Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000267 (gene) - C. hemisphaerica

Overview
NameXLOC_000267
Unique NameXLOC_000267
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000002:17050..24246+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000267 ID=XLOC_000267|Name=XLOC_000267|organism=Clytia hemisphaerica|type=gene|length=7197bp|location=Sequence derived from alignment at sc0000002:17050..24246+ (Clytia hemisphaerica)
CAGCGGGTGACTTTAATACAAAAATCTTTTAGCATCAACTTATACGTAGG ggattcttaaaaaaaattcagagaCTGTCATTTTAAGCATTCGACTCGCT CGGAACAAGACGGAATTAAATAATTTGAAGTATATCATAAACATTTCAAt tgtttatttacatttttgatTATTAAAAAAAGGGGATTTTGAAGATTTAC AATCATCATCATTTAGTATAAAACTCTTTTAATGATCAAGAAATTTGTTA ATTGCATTTTATGATAATTATCATCAACAGCTAACGAGAATTCATCAGAC ATTTTTGAAGTACTATTCAGACTGACTGGAGATTTGAATATCGGACAAAA CTTTGAATTATAACCGGacagttgatttcgttttggaCAACGTTGACCTT ACTTTCAGGTAAGTGGGACATTAATATTTTGAGAATTCAAAACTGATTTT ATCGATGATGATTAATTTtgaactacagttgacgctctctaagtAGATTT TCACGCGCGATAGGATTTTCAACTTCGTTAACTGCGTAATATCAGCTTTT GGATGCTTACTggtagcgctagataatatttCTCTGGCGTCCATAGGTAA CATGggtaaagcctgggatacacggggacggggttgttggattttcattg aataagaGAGCATATCGAATAGTTGAGCATCGTTTATTAGAATTTTTTGT TGACGGCAACTTCCATCATTATCGAATAATGAAGTGTATGGACAAGTTGA ACGTCAACCCTGTTCTAGTCAGTAGCGATAAAGTGATAGAAACTAGACTA AGAGGAAAAAGGTTAACTTTTATCTTGATCAGAATGGAAGGTCACCTTGT ATGAGCGAGAATACGAAATTCCGTTTAACATATTACCAGGGATAAAGTGG AACTCGGTCTAGTCACGGCTAGGATCAATTGGCGTATTGTTGTCTTGATT CTGTTGTTTCTTTCTAATTGGGTAACAAGGAAATTACACAATTTCTAATT GGTTAACGAGGAAAATAAACTCCTCTTCACGCAAAATTCAACACAGTGTT CTGTCTTTTCGATTCAAATGCTTTGCACAATGACCATGAGATATTGGGTG TATTATAACCACTGATCTTAATAAACTCTGGCTATAaccaccatctttga tcggagttttttctTAAAGTGGTGAACCCGCAAAGAAGCCGTCGCAGTTT TAAAAATTAATGTCAAGCGGCGCTACACTATCACAAGTATTAAAAGCAAT GTAGACCTAGTACTCGAAAATGTTGAAACATCTTCTAGAAAGAGTGTGCC TAATGTAGAATGAAACCTAAAAATTACNTGAAATATCTTCTAGAAAGAGT AAAAAAGTGTGCCTAATGTAGAATGAAACCTAAGAATTACAAGATTAAGA AGCAACCTACGTAAAATAGTTTCAACCAACTTCCgaagaaaatattaatt ttttaatgCGTTGCACTGTAGTGTATATTACATAATTTTCTTGGTAGATA CCCACAATTTTTCATGATCAGTAACCAACATTTGTTACAAAGAGAAAACT TTAACTGTGAGGACGAGGGTGaagttttttgaccatttttgttcagagaa