TCONS_00000124 (transcript) - C. hemisphaerica

Overview
Name
Unique NameTCONS_00000124
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length3462

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000124 ID=TCONS_00000124|Name=|organism=Clytia hemisphaerica|type=transcript|length=3462bp
GTCGGTTAGAAATTCTCCATCATTTTTCCTATAATAAAGACTTATGGAGT
AAAATTATTACATTATTGGCGCGTACTCTTCATAGATTTAAGTCTCTGAA
TTTCTAATTTAATAATGGTAGATCATGGGGGAGGACTGGTGGAagatctt
gaaaagaaaactggctTAACTGCTGATCAGatTGTACCGCTTATTACATT
ATTCTTTGCCTTCTGGGTTGGTCACATCTTCCGAATATGGTTAAGTCCAC
AGcgaatttcaagtcaaaaacgACACTTCATATCAATGGCTCTTGGAATT
ATCATGCTATCAATAGTTTTTGGGGAaCAAGCATTCCATCTGCTGTATTC
ATGTCTCATCTCATACACACTGATGCGTTTTGTTGACACTAGTGTTGTAC
ACGTatGGGTTATGGGTAGTGCAATGTTATATTTATCATTGATACATTTT
AAGAGAATGATGCTGCAAGATGATAATTATGTTGTGGATATTTCTGGACC
ATTGATGCTTGCCACTATAAAGATAACTTACGTTGGCTGTGGAATACATG
ATAAATATCATCCACGTACAACATCAGATGATGCTCGTATCATTTTAAAa
AAGTTTCCTTCTCCTTTGGAATACCTTGGctacattttcaatttttcatc
agTGTTTACCGGACCACCTCCAGAATACCAAGATTATATGGATTTCATAG
ATGGAAAACAATATGATAAATATAAGGACGAGTTGAAAGGGAAGCAACCT
TCACCTATGCTCGTATCCATCCAAAAATTCATTCTTGGATATATGGCTAT
TGGAATGTACGGTTTTGTCAGCTCAATATTCAAGCCTGACTTTTATAAAA
cACCAGAGCTATACGAAAGTTCTTTTTGGTTCAAAGTAATGTTCGCTGAA
ATCATGGTTTATCATCACAAATTTAAGTATTATGGTGCTTTCGGATTAGG
TGAAAGTATATGTAATGCTTCTGGATTGGGATTCAGCGGTGTAGATGAAG
ACCGCAACCCAACATGGGATAAATTGAAAACATTAAGGCCACTTCAAATT
GAGTATGCAACAAATATTCGTGGCTATGTGGATTGTTGGAATTTGACTGT
AAATGTTTGGCTTAAAAAATGTGTTTATTCTCGTCTGAAAGTAATACCAT
TCCTTGGTACTTGGGTATTCTCGGCATTATGGCATGGTTTCTATTCTGGT
TATTACACATTCTTTATACCACTTGGGTTTGCGCTGTTCCTCACTCGAAA
GGTCCGAAGAACAATTCGTCCGTACTTTTTATCGTCGCcatctttgaaat
tattttatgacgtcatcacttggTTCGTCACTAGACTCTTGTTAAATTTC
TACGCCGTTGGATTCGCAACATTGAACTATGCAATCACCTTCAAATTTTG
GAACTCTGCAAGTCATTATGGAACCGCCATTTTACTTCTTGGCACCTTAT
TGGTTATTGTGTTTCAAACGCAACAGCAGAAAAAAGATCACAATCAGAAC
GACCAATCACCTTCCATCTCTACCAACGGTCATCCCCATGTAACCAATGG
CAACCATAATGGGTCCAGATGAAAATACCAGTTGTGTTAGCTTCTTGGAT
GGTTGATTTGTTGAGTATTAAAAAGTTTAAGATTAGTTTGACTGTCAGGT
TCTTTTTAacacagttgacgctctctaattcaacaTTCTACTATTTAATA
CCATCGATGTTAATACGCTCCATtgttcgataatattgaaattctcctaG
ACGAGGCTTTGCCATTCGATATTCCCTTATTGCATGAAAATGCCATACct
tttgaaaattgagttagCTCTCTAATATTTTCTCGAAAGCCATTGTATCT
TATTTGCGATGATTATGGGGCTTCAGGTACGCAGTGATCTAATTCTACTT
TTATCTCCTATTTCTCTGTGACATTCTGGTGTATGTCGTTTAACCACAAG
aacaaaatttctcaaaatggcCATTTCTTTTTATATCCATATAGGgagtg
gacgaacatttccagtgGGTAATCCAAGATGAATTTCCAGGGgctgtttt
ttcatttttctaagggggtaaaaagttattctaaaatttccagggggtaa
aagactgattttagttcgtccaccctcacttttaagatatgaaaagaatt
ttttaaggtacttttgccattttccagggggtatccacgcatttcaataa
ttttttttttaattgaaaaggtttatccaccccccccccccaacggTTTT
TTAATGGGACAGCCCATTGTGAATTTTAGGGTATCAAGCTcgttaaaatt
