Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000971 (gene) - C. hemisphaerica

Overview
NameXLOC_000971
Unique NameXLOC_000971
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000012:787212..797893+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000971 ID=XLOC_000971|Name=XLOC_000971|organism=Clytia hemisphaerica|type=gene|length=10682bp|location=Sequence derived from alignment at sc0000012:787212..797893+ (Clytia hemisphaerica)
AAAACAGAAGATTTATGCCCAATaagatgtttttgttttgaagggCGCAT AATTGATCAGTCGCTGCACTCATTCGGAACGAAACAAAGGCGCAAATAGT GGAAACAAAAAGTTAAACATAAATAatcaagaaaaatataataaaatctt aAGCTTTTTGAAGTACTAGACAAGTTACAATTTTTACgctaaattttgca aatttttgttcGATAATTGAATTGTATTGTCTGTTTTTTGTGTTTGGCTC TTTTGTCCTGCTAAGATAAATACATAATGATATAATCATAATTAGCAAAA TGTATAAGATTTCAATAGTATTtctgattttggctgctgcgaTTTTCCAA GTACTTCATTGTGATGATACGATTGACCCCGATGCTGTAAAATCAACCGA TAAAGATCCTTGGGAGAAATGGAGTAAATTACCGTCATCTGGTAGCAAAA GTCAAGGTGAAAATTGTTTCCTCATTTTGTCTTGCAATTCATAATAAATG TCGTTCAGTAGGCCTGAAAACCTGGTAATTTCACTTATCTATGTTTGCTT GAGACTTTGAAACCATTGTTTTGGAGGATGTTTGTAATAAATCGAATTTA AACCAAATACTACTCCACTAATGTTTGAAAGTAGTTCTAACCAGCAGATC AGTATAACCATTAATAACCCCAactttcataaatttttgtattttctaac GAGATGGCTATTAAAATTAAATcgagttttttgatttttgttacaGGTAA CCATAACAACGATAGTGATGATGATGGTGGTGAAGTTGACGTGACCGAAA CAACAACCACTGAGGTCCACACTAAGACCAACATCAAGAAGAAACCTTCT TCAAAGCAACCCCAAGTTTCTTCAGTTGATAAAGAAACTAAAGACCAGTT CAATGATGCTGTCGATGAAACAGTACGTattctataagaacatccaaaat ttttgaagcattcggatctttttgttcttctgattttcaagtttaaaatg ttcttaacatgattttatttttactattttgtgagtatttttgtccattt tctaagaaatcgggtgtcttagaatctgcaaagccttaaaatgtttttat cttgTTCTTAATTAATGATAtattggtcatcgaagccttgtgttcttaga TAGTTTGTTCACGACGTGCATACAATACggattcttatttttctttaagG AAAGAACCAGGGCCCTTTTCAAACCCTCCCCTCTCCCTTAAAAAAgattc attataaaaaaaagtcattattcaattttaaatttttacccattttttag tcaaattagtctggaatttgaaaatttcctttCGGTCCAAACTAAGGTTA CGTttccttttcaaaacaaaaaccatCTCAGCTCTTCTCTAATTGTCATT TGCTAGAGACTTTTTTAACGTCTAGAACTTATGCAATTAGCAACAATTGG TGGCCTTATTGAccgatctttttcaaaattcatcatgAATTTGATCCTAT AGGAATGTTATTATTTGATTAACGTGTGCTCTTGATTTCCAGGACCCAGT CTCCGTTTTGAATCCAACAAAAAAGCCATCCAAAAAGAAACAACAGCACA AGAAGAAGCACCATAAGAAAACTCAACGAAAACACAATGTTGCTGAAAAG AAACAATTCAACTATCATGGTGATTTCTATCCAGGAAGTTTGTGGCAATA TCCTTACCCGTATTATCACCCATTATATGGGTGTGGAATGTCTCCTGACT GCCCTTGTGGAGGTATGAAGGCTGCTGCTAATTCcgttaaggtggtagtc