XLOC_000066 (gene) - C. hemisphaerica

Overview
NameXLOC_000066
Unique NameXLOC_000066
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:2340620..2360221+

Legend: transcript
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000066 ID=XLOC_000066|Name=XLOC_000066|organism=Clytia hemisphaerica|type=gene|length=19602bp|location=Sequence derived from alignment at sc0000001:2340620..2360221+ (Clytia hemisphaerica)
ATATATCAGAATAATCGTAAAACGATCTAAAGGACTTGGTTCGAGTTTGT TGCAGGTAGTCTCATATTTTTCAAGTACAACTTCAAAACACCGTTCTTAA GGTCCCCTAACGTCAATATAGCGCTGAAACAACGTTGTTCGCTAGCTGAA TGTCTGGACATCTCTAGATTGGGGTGGGATGTATGCAGTCGTCAAaacct ttttcatcttcatgtGTAGGTAtcaacataaaatttaaaaattgtcaaaa attgaatttgctgATAACACTGGGTCATGATTTAAAATATGAAGTAAAGT TTTTTTAGAGCTTGAGCTTACTTTTgagtttcattttcgttttaaaAGAT CATTGGCCATTGATAATGTTTGGGCAACTCTACTACTTAACTCATCTTTA ATTTGAGCTCGGCGGATATCTTTTaatcaaaattgtttgaatCACAGAAA CTAATCATACTCATTTATATGGGATTTTTATGCAAATTGTGTATTTACAA AGTACGatgttaaaatgttttttttaggaTTAATTTAAAGTGATTTAGAC GGCTTTTTTTCGGAGAGCTTTATTGTTGTTAACGCTAGCCAGGATTCATG AAGATTCGTTCTAAGACAGATTTAAGCCTCCCACGCGAATTCAAATTCTT ATCAACGGTTAGAGAAGAAATGATGGATTAAAATAAgcctaaaatcaaaa caaaatattctTCTTCCATTCTACTATGTCGTTTTTTAAAATAATCTAGA TACGATTTTGTTTGAGCTCATTGGATCCGTATGGTGTATTTTTATAAATC AAATTGCAATAATGGGCCATCTTACTATCAAAAATATTCAGGAAATGAAT AAGATAATAGCAGCAGATAAAGTATGAATATTTACCTACAATAAAAATGA AGAGAAGCGGaaggaagattttttttcaaacgtGCGAAATTTTAGCAAGG TAGCAGAGCGGAAgagtttaactttttttcttaaatctAAAATGGAGATT AATCCAGCAAGTTGCAAATGCGTTTTTGAAAGCTTTACGCAGATGGTTTA GAGGTTGATTGATTTTGTTTAGAGAGGCATCagaaagaaaacagaaaggT ACATTATGACATATGATGGAAAcgttgaaaatgataaaagtcAATACCAT AAAACTAACTTTTACATTGGCGCTTAATAAACTAAGTACAGTACAACAAG TCTAGTTTTGTAATGTATAAATTTGGACAAAGCTATTTATTCATCTGAAA GTTTTGGGAAGAGCCTTGATAGCCCTTGATATACACCTACCCAGTCTGCT GAACGAAAGGGCGCAGGCGGGATTGGGCGTGAAGTTTAAACGTGGCGAAA AAAGCGCGCTAAAAAGTTTAGTGGGTGTGTTCGTAGGAAAAACCGCGTAT TGAAATGAGCACGTTTTTggaatcaaaatggtagccgacatcataacaaa aaaaaattttggttgtcAACGTCAGGTGAAACCGCTCTTTGCATCCAACA TTCCAAGTCGGTTAGAAATTCTCCATCATTTTTCCTATAATAAAGACTTA TGGGGTAAAATTATTACATTATTGGCGTGTACTCTGCATAGATTTAAGTC TCTGAATTTCTGtgagtattttttttatttactttcccattttctttata aaaatcacaACCCAAAAGGGNATGAAATAAGAGCACGTTTTTggaatcaa aatggtagccgacatcataacaaaaaaaaattttggtcaacGTCAGGTGA AACCGCTTTTTGCCTTTTTGCAGCTTCCAAGTCGGTTAGAAATTCTCCAT CATTTTTCCTATAATAAAGACTTATGGAGTAAAATTATTACATTATTGGC GCGTACTCTTCATAGATTTAAGTCTCTGAATTTCTGtgagtatttttttt atttcttttcccattttctttataaaaatcactacTAAAGTGATCCTTGC CCTAAACATACCCCCAGTTTCGGGTCATGTTTCTGTACCAAAATAGCAAA ACATTcttttggctgaaatattgaTGATTGGGTCAATTTTGGGCCACAAA ACTTTAGATATTTGCTTCTGAAAACCTGGCATGAACATGACATGTGCAAG