ttgttttttttaatcaaatatttttgatagtTGTACATAATAGTTATCTT
TAACAAATTAAGTcgagtattttttttttagttcacaaaatttttgataa
taatAGTATTTTTTTGGGATAGTTTTGATACagttaatattttttctttg
ttttatatttacaactttgttttgtttatgcTGGTTTATGATATATTTAA
CCTTGTTTTAGTGCAGTTTTCATGCGATTAAGCACCTAAGTTTACGGTTA
AGACCATtgaaagaagaatgaaaaatgaaagaaaaataatcaaagaatgg
tgtaaggaagccgaaaaaatgaGTGCTTAAATCAAGGGAGACAGCGCAAA
ATGGAAAgtccgaaaaaaaatatattttaaaacgGTCATTGTAAAAGTAC
GAGCGGATAATAAAGGCCCATGTGTCTccacggtggcctgcaaacctgta
aagctttattattataAGAAGAAAACAAGGCATTTAAAGTTCCAAAACGA
AATAAAAACGCTAAAAACGTTTTCTACGTTGTGAAATTATggcttaaaat
tttcaattctcaAAAAAGGTCCAAagtaatattttctttaaaaaataatt
attgttTGGAGACAATTTTTCATTCGTGGGTAATAGACGATATTGGCTTA
ACataaaaactcagatttgatccccgagaattccccacaatgctttgcgc
ggaaaataTTTCACCGCGAACTTTTTCCGcccaaagcattgtggggaatt
tgGTCTTTACttcttaagaaatattttaGGTTCTCTCACGTTTTAGGATT
TAAAGAATTGAAAGTTACTGCCTaagtttattttgtttttttttgaaaat
ttttgttgttattttcccggtttttttgttgttttttctgttttatttac
aATGTTTATTCATGTAcagtttatttttttatgatatatttatatatttt
tttctatcttctatgttaaaattttggaacaaatttattttgaataaagg
GGCCAATAACATATTCTCTTTATCTAGTTATTAATGTATATTTAGCAATG
TTTATATTGGTTTACAGTTAAATTtctttagaatttcttttgatattcgG
CAATGTTATCTGCGTTTCAATATTGTATTTGTTGACCAAATGTGGCCATG
GTAATAATCCAC
Run BLAST on NCBI

transcript from alignment at sc0000001:2342400..2360221+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000124 ID=TCONS_00000124|Name=TCONS_00000124|organism=Clytia hemisphaerica|type=transcript|length=17822bp|location=Sequence derived from alignment at sc0000001:2342400..2360221+ (Clytia hemisphaerica)
GTCGGTTAGAAATTCTCCATCATTTTTCCTATAATAAAGACTTATGGAGT AAAATTATTACATTATTGGCGCGTACTCTTCATAGATTTAAGTCTCTGAA TTTCTGtgagtattttttttatttcttttcccattttctttataaaaatc actacTAAAGTGATCCTTGCCCTAAACATACCCCCAGTTTCGGGTCATGT TTCTGTACCAAAATAGCAAAACATTcttttggctgaaatattgaTGATTG GGTCAATTTTGGGCCACAAAACTTTAGATATTTGCTTCTGAAAACCTGGC ATGAACATGACATGTGCAAGCCAGGTTTGGGTCATGTTTTTCTaggaatt ttcaaattcaaaattgcCAAGTGGCATgagaatacacctttcccgtaatt tgtaaaactaatgcgcgcgcattattttgatgctctccaccgtttggtct ctggaggtaaacaaaccggtttttgcctgcgttcccttagggaaagttgg ttttttgagcttttcttaagttctgtcgaacaaaatcccctcaaatttta gtatgttcaatctattcatgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNtatacacaacggtggagcgcacattttcccgggca atttctgagaaatttgaattacgggaaaggtgtatttggGCTATACCGTG AGTATTGTCTTTAAGCTAGTTCTGGTTTTTACCAACTGACGAACCAtcct gttgtttttttattttgctgaaattcTAATTCAAGTGTAAGCAGATATTC ATTAAGGACCAGAATAAACTCTTTGGACCAGTGGTTGtaatcaataaaat caatcaTCAATTTAAAATGATAATAGATATCGATAACtaacagtcaggga aatccctcaattgcagtatactgcaattgcggttgTTTTCATTTGTGGTT AGCCTAGAAAGGCTTATAACGgctacatatagtgctggtcAACCAAGTTA AACAAACATCCACTGTAAAAAACATACAagaagaaagcttttctttaata