Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_001011 (gene) - C. hemisphaerica

Overview
NameXLOC_001011
Unique NameXLOC_001011
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000012:950836..987805-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_001011 ID=XLOC_001011|Name=XLOC_001011|organism=Clytia hemisphaerica|type=gene|length=36970bp|location=Sequence derived from alignment at sc0000012:950836..987805- (Clytia hemisphaerica)
GGTCGTTTGATTCGCCGTTCGCTTCTTTCGATTGACATCGTCTGGAATTA ACTACACCTTTTTTTTTAAACAATCAATCAAATTTTATGTAAAAAAGAAA AGAAATATCAAGAAAAATTTTAACAAGGACGAAAATAAAAAACATTGATG ACTAATACCTGGTTGCTGTTGGAAGTGTCCATACATCTTGAAGAGCTTGA TTAACCCTAAATTTGTCAGAGAAAAGACTTTTTTTGATGGTTTTCGCTGC CAAAAATTGATTTATTTATGTTTCAAATCTACCATTTTGGATTACCTAAT GTTTGTTAAACGCCGTAAATATGATAGGCGGCCGCACGCCCCACGCGCCG GGCGGTCATAACTTGCAACCATTTTGTGCATATCATTCGATCCACTGACC TTTATATAATAAGGTTATAAAAGGTCAGTGATTCGATCACACGTGGTGGT TCATTGGTTAAAGCAGGTTACCAGTTACACTCCCATCCCACAAAGACATA TGTACATGACATATACATAACAACATAATATATATTCAGCATATAAGAAA AATATTAAAGGCAATACGAGCCAGTACATTTGTAAGGTTTCTAAAACACT CCATGTCAGGGTAAGCAGTTCAATTTGATTTTTATACTTTTCCCTTGGTT CCTTCCTTTCTTTCTACTGTACTGTCTGATGACGACAGCGATAGCAGAGT GCTGCCAGACATGATTTCTAACCTCTGTTCAACAAGTTTTCACTACACTT ATACATTCAACATACCTGATTGTAAAGGATTCTTCTTTGCGGCTCATTTT ATTACTTACAATCAGATTCTATATTTTCTCTCGCAATCAACCAAAACAAC AATACACCTTTCCTGTAATTTGTAAAACTAATGCATGCGAATTATTTTGA TGCTCTCTATCCTTTGGTCTCTGGAGGTAAACAAACCCGTCTTTGCCTGT GCCTGCTGCGTTCTTAGGGAAAGTTGCAGTTGGTTTTTGAGCTTTTCTTA AGTTCTGTCTAACAAAATCCCCTCAAATTTTAGTATGTTCAATCTATTCA TGATATTATACCACTCTATCAGAATTAGACCAGGGTTATCGGCGTTAGGC CAACCAAAATTTTGAAATATTTAGGGGAGCCATCCAAACCTGCCACCAAA AACTAACTTTGATACACCTTTCCCGTAATTCGTAAAACAGATGCGCGCGC ATTATTTTGATGCTCTCCACAGTTTGGTCTCTGGAAGTAAACAAACCCGT TTTTGCCTGCGCTTCCTTTTAGGGAAAGTTTTTTTTTTTTTAGCTTTTCT CAAGTTCTGTCAAACAAAGTCCCCTCAAATTTTAGTATGTTCAATCTATT CATGGTATTATACCACCCTGGAAATCTTTTGCCAAAAGAAGATCGCTATT AAAAGTTAAAAGCTGAAAACCCACTTTCCCTAAGGCAATGGCATGGGAAT TTGATGTTCTGTTTACCGTCGCATTGTAAAAAATATTTGATGCGGCAAAA TTTCATTATTCATTATTCATTATTCCTACCTGGTGCTTCCCATCTCCAAC GAAGTTGAATTTCACGATTCCACCGTGAAATCGAGCTGCTTTCACTTTCG GAATCAAAATGACATGACAAGACGCATCTAAAACGCGAATTTTTAAAACG CCCTTGTAGCCGCCCACTGCTTAATAAAATGCCTGTCCCATTTGCGGACG TGATTGGAACCATGTCTTTTACTCGAGGCGTACATTTTGTTAGCGAAGAT GTTATTTTTGATTCACGTTGAGTGTTTTGGATAGCTTGGCACAGGAAAAT