taccgccagatttcaaaagtcaaaaaatcacattttttgcaataactcaa gaacttctttacatttcgtaatgaaattttcaggaaatNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCcaggagatgttcagaaaga cctaaggatctcaaaacacccaaaaaccaaaattcgacaattttttcgat gattttccatttctcggtagactaccaccttaaccAAGAACTctgtaatt tatctttaaaTTGATCTATAGATAAAAGTATTCATCGATGGGAATCTATT TTCAAATGGTaacttaattttgaaatattgaggTTCCTTCCCAGAAATCG AGATTTCCAGCTTAAAAACCAAGGGTTGTAAAATTTGATTTAGATTCTCC TGGCTAACAAATCGCTAATTAAGCATTTTGTAATTAATGCAATTTCTCaa atctagaaaaaaaaagagatttgagAACCTTTTACTTCACTTTCTTCTTC CTTTCCCAAGGAGCACCAGAGCCGCCATGTGCACCACCACCAACAGAAGC TAAAGAAGATAAACCTCCCACAGAAGCTAAAGACGATGGAGATAAACCTC CACCGAAGAAACCGGCAACAAAGTAAGCAATGACGATTCTTTCAACATTC TTAcgaacaaaaataaagaaactgaGACACATTACGATCATCTTTAGAAC AtttgagcatattttttttttttaaatctttgagcAGCTGAGACAGAAAA TTCAATTCttcctataaaaaatgttttcaaaaacaccTTTTAATAAGCAT TATTCTTTTCGTTACAGGAAAGTTGACATCGAAGCTTTAGAAGACGCCGA AACTCCAAAGTCGAGACATAGACGACAATTAGTACCAACACATTATTATG GTCCACCAAGTGCAGGATGGGGTggtttccacccaggacatacTGGCGGT GGTTGGGGTGCTCCTTATTGGTACAAGTAAGTTTACCGATTTTATGACAG CTGTTTATGCATGACGTGTTGATTGATTAATAATATGTTTTCTTCTCCGT ATATGAAGCTACTACTATGACTGTTTCATCGACTTTGATAACATAATGAG CTCTTCAGGGAAACTAATTCATAacatttcccatgttcaaacaAGTATTC CAGGAATTAGGGAGTTCCCCTATTAAGCTTTTGGCGAATCTGTCTCAAAA ATGATGCTTTTTTCTCGTTTTAAACTGATGCctgtttgacatttttaaat atCTATACCGACCAATCCAAGAGATTAAGCATTGTttaagaaatctaaaa attttgggaTTTTAGCTACTATTGTTTAAcactaatttttcttttttatt cgtAGAAAACGAACTCACACTCCACAAGTCAGACAATTAGTACCAACACA TTATTATGGTCCACCAAGTGCAGGATGGGGCggtttccacccaggacata cTGGTGGAGGTTGGGGTGCTCCTTACTGGTACAAGTAAGTCCTCCATTTA CTCtaacaaaatcaataaacacCGTCACTCTAATACTGTTCAGTTTCATT ACTGTTGAAAAATATTACCCCTTACTATTACTATTTAGTAATGGTAATGG AAATAAATTCCCTTAGAGCTCAAATttatttcaacaaaaatcaTTGATAA TCATTAACTGATAAACCATCTTTAGAGATCTTCCCCTTGGCGTGAAACGA ATTTTTCGAAGGAATCTTCTTGTTGTGATCTATTGAGTATTGTTGGGATA GATTGGcaaatttttgaagaatatttttcataaaattgattttctgcCTT ATAGAAAACGAACTCACACTCCACAAGTCAGACAATTAGTACCAACACAT TATTATGGTCCACCAAGTGCAGGATGGGGTGGTTTCCAGCCAGGACNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGACATACTGGTGGAGGTTG GGGTGCTCCTTACTGGTACAAGTAAGTCCTCCATTTACTCttacaaaatc aataaacacCGTCACTCTAATACTGTTCAGTTTCATTACTGTTGAAAAAT ATTACCCCTTACTATTACTATTTAGTAATGGTAATGGAAATAAATTCCCT TAGAGCTCAAATttatttcaacaaaaatcaTTGATAATCATTAACTGATA AACAACCATCTTTAGAGATCTTCCCCTTGACGTGAAACGAATTTTTCGAA GGAATCTTCTTGTTGTATCTATTGAGCATTGTTGGGATAGATTGGcaaat