CCAGGTTTGGGTCATGTTTTTCTaggaattttcaaattcaaaattgcCAA GTGGCATgagaatacacctttcccgtaatttgtaaaactaatgcgcgcgc attattttgatgctctccaccgtttggtctctggaggtaaacaaaccggt ttttgcctgcgttcccttagggaaagttggttttttgagcttttcttaag ttctgtcgaacaaaatcccctcaaattttagtatgttcaatctattcatg NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtatac acaacggtggagcgcacattttcccgggcaatttctgagaaatttgaatt acgggaaaggtgtatttggGCTATACCGTGAGTATTGTCTTTAAGCTAGT TCTGGTTTTTACCAACTGACGAACCAtcctgttgtttttttattttgctg aaattcTAATTCAAGTGTAAGCAGATATTCATTAAGGACCAGAATAAACT CTTTGGACCAGTGGTTGtaatcaataaaatcaatcaTCAATTTAAAATGA TAATAGATATCGATAACtaacagtcagggaaatccctcaattgcagtata ctgcaattgcggttgTTTTCATTTGTGGTTAGCCTAGAAAGGCTTATAAC GgctacatatagtgctggtcAACCAAGTTAAACAAACATCCACTGTAAAA AACATACAagaagaaagcttttctttaataaaagaatctgatctacggaa aaaatattttgtctatgcgttaaaaagatatgatgaattatgtacaaaaa ttgcctgttttctccttgaatcttgaattctgtttctttaatatactgca attgcggtatatgaaaaatgtaaaagtgacatttataccccaattgcagt aaaaaattactaccgcaattgagggatttccctgactgactAATCGATTG ATCAGTTATTGATTCAAATCTATAATCGTTCGCTAATAATCAATATTCAT AATTTTGTTGACTTCCATTAGCTATCCATTGCTATCAATCCAATCGATGT GATCAATTAATAATCGATGGATGTTATCAATCGATACCATCAATTTGGAA TCGAATTTTCCTTTAGGCTTACAATCTTTTGTCTAGCAATGAATTATTGA TACTGCAAGGTAATCAATATTAATTGATAGATAATCAAAATTAATCGATT GCTCATCAATATCCATTGTTGACTAATCAATCGCTAAtcaatatttacaa tttttttgacCTCGATAGCTATTGATTATAGATTTTAATCGATAACTGAT AGCTGACACGATAGCTGACATTTTATGTCTCTGTTCTACCCTTTTTAAAC CCCCTAGGGACAGTTTGTGTTTAAAGTCttcttaaaagtaaaaaaaaggt ctgtctcaaaattcagtaaagtttaaaaaaagtatgTATGTTTTTGACCA CAGAAGGAGGCAATCCTTTCTATTCCTTAATTAATTGCTCCATTCTCCTT TGGCTACTCTCTTTAATTGCTTAGCAACCATTTTGTACTGAGAAAATCCA ACCACAACTCTGCACATCATAGCTGAATGCTCTACCTTGCACTATGGTTC TTTTGTATTGTAAGGTTTACCATTATTTGTTAACTCTTATTAAAGGCTTT CGGGGAAAACATACTTTTATTgcttgaaaatccttttttcaaaagttaca agttaaaagagtgaaaagaaaaagtgtgattcatgatatgcaccattgca atgtcttccattccacccaatagttgattggttgaaagtgacgtattgac tgattatacgtcacttacaaccaatcagctgttgggtccatgatgtaatg tcagaagacattgcagtggtgcatatcatgaatagctaGATTTGAGTAGT GGCCAAAGCTTATCTTTCAAAATTGTAAACTCTGATATTTATTTCACCAG AatattttagtatcctttaattcCCCCATATATTTTGTGTTCAAAATATT AATGGAGAAAACAGACAAATTAGCAAATTATCAGGAAAAAGCATACTCAA AGCAGatggaaatttttgatttatagCATTAGGGAGGTATTAGAGGGGGT TTATGTaagttgtttgaaaaattttgatagttttttgGAGAACAATATAA TTAATATATTTGCAGTTTCTACTTTAGAATTTAATAATGGTAGATCATGG GGGAGGACTGGTGGAagatcttgaaaagaaaactggctTAACTGCTGATC AGGTAAATCTGGTAAATCTCATGCCATATTCCTATAACATTTATTTGGAA TAATGTTTAATCATCTTTCGGATAACAGTCTACATGGTCATTAAAATGAC ATTCACAGTTAGAATTTAACACAACATAAATAATCTTGTATATATAGTAT GTCATGACAtgatatacactttttttatataagaacaagtaAAATGTTGT