aaagaatctgatctacggaaaaaatattttgtctatgcgttaaaaagata tgatgaattatgtacaaaaattgcctgttttctccttgaatcttgaattc tgtttctttaatatactgcaattgcggtatatgaaaaatgtaaaagtgac atttataccccaattgcagtaaaaaattactaccgcaattgagggatttc cctgactgactAATCGATTGATCAGTTATTGATTCAAATCTATAATCGTT CGCTAATAATCAATATTCATAATTTTGTTGACTTCCATTAGCTATCCATT GCTATCAATCCAATCGATGTGATCAATTAATAATCGATGGATGTTATCAA TCGATACCATCAATTTGGAATCGAATTTTCCTTTAGGCTTACAATCTTTT GTCTAGCAATGAATTATTGATACTGCAAGGTAATCAATATTAATTGATAG ATAATCAAAATTAATCGATTGCTCATCAATATCCATTGTTGACTAATCAA TCGCTAAtcaatatttacaatttttttgacCTCGATAGCTATTGATTATA GATTTTAATCGATAACTGATAGCTGACACGATAGCTGACATTTTATGTCT CTGTTCTACCCTTTTTAAACCCCCTAGGGACAGTTTGTGTTTAAAGTCtt cttaaaagtaaaaaaaaggtctgtctcaaaattcagtaaagtttaaaaaa agtatgTATGTTTTTGACCACAGAAGGAGGCAATCCTTTCTATTCCTTAA TTAATTGCTCCATTCTCCTTTGGCTACTCTCTTTAATTGCTTAGCAACCA TTTTGTACTGAGAAAATCCAACCACAACTCTGCACATCATAGCTGAATGC TCTACCTTGCACTATGGTTCTTTTGTATTGTAAGGTTTACCATTATTTGT TAACTCTTATTAAAGGCTTTCGGGGAAAACATACTTTTATTgcttgaaaa tccttttttcaaaagttacaagttaaaagagtgaaaagaaaaagtgtgat tcatgatatgcaccattgcaatgtcttccattccacccaatagttgattg gttgaaagtgacgtattgactgattatacgtcacttacaaccaatcagct gttgggtccatgatgtaatgtcagaagacattgcagtggtgcatatcatg aatagctaGATTTGAGTAGTGGCCAAAGCTTATCTTTCAAAATTGTAAAC TCTGATATTTATTTCACCAGAatattttagtatcctttaattcCCCCATA TATTTTGTGTTCAAAATATTAATGGAGAAAACAGACAAATTAGCAAATTA TCAGGAAAAAGCATACTCAAAGCAGatggaaatttttgatttatagCATT AGGGAGGTATTAGAGGGGGTTTATGTaagttgtttgaaaaattttgatag ttttttgGAGAACAATATAATTAATATATTTGCAGTTTCTACTTTAGAAT TTAATAATGGTAGATCATGGGGGAGGACTGGTGGAagatcttgaaaagaa aactggctTAACTGCTGATCAGGTAAATCTGGTAAATCTCATGCCATATT CCTATAACATTTATTTGGAATAATGTTTAATCATCTTTCGGATAACAGTC TACATGGTCATTAAAATGACATTCACAGTTAGAATTTAACACAACATAAA TAATCTTGTATATATAGTATGTCATGACAtgatatacactttttttatat aagaacaagtaAAATGTTGTTGAGGctcagctgttcttatttttttggca ctttgagcctcaaattgttcttatcagcctgttcttatttatatttataa ggTGTAATTGAGGTGTTTTGGgtgttatacccaattttttactactttga cccatAAATTGCATGAAACTGAGTAATTTCAGACtgagcattgttcttaa attgttctttttttggcgattttgagcctcattattcttataaaaaagtg tgattgaaaatattcttgaaatcAAAACTCTCTCTCCTTTTAATTGGACA TTTTTTCCTAGAGAAGAGTgtgtcaaaattttaaaataagagaatcattc attcatttcattgttttagatTGTACCGCTTATTACATTATTCTTTGCCT TCTGGGTTGGTCACATCTTCCGAATATGGTTAAGTCCACAGcgaatttca agtcaaaaacgACACTTCATATCAATGGCTCTTGGAATTATCATGCTATC AATAGTTTTTGGGGAGTAAGACTTTATAAATTACTAGTATCAATCATAGC CCCGGCAATAACCACATCTTTGTGATAATAATCCAAAtaacaacaaaatt tatttgattaGACCTTTTCTACAGTTGAAATTGCAGAAGACAATATATGG TACAAGCAtgggttttgctttgtttttgataggCTGGCTCAAGGAAAAAT TAGCTCTGGCGAAATCTAGATTCTAGACcggcgaattcttagcaagccCA ATGTATTGATTGGCATGAATATGTACTTGAGGCAGCGAATGGAATTGTTA GACTGGAGAATCTTTTTTGTGCCTTGGACCGACGAAATTCGCTGATTGCC GGGCCTTAAGACCCCTGGATACAAGTTTTCTATATAAGATATGTAAGACA