ttttgaagaatattttttataaaattgattttctgcCTTATAGAAAACGA ACTCACACTCCACAAGTCAGACAATTAGTACCAACACATTATTATGGCCC ACCAAGTGCAGGATGGGGTggtttccacccaggacatacTGGCGGAGGTT GGGGTGCTCCTTATTGGTATAAGTAAGATAATATCTATGATAAAATAAGG AATGTTCAACTTCAATTGCTTTCCAAAGCTAACAACGTCTTGTTTTGTGC GTCAGAACTATGGGTTGTTCCTAATCGTTTCAGTTACTCCGACGTCCTCA AAATAGTAGAATAATAAACTTGGTATAGTTTCTCGTAGTAAATGATGAAA TAGATTCACCGGCTACAATAGAATAAAGCGTACTTGAGTGCATCTATTTT GAGTTACTTTCATTATTATGTACACTTTTAGGAAAAGCGATACGAAGAAT CCTGAAAAGACTCACTCTGCAAAACAATTAGTTCCAACACATTATTATGG CCCACCAAGTGCAGGATGGGGTggtttccacccaggacatacTGGCGGAG GTTGGGGTTCCCCTTATTGGTACAAGTAAGTTAATATTTGTGAtgtaaag caaaaaaaagtttaactttCGCTGCTATCAAAAGCTAACAAAGTCTTGTT TGGAAGCTGAAACGATACTAATATTTTAGATACGGCCTACGAGGTTTCGG TGTTGCAGAAATCAATCGTTTTTACTCGGAATTCGGGTAATATTACGGAA TCCTAAAATTGGTTCGGTATCTGAAATAGACGTATTTGTACGTCAAAATC TGGGTGATGAAAAGATTACATTCTTGAATTTCGGAATTTTTGCAAGATgg ctcaaaaacaaaatttttcggtttttcgaaaatcagaaCCCTCGTACGCC CCGCCCCCTATACTACACTAAGAAGTATTTCCAgagattttgacatttta gaaAATAGATTTAAGTACTAGAGACGCCTACCCATTACGTCCTATGTATG GTCGATTGAGATTTCTTAAGCATTTTCCAATTGCTTATATcccatttttt tagaaaagacGATGTATCACCAAAGCAGCTAGTACCAACACATTATTATG GTCCACCAAGTGCAGGATGGGGCGGTTTCCACCCAGGACACACTGGTGGA GGTTGGGGTGCTCCTTATTGGTATAAGTAAGTTTGAACGAACATACTTTG ATTTCCTCGGCTATTTCGATGTTTAAACTTGCGCACAGCTTTCTTGAAGA ATCCTCTAAACATGTTAGAGCTTTTGCATATACTGGTAATGTGAGGAAAA GCATTGCCAAAATAATGCAATGCTTTAATAAAATACGATTGGGAGATATT CTCTTTATATCTTTAGGTTATAATGTTTTTCTATTCGAGTTGTAGCACTG AACTAAAGTTGGCAACACTATTCTGAATTATAATGGGAACTATATTATTT TACTTAAACCAACAGAAAACGAACTCACACTCCACAAGTTAGACAATTAG TACCAACACACTATTATGGTCCACCAAGTGCAGGATGGGGTGGTTTCCAG CCAGGACATACTGGTGGAGGTTGGGGTGCTCCTTATTGGTACAAGTAAGT TGTTTAGATTTCAAAGGCGTAGTCAGATAGTTTGAGATATTTGGTCTTTA GATTCCTCTTAATATTTCTGAGCAAACTTTTTTGTAAGCAATAGATCTCT CAACGTGGAAACCCTGTGTGAACCCATCTTCAACGTTTTCAAAACatcgt ttttcaaacttacaaAATCATTTTAGCAAAAAGAATTGGGGGTTTACCgc caaactaaaaaaaatatacAGACCAAAAGTCTTTTACCGTCTGGTAAGCC CTTCTAAAAAGGATCTACAAATGGCTAATAGACCTTTGTTGCCTTTATCA TAAAAGTCTAATATCAAAGTTTCAAGTCTAATATTTACCGTTGTTTTCAT ATAAATAGAAAAAGCGAAACGAAAAATCCTGAAAAGACTCACTCTGCAAA ACAATTAGTGCCAACGCATTATTATGGTCCACCAAGTGCGGGATGGGGTg gtttccacccaggacatacTGGCGGAGGATGGGGTGCTCCTTATTGGTAC AAGTAAGTTGAACATTTTGATCATCTTTGCATGGTAACCCAAATCAAAGT TACTGCAAACATAGTTACCTAAAAGCTTCCTTTTCGAAGATTTTGACTTA CTTGTGGCTCGTTCGCCTACCTTTTGTCAGGTAGTAGTTCATTTATCTAC