acaaaacatttacaaaaatcaggagCCGATCCTactttaaaatctgaaaa atctaaatcacACACCAAATAATTTTCGTTTTGTTTAAAttcacttttta atgaaatatacaaacaaaatcgAATTATacatttaagaaaataaattcgT GATcgttgatgatttttaaaagatttgaaattaaAGCGATTTTTTAACTG GATTTTTAACTAGTTTtctgtttaaaattttgatagttAGGCTAAGTAGT GATTCTAAACTTCTAAATCGGAATTACATGAATAAAATTCTGCTAATCTC AAATGATGGGCAAATCATCTCTGTCTCTTTGTACCAAGAAATTTCAGGAG TTTCGAAATCGATGGAAGTCTCTTAAGGTTAAATTAAGATGGCGTTcctc aagaaattttttttgacagtttCCTTTCGCCTTTCCATCAGTAGAAAATT AAtgactttatgaaatttgtctcTCTCGTGGGAAATTTTACCATCAGTTT Tcaacgaaaaatgttttttcactcattttttttttttttgagtttcaaaa tttttatggTTAAGTCATTACACCTAGCACACCAGGCGCCTTGAGAATGT TCTAATTCATTTTCATTCTGTTCTTCAATCTTTGAAAGAGGAACATTGAA GAAAAAGGACTGTTTAAAAAGTCAACCTAATTGATATATACCCCTCACAC AAATATTAGTGGtctaaaaaagagagaaaacagcaaaaaaaaaagtaaag catAATCAAAAATccgtcttcaaaaattttctcacaatGAAATTTTATAA GCTTAGCTAAAGATTATCCGGCCACACAATTTTTATCATCGTCATAAAAA TCATTCGAAAGCTAATTGATAATAAAATATTATTGTCTCCTACCCTTTTG TTCAGAAAGAATTTTCCACGCGTTTCGTACATTATCACGACTCTCTCCTG ATGGACTTTTTGAACCAACTGATCTCATTGGGTATCCAGAACAATAActt caattttaaaacaaaaggttTTTATTGCTTCATATACAGTAACAGAAAAG TTACCTAGAAACTCCAAGTAGAATCTAGCCTTTATTTAAttgtatttttc tattgttctaaaatCAATCACGTGTGTAATCGTAAGCTaaaaagctaaat tttattGACGATACAAAAATAAAGGGGACAAAGTCTGCATATTTTATGCA ATGAGAAAAACATCTGGGGGTGTTGTAGAGAGTTGAGAGTGAAAAAAGGT GCGTAACAagattttcgaagatttttttgaTTAATCCAAGATAGTAACGA CTTAAACCGAtcagcgaaaaaaaaaaacgtttcacttcattataattttt taaggttttgaaatAATTCATCGGACTAATATTATTGATGATCATTATAA GCTTGGTATTTCTTTAAGtattttgttattcaaattcactacattttttt tatattgtacaaacttcTTTTGGTTGGTAAAGGGAAAGGTCATCATTTTC GAGCTTTGTTGAAACTCAGCAAAAAGGTTTTTGAGCCATcttataaaagt ttttgaacCGTAATAACATCGGCGCGATACTTTGGTGGAACTTATAAGTG AAATCGCTCACATTTTAGTGTGCTCGGAACTTACAATGTTAACTAGCTAT GTAAGTATACAATGAAGTCTTGAATTGAAAAAAGGCTTGCCAAAGACAGG GGCCAcggctccactttgaaagtATTAGGGCCACATAATATACTGACTAA GGAGACGCCACTGGATGGGGCCGACGGGTGAAAAGCAATTTTTAGCTCTT TTAGATTACCTAAAACAGACCTGTTTTAGGCGATCTGAAGGTTTAAGGTT ATTAAACAGAATTTGACTTGAttggtaaattttctttttgttttgaaaaa atgtgccTCCCCCCCGCTGGCGCAGCGCCTGTAAAGACTACTATTGGTTA ATGTCAGAGGATGCTATCGTCTGTTAGAGGGACAGTTAACGCTGGGAAAA CTTATAAGCGCGTAGTTTACTGTCGTAATGAGGGGTTACGGAAAGAATAG