AAGAAAATAATGAGTTTTTAAGAAATAATGAACTTTTTTGAGCGGCGGCT CAAGAGCATGCGGGCGGTCAACGGTAAACAGAACATCAAATTCCCATTGC CTAACCCCTCGCAGGCAAAAACGCGTTTGTTTACCTCCCAAACAATTTTA TACACAACGGTGGAGCGCACATTTTTCCAGGCCATTTCTGAGAAGTTTGA ATCACGGGGAAGGTGTAATGGTTGTTTGTGGATATGGGTGTAGGTTGTTG ATGCTACTCGTGGATGTTTACTCATGGCAAAGAAAATTTTACCAGAAATA CCGTCAAAAGTAGTTTAATTCTCGTGTGGACAAATTTTTGCAAATCAACC TCAGTTTCACCAAATTTCTTACATTTTCCTAAAGGTTTTGGCCAAAATTT GGATGATAAATTTCATGAGGACTAATTTTTCACGAAAATGGCCAAAAATC TCAAAGATTTAAAATTCAAGCAAAATTTAATCCAGTTATGGCCAGACGAT CTCAATCGAACGGAATCAACGATCGAACGCAATCGACTGATTGAATTTCG ATTGTCGAATGCAATTGAATCTCAATCGAATGTCAAAATTCTGGGTAATA TTCAATTGGTTCGATTGTTGTTCGACTGGTTCGATCGTCGATTCCGTTCA ATTGAGATCGTCTGGCTTTATTCTTGCAGCTTCCCAACATTCGATTGAGA TTCGATTGCGTTCGACAATCGTATTTCAATCGGTCGATTGCGTTCAATTT GGTTCGATTGGTTTGATCGTCGATCGTCTGGTTATGGTATCAATATTAGA CAAGTTAATTCCATGCCAATTGTTACTTTGTCATGTATTTTATTTCTTTG ACTGCTTTGAAAACCAAAATAAACAGCCCCAATGCTGAAGTCTTGGGTTT TTTGTTTTCCGGCTTACACGCACGGCCCTCAAATTTTAGCATAGGGATGA TAAAGTTTCTTAGGGGGAGGCAGCTTGGAGACTTCAAAAATTGTTGGGAT GGGGGGTCATGCAGTTGGTTCCAGACATCATGACGGTTAGTACCGTGGTA CTGTAGGTCATATTTGATTTTTGGAATTTGCGGTTAGTACCTTGTGGGTA CACTTGGCTAAAATTGGTTCACGTGCACGACTTTGTAAAAATTTTGCATG CTTCACATGCATTGTCTTTGTTACGTTAGTGATTCGTCGCTCTCCTACTT ATTTCTTCCTTGAAAGCTTGCATGTCAAAGATTGCTTGTTTCAAAATTAT GTGCAGTTGGGTGTCCCATCCGCAACAAAAGCTCCATTTATGCTTACAAG TGAAGATCTGGGAACTAGAGGACCCCCATTTTTTTTTGTTGTGACATATT AAATGGTTTCTTGCGTTAAAGACATTTATTGCCTTTAAATAATCTTTTTT AACTGGTAAAAACTAATACAGTCCAAAAATTTGTCCCGTCCGCAACGACA CAACAGGGCTCTAAATAACGGTCGCCCAAATAGCTTCATGTCCGACCCAA AAATCATAATTTTCAAGCTAAAGCAACCCTGATCAGACATTATGTCGGAC CCACTGGAAATCGTTATTTCGAGCCTTGCACAAAAGTCTTAATTTCTCTT TTTTTGAGACAACTTTAATGTTCTAACTGTATCAAGCCAATGAACTAGAG GGAACCACATGCTTTTTGCAGCAGTATCATTTTTCTTGAGATTACATGTA CTAGCTATGAGCGAAAAAATTTTTGTCCTGTCCGCAACAAAGTGTCCCGT CTGCAACATTTTTCTCAGGATTGGGGCTGTAACAAACAAATTCTATAACA ATCCAAGGAAGGCTATTTAGTAGAGTTCACAAAAATGTGAAGTTCTTAGA AATTGCATTTGCCAAAGTTGAGTTATGGGTCCTCAAAAAGTGCCGATGCG GACGGGACATTGTACTATTTTTCTGCAATTCACCCAGTTAAATTGCCAGC TTTCTGTTTTTATTAAGTTGTGCATTACTCACTACAATGTCTTCTTAAGC TTTTTTCCCAGTCTTTTGTCAAAAAATGCAAAAGTGATATTTTTTATTTC TGGGGTTTTAGACCTAAATAATGTTGGCTTGGGCAGACTTGACTTTAAAT GTTGGGCCTTGTAGCTTTGTATCATATATGTTAGGCTTTGTGTTTATCTA TATATTAATATATGTAGTCTGTATGTCTGTTTTCTGTGTGTCACTTGTTT