AAGttattttaaatatattttctccattttagaCAAGCATTCCATCTGCT GTATTCATGTCTCATCTCATACACACTGATGCGTTTTGTTGACACTAGTG TTGTACACGTGTAAGTAACACAAAAAATGTTAACGTTTTATACCCTTTGT AAATATGGGAAATCATATGCAATTGGAAGAGGGGAGCCAAATGAATTAAA ATTCTCTTagattttgaggaaaaaaattattttgttaccAAAGCTTGAAA ACTGAAATGATCTCTGATTAACTGCTGTTTAACATTTCTCTCTCAGAATA GCGCTCTCATTCAAAATTACaacatttctttttaaaattgtgtAATCTTA TTtctacttcttctttttcagatGGGTTATGGGTAGTGCAATGTTATATT TATCATTGATACATTTTAAGAGAATGATGCTGCAAGATGATAATTATGTT GTGGATATTTCTGGGTAAGACCACTGACCTTTAAATATCCTTGGactaag ctatatccgccatctttgatcataGTTTTTTTTGANATTTCTGGGTAAGA Ccaatgacctttatatatccttggactaagctatatccgccatctttgat catagttttttttgaaattggtattgaaaagaagccattgcaatgttaaa aattaacgtctaacggcgctacatcatcaaaagtatcagaggaaaagtag atctagcgctatCAATGTattttcaccgctattgagtagtgccgccaata gggctcagatcaaagatttttggttggcccggattgagtaacttggtagG GATATATAAGGTTCAGTGGGTAAGACCCTTTACCTTGTTCTTTATTTATT TAAtagattggttgaaaaaatattGTACACCAGTAGTGAATGTAGTCTAT TAGTTCTACTTTACTTCGAAAGACAATACGGGCACGCTTCGCACAGTAAG CTCGAGCCTGACTACACAATTGTATCATTGGGGATATAAAATGTTATATG CACAACACTAATAGCGTTTTTCAAGCTGTCtatcatttttattgcattGC TACTCAAATTTTTCTGATGATTTATATGTTATTTCTTCTTAGACCATTGA TGCTTGCCACTATAAAGATAACTTACGTTGGCTGTGGAATACATGATAGT AAGATGTcatttaaagcattttaaactttattctcaacttcagttgagct acaatctgacaatgtctgtctgtctgtgtgtgtgtgtgtgtgtctgtctg tcacaaaaactttagggcagcctgtagACNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTGCTTTTTTACACCCTAGTA GGGTTTGGTTTACACCAAAAGAGGAACCACTACTGGAGAGAACccatttt tgtgttgtttttgttttaactgCAATAACATCAACAGTGGGGAAAGCTCT TACAGTCTTAGTCTCTATCAACTTCCTTGCCCTAGATCacaatttgaata aaatctcCCCCCTTCAAGTGCACGATGAATTTTTCCCCACTTTCAAGGTA GAATAGGATATTTTACAGACACTTTTTACTCTACCTGAATATCGAACTGA CCTAAAATTTGAAGAGTATTGTCTCAATTTTGCTCTAACTTAATAACTAG ATGTTTTTCTGTGATCTATTTCATGTAACGTGAAAAGGAAAATTCATCAC TTTCCCTTTGAAATTCTTGTTTTCTAGAATATCATCCACGTACAACATCA GATGATGCTCGTATCATTTTAAAGTgagtttttcttaaaagaaaaatttg aatttcctgAAGGGGAATGATCTTTAAAAgaccttttatttctacaattt GCGTACATGTTTAAATATGTTGATTTCTAATACAATTTGCTAttgtttta aatctttttttttattctagaAAGTTTCCTTCTCCTTTGGAATACCTTGG ctacattttcaatttttcatcagTGTTTACCGGACCACCTCCAGAATACC AAGATTATATGGATTTCATAGATGGAAAACAATATGATAAATATAAGGTT ACCCAGCTTGCACACAACgctttttcaacgtttatctaacgttcacaacg tccatataacgttagatgaacgttgaaacaacgccgCGTGCTAGCTGGGT AATGAtctattaaaaattttaaatctcgACTTTGGACAATTAGACCAAAA TACTTGGCGGTAGAAGGTTATATTAcaggccaaatatctcaaaccatctg attatccctttaaaggctttatttttgcataagtgttcctgtttcatatc agacacatatttcttatcaggacagtgtctgtctattgttatattatgct gatataagcaaaaaatgtttttctttttctctttctgaccaatcttgctc ctcatccgtgtcaatccaatgtgaaaaagcttgtgaattaaaattaatga gtaagcaaaaaatatcgctcttatttaaaatcaaaacctttaaagggata ataagatggtttgagatatttggcctgTAGTAACCTTCTACGGCCTACGA TCCTGAGTAAAACCTCCAAATATTTTgatctaaatattttcaaaagtcga