TGAGGctcagctgttcttatttttttggcactttgagcctcaaattgttc ttatcagcctgttcttatttatatttataaggTGTAATTGAGGTGTTTTG GgtgttatacccaattttttactactttgacccatAAATTGCATGAAACT GAGTAATTTCAGACtgagcattgttcttaaattgttctttttttggcgat tttgagcctcattattcttataaaaaagtgtgattgaaaatattcttgaa atcAAAACTCTCTCTCCTTTTAATTGGACATTTTTTCCTAGAGAAGAGTg tgtcaaaattttaaaataagagaatcattcattcatttcattgttttaga tTGTACCGCTTATTACATTATTCTTTGCCTTCTGGGTTGGTCACATCTTC CGAATATGGTTAAGTCCACAGcgaatttcaagtcaaaaacgACACTTCAT ATCAATGGCTCTTGGAATTATCATGCTATCAATAGTTTTTGGGGAGTAAG ACTTTATAAATTACTAGTATCAATCATAGCCCCGGCAATAACCACATCTT TGTGATAATAATCCAAAtaacaacaaaatttatttgattaGACCTTTTCT ACAGTTGAAATTGCAGAAGACAATATATGGTACAAGCAtgggttttgctt tgtttttgataggCTGGCTCAAGGAAAAATTAGCTCTGGCGAAATCTAGA TTCTAGACcggcgaattcttagcaagccCAATGTATTGATTGGCATGAAT ATGTACTTGAGGCAGCGAATGGAATTGTTAGACTGGAGAATCTTTTTTGT GCCTTGGACCGACGAAATTCGCTGATTGCCGGGCCTTAAGACCCCTGGAT ACAAGTTTTCTATATAAGATATGTAAGACAAAGttattttaaatatattt tctccattttagaCAAGCATTCCATCTGCTGTATTCATGTCTCATCTCAT ACACACTGATGCGTTTTGTTGACACTAGTGTTGTACACGTGTAAGTAACA CAAAAAATGTTAACGTTTTATACCCTTTGTAAATATGGGAAATCATATGC AATTGGAAGAGGGGAGCCAAATGAATTAAAATTCTCTTagattttgagga aaaaaattattttgttaccAAAGCTTGAAAACTGAAATGATCTCTGATTA ACTGCTGTTTAACATTTCTCTCTCAGAATAGCGCTCTCATTCAAAATTAC aacatttctttttaaaattgtgtAATCTTATTtctacttcttctttttca gatGGGTTATGGGTAGTGCAATGTTATATTTATCATTGATACATTTTAAG AGAATGATGCTGCAAGATGATAATTATGTTGTGGATATTTCTGGGTAAGA CCACTGACCTTTAAATATCCTTGGactaagctatatccgccatctttgat cataGTTTTTTTTGANATTTCTGGGTAAGACcaatgacctttatatatcc ttggactaagctatatccgccatctttgatcatagttttttttgaaattg gtattgaaaagaagccattgcaatgttaaaaattaacgtctaacggcgct acatcatcaaaagtatcagaggaaaagtagatctagcgctatCAATGTat tttcaccgctattgagtagtgccgccaatagggctcagatcaaagatttt tggttggcccggattgagtaacttggtagGGATATATAAGGTTCAGTGGG TAAGACCCTTTACCTTGTTCTTTATTTATTTAAtagattggttgaaaaaa tattGTACACCAGTAGTGAATGTAGTCTATTAGTTCTACTTTACTTCGAA AGACAATACGGGCACGCTTCGCACAGTAAGCTCGAGCCTGACTACACAAT TGTATCATTGGGGATATAAAATGTTATATGCACAACACTAATAGCGTTTT TCAAGCTGTCtatcatttttattgcattGCTACTCAAATTTTTCTGATGA TTTATATGTTATTTCTTCTTAGACCATTGATGCTTGCCACTATAAAGATA ACTTACGTTGGCTGTGGAATACATGATAGTAAGATGTcatttaaagcatt ttaaactttattctcaacttcagttgagctacaatctgacaatgtctgtc tgtctgtgtgtgtgtgtgtgtgtctgtctgtcacaaaaactttagggcag cctgtagACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNCTCTGCTTTTTTACACCCTAGTAGGGTTTGGTTTACACCAAAA GAGGAACCACTACTGGAGAGAACccatttttgtgttgtttttgttttaac tgCAATAACATCAACAGTGGGGAAAGCTCTTACAGTCTTAGTCTCTATCA ACTTCCTTGCCCTAGATCacaatttgaataaaatctcCCCCCTTCAAGTG CACGATGAATTTTTCCCCACTTTCAAGGTAGAATAGGATATTTTACAGAC ACTTTTTACTCTACCTGAATATCGAACTGACCTAAAATTTGAAGAGTATT