TCGCAAGCAATGTTTTTGTTCTTTTAAAAGATGACTTTGAGTTGTTCGAT AAGTTTTTTTTGATTGATTGATTATAATTCTTGACTTGCTTTCTTTTTTT CTCTCTTTTCTTTTGTTTTATGTTTTTGAACTTAATTAGCGACCTCTTGA TTTATTAAGACATTTGAATTCTTTTCAAAACAAAGCAAAATCTTTTAACA AAATCTGTTTACTTAAGTCGTTATAGAAAAAAACAAAACTAAAATAAAAC AACAAGACAGTTTGTCAGAAGAACAGCAACTTTTTAAAAAATTTTACCGC CAAAAACAAAGGAGTTCTTTATTCTTAACCCTATTCTACCTAGGGGGGGG GGCTTTTTCTGTTCGGAGGTCAAATTATTGGTAATAAATAGCTCCTGAAA TAAAAGAGCTTTTGCCATGAAATTTTCTGTAAATTCCTAACTTTTATTTA GCTTCAAAATAAAAAAAAATTTGACACCTAAAAATTTTCACACCTTGAGC ATTTCTGACAGTAAATGTCACAAAAATTGACACTTTTCCAATACAAATTT ATTTTTTAAACCGTAATTTAATGAATATTTAGGATAAATTAATCATTTTA AAACTCAGGAAACTTTTTTCTAAAGCCTTTGTTAGAATACAATAGCAATT TTCGGTCTTAGGTCACTTTGGGCATAATGAGTGACGTCATCAAAAAAAAA TTCCGTCAAAAGTTACCTTATGCGACAAGGATCTTGTGTGCCAAATTTCA TCCAAAAAGACCCACTAGATCAAAAGTTAAGGGGTGGTACAGGATCAGCC CCCCCCCCTAGTTCTGAACAGCCCCTAAAGGCCTAGGTTGAATAAGGTTA AGAACATCCTGGAACATCTAAGAATTACGGCAAAATAATTATCGAGTCAT TCATTGTTGAATTCGAAAAAGGTATGACAAAGGTTTAATAAAAAGCAACC AGGACATATTTTAGAAAGGCATGGTAGCGTCCGTTGGTGACCAAAAAGGG CACTTTTTGTAGTATTTTACTACAAAAAAGGCTGATTTTACCAAAATTTT AGTGATTTTAGAAGGGGTAGCGTCCGATAAGCGGACACTAAAAGGGCATT AAAAATGGTCTGGCAACATAGAATCGCACTATTACGTTATTTTGTCTGCG TGTCTTTCTTTCCTGAACTTGTGTCGTGTCTATAATTTCACCCTCCTTTT AAACAAATTCATTCAAAATGAAGCATAAACAAGTTGCATTTCAATCGCTA AACTTTTTTTTAGTGGTGGGCCATTCACCTCAGAGAAACCTACCTTATTG AAACTAATTTTTGCGGGAATTAATTTTAGCTTTTTTCGTGGTTTTTCGTC AATCGCAAAAATTTGAGCCTGCGAATTTTTTCCAATGAAAATCCAAGGAA AATGAAAGAAATTGTCAAAAAAAGGGCAAAACCGTGAAAATTAAAACCTG CAAAAATTTCAGAATGAAAAAAACGCTAAATTAATTAAAACCCGCGAAAT GCAATTTTTAGGATATTTTTTTTCAACCGTGAAAATTAGTTCCCGCGAAA ATTAGTTCCAATAAGGTAAACAAAAGGGATGAGCTGGAGTTTTTATAAGA TACTTCACTAATTGGTCATTTGAAGTGATAGAGATGACGCATTCTTTAGA AAAAGTAACAAAATTGTTTTATTACTGGTTAACGACGAACAAAATGAAAT AAGAGCTTGTAAAAACTCCAGCTTGTCCCAAATAAAACAATTTCTGTCAC AACCATCACGTAACTACAATGAAAAGTTTCAAAAGTTTTCTGCAACTGTT TCCATCTAGACAAACTGCTAATGAATTTTTTGAATCATTTTTTGTTTCTG AAACCGATTTGTATATGTTTTCTTTTCGTTATTAACCCCACGGTCAATAG CAACTTTTTGCGTATTTCATTTTTCAAATGTTTATATTTGATGAAAAATG TTTCAAGTGGCCCCAGACCTTTATCTTGACATCAAAGTTTCCAAAATTAT TGAAAACTAGGGCAAGTAGGGCTGCCTAGGGTATTAACAGGTTTTCAAAT AGTGATTACCTTGAGCTTTGGCCGCTCAAGACCAGGTGCCAGCCTGGTAA TAGTCAAATGTACTTAGTACTGCAGTGTACTAGGTCTAGGTGCAAAAAGG AGTGGTGTCAACTGGTGTATGTCAACTTTGTATTTTGCTGTTGTTTTTTG CTACAATTGGGCCTATGAATAATCTGAAGCATCTCAAGTTGAGCCCAGTG