gaTATAACGATTGGAAATTactgaaaatgggttcttacacggttcttttg ttatatttcttactaaaagtaaaaaaacttgtaactaATATATCATAACT TAGGAAAAtagttaggcaaaaatattttgaggttttgttCTTGAAGGAac ccacatgccaaatatctcaaaccatctgattatccctttaaaaataCTTT TGGAAATTCAGTTTagtaaaagaaatattttacttttttaaaacaCTTAC CTAataaatgaaagtaaaatttgaatttcttcaacTTGCCTAGCCCTAGT TTTGGTACCCTGTCCAGATTTAGTGTAATGAGGGCAAAGGTtcgataaaa aataataaaaaaggtAAACTGAACATATCGTTTGTTTATTTGTCGTTCTT CAaaagaatcttttgttttatttcggTTTATTAATCTTATTTTTTACACC AAATCTGGACATCACTCTTTGTAAAGCCACAAAACCCTTTTTGGTGATCC CTTTTTCGGTTGGAAAGTTTCCTCTTccctttaatttatttttatttttt ttcatactttttagGACGAGTTGAAAGGGAAGCAACCTTCACCTATGGTA TTGAAATTATAACTTTTcttgaaatgttttgttttgtagaAAGGACTACT ATTAACACTATTACTAAAACCTGTTTCTTAAAATTTGcggtttattcatt ttttgtaaatatttctcTTGAGAGATtactcgttgaaaagataatttaga GTGGTTTTGCGAGAAAGTTCGAATATGaagataaaaattgaagaagaaaa aattgtaatcgTATATTTTAGGTATCACTTTAAATGCtatcttttatttt tccctCAAAAGTAATGTTTAAAATGTATTGACTGCAAATGTTTTTGGAAC AGATCATTTATATCAGACACAAAATACATGTTCCCGAAAAGTCCAAATTG aaagtgatttatttttttctcataccatttttttctttgttatttcAGCT CGTATCCATCCAAAAATTCATTCTTGGATATATGGCTATTGGAATGTACG GTTTTGTCAGCTCAATATTCAAGCCTGACTTTTATAAAAGTAAGTCGTAA TCCATAATAATTAATACACCCAGCGAATATTATGGTAGGTTGTTACATAA AAGGTCTCCTCTTTAAATGAATTTTAGTGGTTTAAAAAGCAGCCAACGAG TAAGGAAATTGTTCTCCTCAACATTGATATGATGGAGGATTTCTTGGAAA AGGACACAATTGTTATCTTGATGGACTTAGATTTTTAAATATGTAGGTAC AAGTCCGATTAATTCAATGGGAAATTTACGGGAAATAAAGTGCTGATAAG CTTGATTCATTTAACAATCAGCCCTTTATACTTAACTATCCCAGAAAATG ACTTTTGGTCTTTCAGTGTTTAAATCTtataatcgtcagccgtgcaaaat tactcgaatctgattggtttagaggagtgcgattaatcgttaattgcact attaccactttttgcactcttcggcggggggNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNatttgcactcgtccttcggactcgtgca aattactattttctcctttgttactcgtgattaatcgttaattgcactcc aaaccatacgattactagtactaatagcATCAACAcgtcaattaaaaaga aaatatcttatTTTCACATACCATTTTCAGTAAAAAGtgtaaaataaaat ctaaaagaaaaattatcaacaatatttttatacattttaaaTAACCTTTC ATTCCTTTTCATCTTTACCAATTTATAATAACTTCattaaaacaacaaca atataAAGGTTTGCTTAGAGTGCCAAGTAAATCTGTCCAGTTCCCAACGT TTACGgataaagattgaaagaaagaaTTTTAGCCCTCTACTATTCTTTGT TTTATTCTACTGTTTATAATTTTACTTCTTAATTATAGTAGAATCTCGGA AGAGATATCTTCCTTTTTAAAATAAGTTCCCTTCCTTTCTACTAGAGAAG GCCTTGAATGTATTAGGTATTTTTATTGAGAGAGAAGTTTCTTCTataat atcaaattttgaaaatgtagcAATTCTTCTAGTTGAGAATTTATCAATAA GATCCCTCTGTTAGAAGCTCGTGTATTGTaaagaaatttctttgataaag tCATCACACCTGGCTATCGACATAATTTCTATAGAAGGTTTGAAATTCGG GCACGATGCCTGTAGATAAATCATTAATTGTTGACTTATTTGATTTATCA GTGTAACCCTCTAAGGATCTTTGCGCTGTTTTTTCTACCAATGTATTCCC TGATGGGTTACCCACACTACAGATTCTACCTGATTGTTGCAAAGTCAAGT CATGCATTTATTCTGTTTAACATCTGTAGTCTTGTTCCGTTTTGCCGAAA TATCTTTTTCCAAGTACGAATTCCTTGAGTACGAAATCCTGAATGTTTCC CGAAATAAACAGCCGGGTTCACTATAGAGCTAATAGACCATATAAAGCGT