GTCTCAATTTTGCTCTAACTTAATAACTAGATGTTTTTCTGTGATCTATT TCATGTAACGTGAAAAGGAAAATTCATCACTTTCCCTTTGAAATTCTTGT TTTCTAGAATATCATCCACGTACAACATCAGATGATGCTCGTATCATTTT AAAGTgagtttttcttaaaagaaaaatttgaatttcctgAAGGGGAATGA TCTTTAAAAgaccttttatttctacaatttGCGTACATGTTTAAATATGT TGATTTCTAATACAATTTGCTAttgttttaaatctttttttttattctag aAAGTTTCCTTCTCCTTTGGAATACCTTGGctacattttcaatttttcat cagTGTTTACCGGACCACCTCCAGAATACCAAGATTATATGGATTTCATA GATGGAAAACAATATGATAAATATAAGGTTACCCAGCTTGCACACAACgc tttttcaacgtttatctaacgttcacaacgtccatataacgttagatgaa cgttgaaacaacgccgCGTGCTAGCTGGGTAATGAtctattaaaaatttt aaatctcgACTTTGGACAATTAGACCAAAATACTTGGCGGTAGAAGGTTA TATTAcaggccaaatatctcaaaccatctgattatccctttaaaggcttt atttttgcataagtgttcctgtttcatatcagacacatatttcttatcag gacagtgtctgtctattgttatattatgctgatataagcaaaaaatgttt ttctttttctctttctgaccaatcttgctcctcatccgtgtcaatccaat gtgaaaaagcttgtgaattaaaattaatgagtaagcaaaaaatatcgctc ttatttaaaatcaaaacctttaaagggataataagatggtttgagatatt tggcctgTAGTAACCTTCTACGGCCTACGATCCTGAGTAAAACCTCCAAA TATTTTgatctaaatattttcaaaagtcgagaTATAACGATTGGAAATTa ctgaaaatgggttcttacacggttcttttgttatatttcttactaaaagt aaaaaaacttgtaactaATATATCATAACTTAGGAAAAtagttaggcaaa aatattttgaggttttgttCTTGAAGGAacccacatgccaaatatctcaa accatctgattatccctttaaaaataCTTTTGGAAATTCAGTTTagtaaa agaaatattttacttttttaaaacaCTTACCTAataaatgaaagtaaaat ttgaatttcttcaacTTGCCTAGCCCTAGTTTTGGTACCCTGTCCAGATT TAGTGTAATGAGGGCAAAGGTtcgataaaaaataataaaaaaggtAAACT GAACATATCGTTTGTTTATTTGTCGTTCTTCAaaagaatcttttgtttta tttcggTTTATTAATCTTATTTTTTACACCAAATCTGGACATCACTCTTT GTAAAGCCACAAAACCCTTTTTGGTGATCCCTTTTTCGGTTGGAAAGTTT CCTCTTccctttaatttatttttattttttttcatactttttagGACGAG TTGAAAGGGAAGCAACCTTCACCTATGGTATTGAAATTATAACTTTTctt gaaatgttttgttttgtagaAAGGACTACTATTAACACTATTACTAAAAC CTGTTTCTTAAAATTTGcggtttattcattttttgtaaatatttctcTTG AGAGATtactcgttgaaaagataatttagaGTGGTTTTGCGAGAAAGTTC GAATATGaagataaaaattgaagaagaaaaaattgtaatcgTATATTTTA GGTATCACTTTAAATGCtatcttttatttttccctCAAAAGTAATGTTTA AAATGTATTGACTGCAAATGTTTTTGGAACAGATCATTTATATCAGACAC AAAATACATGTTCCCGAAAAGTCCAAATTGaaagtgatttatttttttct cataccatttttttctttgttatttcAGCTCGTATCCATCCAAAAATTCA TTCTTGGATATATGGCTATTGGAATGTACGGTTTTGTCAGCTCAATATTC AAGCCTGACTTTTATAAAAGTAAGTCGTAATCCATAATAATTAATACACC CAGCGAATATTATGGTAGGTTGTTACATAAAAGGTCTCCTCTTTAAATGA ATTTTAGTGGTTTAAAAAGCAGCCAACGAGTAAGGAAATTGTTCTCCTCA ACATTGATATGATGGAGGATTTCTTGGAAAAGGACACAATTGTTATCTTG ATGGACTTAGATTTTTAAATATGTAGGTACAAGTCCGATTAATTCAATGG GAAATTTACGGGAAATAAAGTGCTGATAAGCTTGATTCATTTAACAATCA GCCCTTTATACTTAACTATCCCAGAAAATGACTTTTGGTCTTTCAGTGTT TAAATCTtataatcgtcagccgtgcaaaattactcgaatctgattggttt agaggagtgcgattaatcgttaattgcactattaccactttttgcactct tcggcggggggNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNatttgcactcgtccttcggactcgtgcaaattactattttctcctttg ttactcgtgattaatcgttaattgcactccaaaccatacgattactagta ctaatagcATCAACAcgtcaattaaaaagaaaatatcttatTTTCACATA CCATTTTCAGTAAAAAGtgtaaaataaaatctaaaagaaaaattatcaac aatatttttatacattttaaaTAACCTTTCATTCCTTTTCATCTTTACCA ATTTATAATAACTTCattaaaacaacaacaatataAAGGTTTGCTTAGAG TGCCAAGTAAATCTGTCCAGTTCCCAACGTTTACGgataaagattgaaag aaagaaTTTTAGCCCTCTACTATTCTTTGTTTTATTCTACTGTTTATAAT TTTACTTCTTAATTATAGTAGAATCTCGGAAGAGATATCTTCCTTTTTAA AATAAGTTCCCTTCCTTTCTACTAGAGAAGGCCTTGAATGTATTAGGTAT TTTTATTGAGAGAGAAGTTTCTTCTataatatcaaattttgaaaatgtag cAATTCTTCTAGTTGAGAATTTATCAATAAGATCCCTCTGTTAGAAGCTC GTGTATTGTaaagaaatttctttgataaagtCATCACACCTGGCTATCGA CATAATTTCTATAGAAGGTTTGAAATTCGGGCACGATGCCTGTAGATAAA TCATTAATTGTTGACTTATTTGATTTATCAGTGTAACCCTCTAAGGATCT TTGCGCTGTTTTTTCTACCAATGTATTCCCTGATGGGTTACCCACACTAC AGATTCTACCTGATTGTTGCAAAGTCAAGTCATGCATTTATTCTGTTTAA CATCTGTAGTCTTGTTCCGTTTTGCCGAAATATCTTTTTCCAAGTACGAA TTCCTTGAGTACGAAATCCTGAATGTTTCCCGAAATAAACAGCCGGGTTC ACTATAGAGCTAATAGACCATATAAAGCGTCCAAtttgtaaaagttcatt attgtGTTGTTCaaataagattttaaaatgTTCAGGCAATGTCGTATATC TGTTGATAACCATGGCTAAACGTATAATGAAAATACCGGAAGATAAAAGC CATGTTGCTGCAACCACCCAGTTAATAATCATCATTGCTTTTTCGTTACG TTCGACTGATCTTTGTTTGATGACATCGGATTTAGCTTCCTCTTGTTGTC TATGTAAATCTTCCTTGGTTTTCTGTGAGAATAAGTGAACAATAACAGCT AATACTGGTATTGTTATAGTGACAAAAAGATCACTGGCATCTTTATTTAT TCTTTTGAGAATCATGTAAGGTATTGGCGAGCACCAGGGTAGTACCAGCA ACGCAGTCTTCTTCATTTTACAATTAGCGCCAAAGCCTGATCGGACAATT TTGACATACCTATAGAAAGCTATACTAATTAAAGTATATCCACTAATCGC TATAATACCTGTCAATGCTTTTGTCAATGTGTGCAATAATGGACTTGCTA CTTCTAGAATCTCCGCAATCGTCAATGGTGAAAGAACTGTACTGACCAAT AAATCACCAATACATAAAGAAATCAATAAAGAATTTGGTAGATTTTGGAG TTTTCGATATCGTATGAAAAGATAGATAATGAATAAATTTATAGGTATCC CGAACGTCATTGTTGTGCTGTATCCTGTTAATAGAATGTATCTCCATACT GTCAAGTTAGCCATATCTTAAGGAGCGATTGATGAGGGGTGTGAGACGTC GACTGCGCgtggacaaatctttgaacaaaggcttaatctcaGAAGATCGG TAACGCAAGGCTACTATGCTTTATACAATACCCTGTTCTCGTTCAAGTTG TCTGCATAGGATTTATCTCCGGTGGCAGTCAACGCCGGGTACGAGTCTGC CCTCCTTCCAGTGGTCTGTTCGATTCACAGATAGTCGAGACggctttgtt tttattgaaacatttcgaatgttttgaatacGTCGAACGATTTGATTGGT ACAAAATTGATCACGTGCTTAAAATACTGCAataacttcttggaagaata cgATAAAGCACAACACAATTCTTTGCGATATATTTTATCTCTCTCTCGTG AGTAACCTTCTGATTCAAAGTATAATCTTTTCactcttttaaactttttt taataaaatctttgtttttaattgGCTCATACGACCTCCGTTATGCTACA ATTTTTTTGATTCAcgaaaatttcacaattttttttaattcacggaaatt tcacaattttttgtAGTTCACGGAAATTTCACAGCAAACACTTTTTCTTC AAACAACTTTTACCGATCTTTTTGGgcgttttaaagaaaaaaaagtcaaa tgtAATAATGTATTATACTTTAAAATGCAAAAGGAATATTTAATCCGTTC