TGTATTTTCAAGTGGTCGTTGTAATTCGTGTCTTCACTTCGTCATTTGTC TTTACAGAAAAAGCGAGACAAAGAATCCAGGAAAAACTCACTCTACAAAA CAATTAGTACCAACGCATTATTATGGTCCACCAAGTGCAGGATGGGGTGG TTTCCATCCAGGACATACTGGTGGAGGATGGGGCGCTCCTTATTGGTACA AGTAAGTATACTGATACCTTTTGGTAGCCATTTACGACAATGATGACGAA AATGTTTTCAGTCTCGTCAAAATTTGCCATTTCTTAGAAAGTGATGAGAA ACTCATGTATCTAGTGATGTAGTATATAAGCTCAAGTAGACTGATCTGTA TTAAGGAATAAGAATTATAATTATTTTGAAAGAGGATTTGccacaataca cctttccccttgatttcaattaaaaacgtttatattttttaccattttaa ttttttcagaaaaagtgaGACCAAGAATCCAGGAAAAACACACTCTACAA AACAATTAGTACCAACACATTATTATGGTCCACCAAGTGCAGGATGGGGT ggtttccacccaggacatacTGGCGGTGGATGGGGCGCTCCTTATTGGTA TAAGTaagtcaattttaaaagttattttttgtgttttagcGATCCTTAGC AAGCTTAAGTATCGATAgataaatcacgacgacggaagTTTTTCCTCTAT CCTTGTTCATTAACGCTGCGGATTTTTTCTTCAGGCTAACCTGAAAGCAA GGTAGATTTGCCCCGTGTAGTACATACAGTACATACAAGCGGAGCTTCAT TGTATAAACAATAACATAAGTTGATTTCTTTGAATGGTAAGTCTAAGTTA TGCTCTCAGGTTAGCCTGTAGAAAAGTTCCGCAGCGCGAAAGAACAAGGC TAATGGAAAtccgtccgtcgtcgtgattcaTCTATCGTTATTTAACCTCA TTGTTGtgctcaaataaaaaaagaaggtCAGCTTCCATATAAAAGCTCGT TATCATATTTTAGTTTCAGTACAATAGTTTTCTGTACAAGGTTGACTTGA ACCTGCTTTGGAATATTACACACTAGAGTCCGTCGTACAGGCTAACTATC TTTGTCATGGTAATAAGTTATAACTAGTCCTCCTTTACCTTACCTCAGAA AAAGCGAAACGAAGAATCCTGAAAAGACTCACTCTGCAAAACAATTAGTA CCAACACATTATTATGGTCCACCAAGTGCAGGATGGGGTGGTTTCCATCC AGGACATACTGGCGGAGGATGGGGCGCTCCTTATTGGTATAAGTAAGTGA TTTATACCTAGTTTAgtgtatttttgtaaatttgaaaatttgttagaata aattcttaaaaaaataatcactttgtattattaattttgttgtGTCCCTT ATAAATTACAATTTATACAATTATGCTTTTTTCATCATTAACAAACTCGA AATCACCTTGACCTTTATACTGCTGATCTTCTAACAGGTGCTAAAAGTTT CTAACCAAACAAAATCACAGATAAGCACCATACTTTTATAGGAGATCAGG AATTGTTCGTTCCACCCATACTGAGAATGTTGTTACATCACCATCAAAGA AATACATGGTAGAAGGATACAACAATCTTGGTATAGGACATATTGGTAAA GATGAAGGAGGCTGGGACCATGGCTTTGGTGCTGGTCATGGCTTCGCGTG GGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAGTTTAgtgt atttttgtaaatttgaaaatttgttagaataaattcttaaaaaaataatc actttgtattattaattttgttgtGTCCCTTATAAATTACAATTTATACA ATTATGCTTTTTTCATCATTAACAAACTCGAAATCACCTTGACCTTTATA CTGCTGATCTTCTAACAGGTGCTAAAAGTTTCTAACCAAACAAAATCACA GATAAGCACCATACTTTTATAGGAGATCAGGAATTGTTCGTTCCACCCAT ACTGAGAATGTTGTTACATCACCATCAAAGAAATACATGGTAGAAGGATA CAACAATCTTGGTATAGGACATATTGGTAAAGATGAAGGAGGCTGGGACC ATGGATTTGGTGCTGGTCATGGCTTCGCGTGGGGTGGTCCTACTGCCCAT GGTATGGGTCCCATAGCTCACAATGAAAGTGGAGATTTTTCAGCCGAACA TAATGGACAATACGGCTTCAGTCATGGTTATAAAGGACGCTTTGGGTCTG GCTTAGCAGGTTGGGGTAACCCTTCCACTGGGGATATGCTTGATACAGAC CAAGAAATAGGGGAAGGTGACTACGAACCTCGCCACCCGTTAGTGGTGCC TCAAGGTCGTGGACATTTTCACCACAATCATAATCATGGTATCGGTTATG GCTTCAGAAGTGGGTCTTAAAGCAATGTTCAAGTAATTTGAGAAAAGGAA GAAATTCAAACGTTAAGAACAATTTCTGGTTTGGTGATAAGATACAATTT GATCTTGTTTTAAAGCGGAAACAGTAATAAGTAACGAAATACTATTTCAA TTTCAGTTACAAGTAGAAGTCCGTGTTTTTTT