CCAAtttgtaaaagttcattattgtGTTGTTCaaataagattttaaaatg TTCAGGCAATGTCGTATATCTGTTGATAACCATGGCTAAACGTATAATGA AAATACCGGAAGATAAAAGCCATGTTGCTGCAACCACCCAGTTAATAATC ATCATTGCTTTTTCGTTACGTTCGACTGATCTTTGTTTGATGACATCGGA TTTAGCTTCCTCTTGTTGTCTATGTAAATCTTCCTTGGTTTTCTGTGAGA ATAAGTGAACAATAACAGCTAATACTGGTATTGTTATAGTGACAAAAAGA TCACTGGCATCTTTATTTATTCTTTTGAGAATCATGTAAGGTATTGGCGA GCACCAGGGTAGTACCAGCAACGCAGTCTTCTTCATTTTACAATTAGCGC CAAAGCCTGATCGGACAATTTTGACATACCTATAGAAAGCTATACTAATT AAAGTATATCCACTAATCGCTATAATACCTGTCAATGCTTTTGTCAATGT GTGCAATAATGGACTTGCTACTTCTAGAATCTCCGCAATCGTCAATGGTG AAAGAACTGTACTGACCAATAAATCACCAATACATAAAGAAATCAATAAA GAATTTGGTAGATTTTGGAGTTTTCGATATCGTATGAAAAGATAGATAAT GAATAAATTTATAGGTATCCCGAACGTCATTGTTGTGCTGTATCCTGTTA ATAGAATGTATCTCCATACTGTCAAGTTAGCCATATCTTAAGGAGCGATT GATGAGGGGTGTGAGACGTCGACTGCGCgtggacaaatctttgaacaaag gcttaatctcaGAAGATCGGTAACGCAAGGCTACTATGCTTTATACAATA CCCTGTTCTCGTTCAAGTTGTCTGCATAGGATTTATCTCCGGTGGCAGTC AACGCCGGGTACGAGTCTGCCCTCCTTCCAGTGGTCTGTTCGATTCACAG ATAGTCGAGACggctttgtttttattgaaacatttcgaatgttttgaata cGTCGAACGATTTGATTGGTACAAAATTGATCACGTGCTTAAAATACTGC AataacttcttggaagaatacgATAAAGCACAACACAATTCTTTGCGATA TATTTTATCTCTCTCTCGTGAGTAACCTTCTGATTCAAAGTATAATCTTT TCactcttttaaactttttttaataaaatctttgtttttaattgGCTCAT ACGACCTCCGTTATGCTACAATTTTTTTGATTCAcgaaaatttcacaatt ttttttaattcacggaaatttcacaattttttgtAGTTCACGGAAATTTC ACAGCAAACACTTTTTCTTCAAACAACTTTTACCGATCTTTTTGGgcgtt ttaaagaaaaaaaagtcaaatgtAATAATGTATTATACTTTAAAATGCAA AAGGAATATTTAATCCGTTCTTTAAAGTATCCCTCACTTTGAACGATTAA TAGAATAATAATAATGCTATTTTTCCggcatttccaaaatttacatttcg cTCTTCCACCTGAAAATTCTGTATAATATATATGCAATGTCTAGAAGATT TATGAAAAATAACCTGCTGGTATACTGAGGAATAATATTGACGGGCCGTA TAAGACTTTACAATTAGGCCTATTTTCTTCTCTGTGCACTTTTTCACGTG AATttatattttcgattttcaccgTCTCATCCGAACATTTTCAACGGCTT TCCTTTGCGGCAAAAAGTTAACGGAGAGTATCTGTAAAAAATTCGTCGGC AAAAACTAAAATCGTCACTCACCAACAAATTCGTCCCTTTTTACCGACAA ATAGTTTTTGCTGACAAGTAGCGTCGGCTTTTTAAAGGAATCGAGGCTTG TAAAGGAATCGAGGCTTGAAAACACCTATAAACTGAGCAATAGATGGGTA GAACGGAGAACTTGGGATGTCTAAATGTTAaattacagttgacactctct aattcgacgttctactattcgataggctcccttattcggtgaaatttaaa gtccccgtcaataagaaactctcataaacggcGCTCCCTTtatcgataag ctcccttattcgatgaaaatccaattccccttgaagatcgaattagagaa cgtcaaCTGTACTTCtgtgttttcttttcattttagcACCAGAGCTATAC GAAAGTTCTTTTTGGTTCAAAGTAATGTTCGCTGAAATCATGGTTTATCA TCACAAATTTAAGTATTATGGTGCTTTCGGATTAGGTACGTTATTGGTTA ATACACTGGATTCCTTTTCTAGTTTAGTTCAAAGATGGCAGAATATAATA CAACTACCTAGGTGAATGAAGTCGCTCAGTAGTTGGCTCACAAgtagcaa aaattttaaaattgctgaaaaaaGACGGATTCGGATCctctggatttttt ttcaattatgaAGGACCCCCTTaggtttttttctcattttttggaccacc ctggattttaaacctcgttttactgaccaccctggatttttacactcgaa aaaccagaccccctggatttttatTTACCAGACCACCCGAGACGTCACTC CTCCTTAACATTGGATGTAATTTTCTCATTcgatttttaattaattttac