TTTAAAGTATCCCTCACTTTGAACGATTAATAGAATAATAATAATGCTAT TTTTCCggcatttccaaaatttacatttcgcTCTTCCACCTGAAAATTCT GTATAATATATATGCAATGTCTAGAAGATTTATGAAAAATAACCTGCTGG TATACTGAGGAATAATATTGACGGGCCGTATAAGACTTTACAATTAGGCC TATTTTCTTCTCTGTGCACTTTTTCACGTGAATttatattttcgattttc accgTCTCATCCGAACATTTTCAACGGCTTTCCTTTGCGGCAAAAAGTTA ACGGAGAGTATCTGTAAAAAATTCGTCGGCAAAAACTAAAATCGTCACTC ACCAACAAATTCGTCCCTTTTTACCGACAAATAGTTTTTGCTGACAAGTA GCGTCGGCTTTTTAAAGGAATCGAGGCTTGTAAAGGAATCGAGGCTTGAA AACACCTATAAACTGAGCAATAGATGGGTAGAACGGAGAACTTGGGATGT CTAAATGTTAaattacagttgacactctctaattcgacgttctactattc gataggctcccttattcggtgaaatttaaagtccccgtcaataagaaact ctcataaacggcGCTCCCTTtatcgataagctcccttattcgatgaaaat ccaattccccttgaagatcgaattagagaacgtcaaCTGTACTTCtgtgt tttcttttcattttagcACCAGAGCTATACGAAAGTTCTTTTTGGTTCAA AGTAATGTTCGCTGAAATCATGGTTTATCATCACAAATTTAAGTATTATG GTGCTTTCGGATTAGGTACGTTATTGGTTAATACACTGGATTCCTTTTCT AGTTTAGTTCAAAGATGGCAGAATATAATACAACTACCTAGGTGAATGAA GTCGCTCAGTAGTTGGCTCACAAgtagcaaaaattttaaaattgctgaaa aaaGACGGATTCGGATCctctggattttttttcaattatgaAGGACCCCC TTaggtttttttctcattttttggaccaccctggattttaaacctcgttt tactgaccaccctggatttttacactcgaaaaaccagaccccctggattt ttatTTACCAGACCACCCGAGACGTCACTCCTCCTTAACATTGGATGTAA TTTTCTCATTcgatttttaattaattttacttCAGGTGAAAGTATATGTA ATGCTTCTGGATTGGGATTCAGCGGTGTAGATGAAGACCGCAACCCAACA TGGGATAAATTGAAAACATTAAGGCCACTTCAAATTGAGGTATAGAAAGC GTTAGGgctattttatcaatttttatgcACTAAACACTTagtaaccattg agtttaaagccgaaggctagagagGATTCTTCAACCTtttctaaagcaaa aaaaataaaagaattgaaGCCACTTTAGGGATGACGGATTTAACCTAGCG CTTTTTTTCGAAACCCGGCGATAAATCATCTTCGCTTCTTCGGGGGTTTA AACTCAATGTTAGTAACTCAATAAAAGTCGTATCACGTGAAGTTTTATtg gttttaataattttccagTATGCAACAAATATTCGTGGCTATGTGGATTG TTGGAATTTGACTGTAAATGTTTGGCTTAAAAAGTAAGTTTGGTTAAGCC TTAAGTTTATTTCCACCTATTTAGCAGACAAATTTTTACATGTAGCAAAA TCATCTTGGGAATTAAATATCTATTTATTGaaccaaaattttactttata taaaaatttgtctttttttttttcgaaacaacTAATAAATACCGTGGTAT TGAATTTCTTTCAAGGAATGTAAGATCACAATATCATACGGTTGATTCTC TGTAGTTTGAGCTTCCATTTTTCGAATCTTCCTAAAGTTTGAACTAATTC CCACAAAGGGGTAACTCTTGTAGACTTGAATTAAAAGGGATGAACCATAA CTAACGCCCAGTTCCCAcaaagacacccccttctcacatacccggtggga ttttttcagccaaaggGGATAGGAATAACGGACTATAACTGATAACtgaa tattttgttttcaagtcagaaaatccaTTGTGCATGGGAAAAAATGGCAT AATACTATGCAGTGAGAATTGggttatctgattattttcagtgggaacGA AAATggtaggataattttccaccggggacgatattttggacaattttcca gtgggtctgtgagaagggggtgtacgcAGAAGAAACTCTTTATACTTGAA TTGAAAGTGATGAACCATAACTAACGAGATTGTTATACTTTTGTTTAGAT GTGTTTATTCTCGTCTGAAAGTAATACCATTCCTTGGTACTTGGGTATTC TCGGCATTATGGCATGGTTTCTATTCTGGTTATTACACATTCTTTATACC ACTTGGGTTTGCGCTGTTCCTCACTCGAAAGGTATGCATTGTTTTACATT TACAATTTTTTAGGTGCCTTCTCTATTTCAATGAGATATAATTTTACGGT