranscript
TCONS_00001428TCONS_00001428Clytia hemisphaericatranscript
TCONS_00001427TCONS_00001427Clytia hemisphaericatranscript
TCONS_00001426TCONS_00001426Clytia hemisphaericatranscript
TCONS_00001425TCONS_00001425Clytia hemisphaericatranscript
TCONS_00001424TCONS_00001424Clytia hemisphaericatranscript
TCONS_00001423TCONS_00001423Clytia hemisphaericatranscript
TCONS_00001422TCONS_00001422Clytia hemisphaericatranscript
TCONS_00001421TCONS_00001421Clytia hemisphaericatranscript
TCONS_00001420TCONS_00001420Clytia hemisphaericatranscript
TCONS_00001419TCONS_00001419Clytia hemisphaericatranscript
TCONS_00001418TCONS_00001418Clytia hemisphaericatranscript
TCONS_00001417TCONS_00001417Clytia hemisphaericatranscript
TCONS_00001416TCONS_00001416Clytia hemisphaericatranscript
TCONS_00001415TCONS_00001415Clytia hemisphaericatranscript
TCONS_00001414TCONS_00001414Clytia hemisphaericatranscript
TCONS_00001413TCONS_00001413Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001425-proteinTCONS_00001425-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000010supercontigsc0000010:243650..358078 -
Orthologs
The following orthologs are found for this feature:
Ortholog NameDescriptionOrganism
DMDdystrophin Dp427m isoform Homo Sapiens
UTRNPREDICTED: utrophin isoform X2 Homo Sapiens
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
9.74 8.03 6.43 5.55 52.9 42.25 42.16 54.5 29.15 39.93 33.01 31.94 78.32 98.5 33.14 47.39 94.59 80.55 127.45 101.92 131.44 126.37 32.59 48.55 90.19 85.01 44.67 40.3 19.05 14.79