ttCAGGTGAAAGTATATGTAATGCTTCTGGATTGGGATTCAGCGGTGTAG ATGAAGACCGCAACCCAACATGGGATAAATTGAAAACATTAAGGCCACTT CAAATTGAGGTATAGAAAGCGTTAGGgctattttatcaatttttatgcAC TAAACACTTagtaaccattgagtttaaagccgaaggctagagagGATTCT TCAACCTtttctaaagcaaaaaaaataaaagaattgaaGCCACTTTAGGG ATGACGGATTTAACCTAGCGCTTTTTTTCGAAACCCGGCGATAAATCATC TTCGCTTCTTCGGGGGTTTAAACTCAATGTTAGTAACTCAATAAAAGTCG TATCACGTGAAGTTTTATtggttttaataattttccagTATGCAACAAAT ATTCGTGGCTATGTGGATTGTTGGAATTTGACTGTAAATGTTTGGCTTAA AAAGTAAGTTTGGTTAAGCCTTAAGTTTATTTCCACCTATTTAGCAGACA AATTTTTACATGTAGCAAAATCATCTTGGGAATTAAATATCTATTTATTG aaccaaaattttactttatataaaaatttgtctttttttttttcgaaaca acTAATAAATACCGTGGTATTGAATTTCTTTCAAGGAATGTAAGATCACA ATATCATACGGTTGATTCTCTGTAGTTTGAGCTTCCATTTTTCGAATCTT CCTAAAGTTTGAACTAATTCCCACAAAGGGGTAACTCTTGTAGACTTGAA TTAAAAGGGATGAACCATAACTAACGCCCAGTTCCCAcaaagacaccccc ttctcacatacccggtgggattttttcagccaaaggGGATAGGAATAACG GACTATAACTGATAACtgaatattttgttttcaagtcagaaaatccaTTG TGCATGGGAAAAAATGGCATAATACTATGCAGTGAGAATTGggttatctg attattttcagtgggaacGAAAATggtaggataattttccaccggggacg atattttggacaattttccagtgggtctgtgagaagggggtgtacgcAGA AGAAACTCTTTATACTTGAATTGAAAGTGATGAACCATAACTAACGAGAT TGTTATACTTTTGTTTAGATGTGTTTATTCTCGTCTGAAAGTAATACCAT TCCTTGGTACTTGGGTATTCTCGGCATTATGGCATGGTTTCTATTCTGGT TATTACACATTCTTTATACCACTTGGGTTTGCGCTGTTCCTCACTCGAAA GGTATGCATTGTTTTACATTTACAATTTTTTAGGTGCCTTCTCTATTTCA ATGAGATATAATTTTACGGTTTAGCTCTCTACCaagaaatttcaagattt taccAGGACTTTTGGTTTGTGGCAGATATTTTCAGTTAATCTAGATTTCC ACCCCGCGGTTTTTTATGATGGATATTTTGATGGAACTTTtaggggaaaa tcatcctataatattcttagaatattcttaggttaggaccctaattcaaa ctagatttaGCATGTAATATACACGTctaaagcataaaatgacaattttg tgaaagtagtgagccttacttgggggtaattggcaaattataattgaaag tgctctaaaaatggcattcttttattcttagcatattcttaattttttgg tcaatttcatcatgaatattctgaTAAAGTataattcttatataaaaaag cgtgtattctagTTTGTTGATTAGGCAACAATTAGgctaaaattgaatat gggggtggaggatataacattttttgtaaGATCGGGTtaacccccggaca ttgtgacttttgaccacCGGACAACAGATTTAACCCCCGGACAACAGATC TAACCCTCCCGGACAAGCATCatttgaccccccggacattcaTAATTACC CCTAAAAAGAGCAGTTTTGCCCCAAACAAGCcaaatttttcactacccct ggacaatatatccaatatatcctccacccccatgtacgatTTTCTGTAAG AGCACAATTAACTGAAATGATAATCAAGAAgactcaaaaatctcaaatga aatctataaaataaacaGGTTTTACTAAGGATAATGGAAAGAATCTTTTA GActagatttcttttttattcggCTATCCCTTTGAAGACAAAAGCTTTTC AAATTACATTACAGGTCCGAAGAACAATTCGTCCGTACTTTTTATCGTCG CcatctttgaaattattttatgacgtcatcacttggTTCGTCACTAGACT CTTGTTAAATTTCTACGCCGTTGGATTCGCAACATTGAACTATGCAATCA CCTTCAAATTTTGGAAGTAAGTTTACCACATATCTTATAAAACACTAGAA gcaaagcaaaaaaattaatcCACAAACCTTTGTAAGATGACCCCAGTTTg gtgccggcaatttgatcaatcaAGACCATTCTCTCATCTCCTCGTTTTCT GCCATTTCAGTTGTTTATTCtgattgaacaaattgccgATACCAAACTGT GGTCTAATACTGTGATCTactcatcaaatattttttgcttcaACTGCGGT