TTAGCTCTCTACCaagaaatttcaagattttaccAGGACTTTTGGTTTGT GGCAGATATTTTCAGTTAATCTAGATTTCCACCCCGCGGTTTTTTATGAT GGATATTTTGATGGAACTTTtaggggaaaatcatcctataatattcttag aatattcttaggttaggaccctaattcaaactagatttaGCATGTAATAT ACACGTctaaagcataaaatgacaattttgtgaaagtagtgagccttact tgggggtaattggcaaattataattgaaagtgctctaaaaatggcattct tttattcttagcatattcttaattttttggtcaatttcatcatgaatatt ctgaTAAAGTataattcttatataaaaaagcgtgtattctagTTTGTTGA TTAGGCAACAATTAGgctaaaattgaatatgggggtggaggatataacat tttttgtaaGATCGGGTtaacccccggacattgtgacttttgaccacCGG ACAACAGATTTAACCCCCGGACAACAGATCTAACCCTCCCGGACAAGCAT CatttgaccccccggacattcaTAATTACCCCTAAAAAGAGCAGTTTTGC CCCAAACAAGCcaaatttttcactacccctggacaatatatccaatatat cctccacccccatgtacgatTTTCTGTAAGAGCACAATTAACTGAAATGA TAATCAAGAAgactcaaaaatctcaaatgaaatctataaaataaacaGGT TTTACTAAGGATAATGGAAAGAATCTTTTAGActagatttcttttttatt cggCTATCCCTTTGAAGACAAAAGCTTTTCAAATTACATTACAGGTCCGA AGAACAATTCGTCCGTACTTTTTATCGTCGCcatctttgaaattatttta tgacgtcatcacttggTTCGTCACTAGACTCTTGTTAAATTTCTACGCCG TTGGATTCGCAACATTGAACTATGCAATCACCTTCAAATTTTGGAAGTAA GTTTACCACATATCTTATAAAACACTAGAAgcaaagcaaaaaaattaatc CACAAACCTTTGTAAGATGACCCCAGTTTggtgccggcaatttgatcaat caAGACCATTCTCTCATCTCCTCGTTTTCTGCCATTTCAGTTGTTTATTC tgattgaacaaattgccgATACCAAACTGTGGTCTAATACTGTGATCTac tcatcaaatattttttgcttcaACTGCGGTGGCTTGAGAAAGACAGGGta tatctagtgttttatataagatatctgtggttgaCCAAATTAGCTAGAAA CTTCAAAACAACTTCTATAATGTCCTTGTAGCGAATGACTGAAAACCGAA GCCCATTTCATAATATGCATAACTGTAAAAACATCGTGGAATTATTTCTA ACCAACACGTCAATAATGAGCTGGTTCATGTAAAAATGACCGAATGTTAG AGCATTTTGCACGTAATAAGACAGAGTTTTTGCctctttctttaaagttg atgtctttgaaaattctttctaGAGTAATTTGCGAAATTTTATGCTCGgg aaaattcttgacaaaatagaaaaacttaaaacaaaatgtaagatctacgg cactttttagcctgttaaAGCCTCATAAGTGAAAGGACAAAGGTTTCAAT CCAACTCAAGAAGTATTTGTACATTTGAAGTATTTTCATTTCAAGAAGTT ATTAAATTTCATCTAATCCAATATTTTACTACCCTCTTGCTAGCTCTGCA AGTCATTATGGAACCGCCATTTTACTTCTTGGCACCTTATTGGTTATTGT GTTTCAAACGCAACAGCAGAAAAAAGATCACAATCAGAACGACCAATCAC CTTCCATCTCTACCAACGGTCATCCCCATGTAACCAATGGCAACCATAAT GGGTCCAGATGAAAATACCAGTTGTGTTAGCTTCTTGGATGGTTGATTTG TTGAGTATTAAAAAGTTTAAGATTAGTTTGACTGTCAGGTTCTTTTTAac acagttgacgctctctaattcaacaTTCTACTATTTAATACCATCGATGT TAATACGCTCCATtgttcgataatattgaaattctcctaGACGAGGCTTT GCCATTCGATATTCCCTTATTGCATGAAAATGCCATACcttttgaaaatt gagttagCTCTCTAATATTTTCTCGAAAGCCATTGTATCTTATTTGCGAT GATTATGGGGCTTCAGGTACGCAGTGATCTAATTCTACTTTTATCTCCTA TTTCTCTGTGACATTCTGGTGTATGTCGTTTAACCACAAGaacaaaattt ctcaaaatggcCATTTCTTTTTATATCCATATAGGgagtggacgaacatt tccagtgGGTAATCCAAGATGAATTTCCAGGGgctgttttttcatttttc taagggggtaaaaagttattctaaaatttccagggggtaaaagactgatt ttagttcgtccaccctcacttttaagatatgaaaagaattttttaaggta