TGGCGGAAAAGTTAGGAACAAACACTGCTAGCACAGTAAAAACCGTCATC AATGTTCACCTTGTACCGGGCTTATCTTCGGCACTCAAATTAATCCCACT TTCTAAATTATTTCCGTTTTAGTGATCTTGTCTAAGTTGATCTTTGCTTT AGAATTTTAGACAGTAAAGTACAGTAAGAACGGGAGTACAATACAAACac aatattcaatttcaaaatattatagtaaaagattttttcaagtgACTCTT CGATACTGAATAAATTCAACTTACGCGACATTGAGAACGTTGGGTTACAA AAAGATTAGGTTAATGGGTCAAGGAGAAACACTCTTCCTCCAAAGCGAAG GTTTGAAAACAGACTTATCTTTTCCCAAGCTAATTAATTTACCTTTCAAC ATTGCAACATGCATAGTGcggttttttttgtcaaataagGCCACATATCA ACCTTAACTATCGAGACTTTATGAGAAAACTTTActtaaaataagagaaa aactGACCCTCAAAATTAGGATTTTACTAATATCAAAATAGTATTAGTTC GATAAGGGGAGCTTCAGGAAGCAGCAAGGTGGCGATACATGTAGAGTTCG TTACTTTGCCAAAAAGAAATTACGAAACCCTGCTAATGTTAATTACTAGT TTGTTAGCGTTTTTTGCAAGATGATATGTGATATCTTCAATTCAATTTTC GGATGATCATGACAGAAGGCTGATAATCTGGTTAAAGCGTTACCTACTCA CCATTAGCTCTGGATCATATACCACACATTAACTAAATCGAGATCTCAAA TACTTTATTAATATTGACATTGTgtttaacttatttttaacaTCTTTATT TCAGATCTCACACGAGCGCGAACGCAGGATGACGTGGCCCTATAATCCAG TACCATCCTATCATGTACCACACCATGGACCATATAACTTCCCTGGACAT TACCCCCTGAATTATTACGGTAAgacttttcaaactcgagatgtATAAAA GTCAAAACCTCAAAACGGCGCTAATTTTTCGCTGCCAGACCCTGCTGAAA ATATCTGAATTTTCACTTTTgaagaaaaaggtcaaattctGTTTTTCGAG TAATTCTGGTAAACGAAGAATACCTTAAAAAGACTAGTAATATTTCCGTT GGTTGAAATTGTCACAAATACCAAATACAGAACTAAGCGTTACGTACTTT CATTGGTACAACAAAACGGAGGAAAGTTAAACTCggtaatattgaaaata aaacgaAAAGTAACTAACTTACAGTCTCATGGTACAGTTTCCATTCTACT TCACTCGACTGTCTTTTCCTAAaggaatacatgtttttttttataagcat acaaaaatccgaaaacaggctcaaagatgcttaggtcgaaagcttaataa tgctgaaaaatgcttgaggggatgcttaaatctaaagcataaatttaagg aaatacaaaaaatccgtaaaattccagccaaaaaaagccaaaatcaggaa aaacatttttcgtaggctcaagttatgcttgccatatgcttaatttttcc ccatatctgagcctagatatgcttataagtacaatgcttataaaaaaaat aatttAGATTTCTAGGtaataatatttaaaatattttgttaaatttcagg ATATCCAAGAAAGCAAAGACGTGAGCGTACAACATTTACCAAAGGACAAT TAGAAATATTGGAGAATTTATTCCGTGAGACGAAGTACCCTGATGTTTTT ATGCGCGAAGACGTAGCAAGAAGAATCAGCCTACCTGAATCTAGAGTCCA GGTTAGTTATTATGAAATCTCAACATCTTCTGATATTATGATAATCTTCA TCGCACAACCTATAACACAAGtataataaagaaatattaaggAGCAATAT GTGAGTGGTCTAAAGCAATTAGCTCATAGATAGCCGAAATCGCTGGCCCT GTTAAAATAATGGAAACGCGGTCTATGGGTTGTAGACTACTGGGGTATCT ATGTAAAATAAAGACTTTATGcagaaagtttttgtttgtttttgtttttg