GGCTTGAGAAAGACAGGGtatatctagtgttttatataagatatctgtgg ttgaCCAAATTAGCTAGAAACTTCAAAACAACTTCTATAATGTCCTTGTA GCGAATGACTGAAAACCGAAGCCCATTTCATAATATGCATAACTGTAAAA ACATCGTGGAATTATTTCTAACCAACACGTCAATAATGAGCTGGTTCATG TAAAAATGACCGAATGTTAGAGCATTTTGCACGTAATAAGACAGAGTTTT TGCctctttctttaaagttgatgtctttgaaaattctttctaGAGTAATT TGCGAAATTTTATGCTCGggaaaattcttgacaaaatagaaaaacttaaa acaaaatgtaagatctacggcactttttagcctgttaaAGCCTCATAAGT GAAAGGACAAAGGTTTCAATCCAACTCAAGAAGTATTTGTACATTTGAAG TATTTTCATTTCAAGAAGTTATTAAATTTCATCTAATCCAATATTTTACT ACCCTCTTGCTAGCTCTGCAAGTCATTATGGAACCGCCATTTTACTTCTT GGCACCTTATTGGTTATTGTGTTTCAAACGCAACAGCAGAAAAAAGATCA CAATCAGAACGACCAATCACCTTCCATCTCTACCAACGGTCATCCCCATG TAACCAATGGCAACCATAATGGGTCCAGATGAAAATACCAGTTGTGTTAG CTTCTTGGATGGTTGATTTGTTGAGTATTAAAAAGTTTAAGATTAGTTTG ACTGTCAGGTTCTTTTTAacacagttgacgctctctaattcaacaTTCTA CTATTTAATACCATCGATGTTAATACGCTCCATtgttcgataatattgaa attctcctaGACGAGGCTTTGCCATTCGATATTCCCTTATTGCATGAAAA TGCCATACcttttgaaaattgagttagCTCTCTAATATTTTCTCGAAAGC CATTGTATCTTATTTGCGATGATTATGGGGCTTCAGGTACGCAGTGATCT AATTCTACTTTTATCTCCTATTTCTCTGTGACATTCTGGTGTATGTCGTT TAACCACAAGaacaaaatttctcaaaatggcCATTTCTTTTTATATCCAT ATAGGgagtggacgaacatttccagtgGGTAATCCAAGATGAATTTCCAG GGgctgttttttcatttttctaagggggtaaaaagttattctaaaatttc cagggggtaaaagactgattttagttcgtccaccctcacttttaagatat gaaaagaattttttaaggtacttttgccattttccagggggtatccacgc atttcaataattttttttttaattgaaaaggtttatccaccccccccccc caacggTTTTTTAATGGGACAGCCCATTGTGAATTTTAGGGTATCAAGCT cgttaaaattttgttttttttaatcaaatatttttgatagtTGTACATAA TAGTTATCTTTAACAAATTAAGTcgagtattttttttttagttcacaaaa tttttgataataatAGTATTTTTTTGGGATAGTTTTGATACagttaatat tttttctttgttttatatttacaactttgttttgtttatgcTGGTTTATG ATATATTTAACCTTGTTTTAGTGCAGTTTTCATGCGATTAAGCACCTAAG TTTACGGTTAAGACCATtgaaagaagaatgaaaaatgaaagaaaaataat caaagaatggtgtaaggaagccgaaaaaatgaGTGCTTAAATCAAGGGAG ACAGCGCAAAATGGAAAgtccgaaaaaaaatatattttaaaacgGTCATT GTAAAAGTACGAGCGGATAATAAAGGCCCATGTGTCTccacggtggcctg caaacctgtaaagctttattattataAGAAGAAAACAAGGCATTTAAAGT TCCAAAACGAAATAAAAACGCTAAAAACGTTTTCTACGTTGTGAAATTAT ggcttaaaattttcaattctcaAAAAAGGTCCAAagtaatattttcttta aaaaataattattgttTGGAGACAATTTTTCATTCGTGGGTAATAGACGA TATTGGCTTAACataaaaactcagatttgatccccgagaattccccacaa tgctttgcgcggaaaataTTTCACCGCGAACTTTTTCCGcccaaagcatt gtggggaatttgGTCTTTACttcttaagaaatattttaGGTTCTCTCACG TTTTAGGATTTAAAGAATTGAAAGTTACTGCCTaagtttattttgttttt ttttgaaaatttttgttgttattttcccggtttttttgttgttttttctg ttttatttacaATGTTTATTCATGTAcagtttatttttttatgatatatt tatatatttttttctatcttctatgttaaaattttggaacaaatttattt tgaataaaggGGCCAATAACATATTCTCTTTATCTAGTTATTAATGTATA TTTAGCAATGTTTATATTGGTTTACAGTTAAATTtctttagaatttcttt tgatattcgGCAATGTTATCTGCGTTTCAATATTGTATTTGTTGACCAAA TGTGGCCATGGTAATAATCCAC
Gene-mRNA-Prot