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001811TCONS_00001811Clytia hemisphaericatranscript
TCONS_00001812TCONS_00001812Clytia hemisphaericatranscript
TCONS_00001813TCONS_00001813Clytia hemisphaericatranscript
TCONS_00001814TCONS_00001814Clytia hemisphaericatranscript
TCONS_00001815TCONS_00001815Clytia hemisphaericatranscript
TCONS_00001816TCONS_00001816Clytia hemisphaericatranscript
TCONS_00001817TCONS_00001817Clytia hemisphaericatranscript
TCONS_00001818TCONS_00001818Clytia hemisphaericatranscript
TCONS_00001819TCONS_00001819Clytia hemisphaericatranscript
TCONS_00001820TCONS_00001820Clytia hemisphaericatranscript
TCONS_00001821TCONS_00001821Clytia hemisphaericatranscript
TCONS_00001822TCONS_00001822Clytia hemisphaericatranscript
TCONS_00001823TCONS_00001823Clytia hemisphaericatranscript
TCONS_00001824TCONS_00001824Clytia hemisphaericatranscript
TCONS_00001825TCONS_00001825Clytia hemisphaericatranscript
TCONS_00001826TCONS_00001826Clytia hemisphaericatranscript
TCONS_00001827TCONS_00001827Clytia hemisphaericatranscript
TCONS_00001828TCONS_00001828Clytia hemisphaericatranscript
TCONS_00001829TCONS_00001829Clytia hemisphaericatranscript
TCONS_00001830TCONS_00001830Clytia hemisphaericatranscript
TCONS_00001831TCONS_00001831Clytia hemisphaericatranscript
TCONS_00001832TCONS_00001832Clytia hemisphaericatranscript
TCONS_00001833TCONS_00001833Clytia hemisphaericatranscript
TCONS_00001834TCONS_00001834Clytia hemisphaericatranscript
TCONS_00001835TCONS_00001835Clytia hemisphaericatranscript
TCONS_00001836TCONS_00001836Clytia hemisphaericatranscript
TCONS_00001837TCONS_00001837Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001820-proteinTCONS_00001820-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:787212..797893 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
4.7 3.45 2.66 1.28 3.79 4.55 71.56 73.48 15.54 12.15 59.59 49.05 63.27 52.66 49.25 137.35 71.78 65.66 1 0.73 38.16 49 47.46 44.91 52.66 52.76 10.05 3.4 1.55 1.27