taatgaaaaattaactctggcTGGCCGGCGAATTCATAGCAAACGCAGTG TATTTATTAGcgtaaatatgtacttgaggcgAACCGAACTTTTCGAACGG CTAATTGTAATTATTTTCGTACCTTGGACCGTCGAAATTCGCCGTTTGCC GGGCCTAAATAAGACCCTTAAGCTTTATGTATCTAATACATTGCAAGTTT TGGCTGATTCGAACACGATCGGGAACTtctttgttcgaattataggagAT GAAAGCATTTAATAAGAGGCTCCACTTGACGAAATTTAGTCCAAATTATA AAGAGATTAAAATAATAGAAATCGATAATCTCCGAttatttaacattttc aaacttttttcatattccaGGTTTGGTTTAAAAACAGGCGTGCAAAACAC CGACAGAAATCCAAGAAATCATCATCTACATCACAAAGTACGAACTCAGA TTCCAGTCCTGAACGAGGAGACCGTTCGCCTGCCCTCCAATCTCCTAACT CTGATAAATCACACAACATTGACCCACCACCACTTTCGTCACCGGCAAAA CCGAACCATAGCAACAGCAACCATAGCAACAGCAACCATAGCAGCAGtaa taacaacaataataatgGCAGTAATGGAAACACAACATCAGAATCAACAA ACGAGTTTAATAACAACAAATCCCAATGCACATTCAATAACAACCATTTA CCTCAAAATCCATTAACACCAACCACGCCTACAAACACGGGCGGATATCC GCCACTCGAAAGAGCACCCTCGTATCCTAACTACATCCCTCAATCTTTCC AGCAATCGCAAAGAGGATATGGTGGACAATCAGATTCGTCATACTGTCCA TATTCACCGACCAGCGGTCGTCAATCTTTCTACCAATCCTCACATCTGCA CCCACATTCAACTAGCGATTACCAGCCATGTGCAGTAGATGTTCATGGCT CTACACCTTTAAGTCCTGGTTGGAATACATATGGTCCGAACATATGAGAC TAGTTTAAATAACTACATTTAAGTGATTCACCAAAGAATAGtgatgtcag atctaacaagtTTCCCACAATCTAACAAGATCGAAGTGACACAAACTAAA CCCTAATTGAAAATAAGACAGAGACATGTCTCTTTAAGAAATGGTTAGTG GTTTCCGCATATTCAATTGTTGATAAAACAGTAGAAGAAGTAATTGGTAG CGAACCAACGACAGGATAACTCTTAATTCCGAAATTCTGTATGCGCGGCA AGGGAAAAAGGAAACTTAATTTATTCAGGTCATATTGGCTTTTAATTTAG TTTGAAACAAGATTTCTCATCTCGCCTATCAgttttctgttttcaaattt gaaatgtaaTAAATTGTAAAGAGCTGAAACTGCAGAAAATTTAGAACGat acaatttctttttttaaagatatttttttgaacttttagaaatttttcgt ttttccaaTAATTCTAAGACAAACGAATATATTATTGTGTATAGCTg
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000393TCONS_00000393Clytia hemisphaericatranscript
TCONS_00000394TCONS_00000394Clytia hemisphaericatranscript
TCONS_00000395TCONS_00000395Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
Otx-related-1TCONS_00000395-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000002supercontigsc0000002:17050..24246 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.08 0.08 0.18 0.26 0.04 0.07 0.44 0.8 0.18 0.14 0.32 0.06 14.75 14.3 0 0 16.5 17.51 21.14 17.24 17.77 18.9 6.29 8.3 13.31 15.43 5.45 3.78 0 0.03