cttttgccattttccagggggtatccacgcatttcaataatttttttttt aattgaaaaggtttatccaccccccccccccaacggTTTTTTAATGGGAC AGCCCATTGTGAATTTTAGGGTATCAAGCTcgttaaaattttgttttttt taatcaaatatttttgatagtTGTACATAATAGTTATCTTTAACAAATTA AGTcgagtattttttttttagttcacaaaatttttgataataatAGTATT TTTTTGGGATAGTTTTGATACagttaatattttttctttgttttatattt acaactttgttttgtttatgcTGGTTTATGATATATTTAACCTTGTTTTA GTGCAGTTTTCATGCGATTAAGCACCTAAGTTTACGGTTAAGACCATtga aagaagaatgaaaaatgaaagaaaaataatcaaagaatggtgtaaggaag ccgaaaaaatgaGTGCTTAAATCAAGGGAGACAGCGCAAAATGGAAAgtc cgaaaaaaaatatattttaaaacgGTCATTGTAAAAGTACGAGCGGATAA TAAAGGCCCATGTGTCTccacggtggcctgcaaacctgtaaagctttatt attataAGAAGAAAACAAGGCATTTAAAGTTCCAAAACGAAATAAAAACG CTAAAAACGTTTTCTACGTTGTGAAATTATggcttaaaattttcaattct caAAAAAGGTCCAAagtaatattttctttaaaaaataattattgttTGGA GACAATTTTTCATTCGTGGGTAATAGACGATATTGGCTTAACataaaaac tcagatttgatccccgagaattccccacaatgctttgcgcggaaaataTT TCACCGCGAACTTTTTCCGcccaaagcattgtggggaatttgGTCTTTAC ttcttaagaaatattttaGGTTCTCTCACGTTTTAGGATTTAAAGAATTG AAAGTTACTGCCTaagtttattttgtttttttttgaaaatttttgttgtt attttcccggtttttttgttgttttttctgttttatttacaATGTTTATT CATGTAcagtttatttttttatgatatatttatatatttttttctatctt ctatgttaaaattttggaacaaatttattttgaataaaggGGCCAATAAC ATATTCTCTTTATCTAGTTATTAATGTATATTTAGCAATGTTTATATTGG TTTACAGTTAAATTtctttagaatttcttttgatattcgGCAATGTTATC TGCGTTTCAATATTGTATTTGTTGACCAAATGTGGCCATGGTAATAATCC AC
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000120TCONS_00000120Clytia hemisphaericatranscript
TCONS_00000121TCONS_00000121Clytia hemisphaericatranscript
TCONS_00000122TCONS_00000122Clytia hemisphaericatranscript
TCONS_00000123TCONS_00000123Clytia hemisphaericatranscript
TCONS_00000124TCONS_00000124Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00000120-proteinTCONS_00000120-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2340620..2360221 +
Orthologs
The following orthologs are found for this feature:
Ortholog NameDescriptionOrganism
MBOAT1lysophospholipid acyltransferase 1 Homo Sapiens
MBOAT2lysophospholipid acyltransferase 2 Homo Sapiens
Expression

Hover the mouse over a column in the graph to view expression values.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 PH_1	 PH_2	 St_1	 St_2	 GrOo_1	 GrOo_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2	 FGOo_1	 FGOo_2	 GO_1	 GO_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2
16.08 11.43 10.91 11.93 12.51 11.88 7.07 7.05 10.15 8.48 5.11 5.26 2.97 4.89 2.29 1.98 4.52 4.38 0.57 0.43 1 0.69 3.21 3.95 5.77 5.56 2.15 3.36 16.73 12.25
Spatial Expression
in the tripal_feature_cv_term.tpl.php