CGTTGCGCACGTTCGACTATTTGGAACACTGAAGACAATTGAATGACAAT TGATCCACCTAGAACTAGGTGTTTTGTGTGAATTTGATTGCTTTGACAAT TTCAATCGGTTGACGAATTCTTTTCCAATCTAGGGTGTTTTAAATATCCC ATCAATTCCTTTTCAAGTTAGGAAAACATTTTATAAAGTATTGAACTCCT TCTTCTTTTTTTTTAGATAAACATAATGCCACTTGGAGATGTGCGTTTGA ATCCTGAGGACCCCTTTGAAAAGATAGTCTTGTTGGAGCAGAGCTTACAG CAAGAAGGATTCAACAATGGTTTTGACAGCGGTAAACAATCAGGACAGAT TGAAGGTTTTCATACTGGTTTAGTTTATGGTAAAGAACTTGGTAAGGAAA TTGGATTTTATAAAGGATTTGTGTCTTGTTATTGTGAACTTTTAACTGAA CAAACTGCATCAAAGCGACAACTGAGTTTGCTGAAACAACTTTCTGGTTT GCTTAATGAGATAGATTATGAAAATTCAGAAGATGAGGGAATGGATGATA AGATGGCAAAAATCAGAACCAAATTCAAACAATTGTCATCAATCCTTAAA GTGCCTGTCAATGTCAATAAAGATCCAGCTTTGTTGAGTTTTTGAAGATA AATTGGCAAAGAAAGGTATATACTTCTATACTTTGGATAAATTTTGCAAA TTTTCAAATATTTTAAATTCCTTGTCTATTTGTGTTTGTTTGTATGGGCA GGTTTTGATATCATAGTTTTTTTATTCTTAACCCCTCCCCCATTCCACAT ATTTTCATGTGCATTTAAAAATTCAAGCTCATCTCATTTAAATGGCAAAT TTTAGTTAAATTTTGATTTTGTTGATTGAAACAAACGATGTTTTTAAAGA TTTCNCAATAGTCAAATGTACTTAGTACTGCAGTGTACTAGGTCTAGGTG CAAAAAGGAGTGGTGTCAACTGGTGTATATCAACTTTGTATTTTGCTGTT GTTTTTTGCTACAATTGGGCCTATGAATAATCTGAAGCATCTCAAGTTGA GCCCAGTGCGTTGCGCACGTTCGACTATTTGGAACACTGAAGACAATTGA ATGACAATTGATCCACCTAGAACTAGGTGTTTTGTGTGAATTTGATTGCT TTGACAATTTCAATCGGTTGACGAATTCTTTTCCAATCTAGGGTGTTTTA AATATCCCATCAATTCCTTTTCAAGTTAGGAAAACATTTTATAAAGTATT GAACTCCTTCTTCTTTTTTTTTAGATAAACATAATGCCACTTGGAGATGT GCGTTTGAATCCTGAGGACCCCTTTGAAAAGATAGTCTTGTTGGAGCAGA GCTTACAGCAAGAAGGATTCAACAATGGTTTTGACAGCGGTAAACAATCA GGACAGATTGAAGGTTTTCATACTGGTTTAGTTTATGGTAAAGAACTTGG TAAGGAAATTGGATTTTATAAAGGATTTGTGTCTTGTTATTGTGAACTTT TAACTGAACAAACTGCATCAAAGCGACAACTGAGTTTGCTGAAACAACTT TCTGGTTTGCTTAATGAGATAGATTATGAAAATTCAGAAGATGAGGGAAT GGATGATAAGATGGCAAAAATCAGAACCAAATTCAAACAATTGTCATCAA TCCTTAAAGTGCCTGTCAATGTCAATAAAGATCCAGCTTTGTTGAGTTTT TGAAGATAAATTGGCAAAGAAAGGTATATACTTCTATACTTTGGATAAAT TTTGCAAATTTTCAAATATTTTATATTCCTTGTCTATTTGTGTTTGTTTG TATGGGCAGGTTTTGATATCATAGTTTTTTTATTCTTAACCCCTCCCCCA TTCCACATATTTTCATGTGTATTTAAAAATTCAAGCTCATCTCATTTAAA TGGCAAATTTTAGTTAAATTTTGATTTTGTTGATTGAAACAAACGATGTT TTTAAAGATTTCCATTCATTGTAACCTTGCTCTTAGGCTATTCCTTTCTC AAAATCTTCCATTCTTAACAGTCTAACAGTATAAAAAGTTTTAACCATAC AATGAGTGTATCAGAATCAGTTAATTGCACAAGACTAAACTTGTGTAAAT TAATCATTATCTTTTACTTGTATGCACAATTACAAGTTGATGTTTCTGTA TCGTTGCTCTGCTAACAATTATGAAAATTGTATGGTAACAGTAGCATACC ATAGTTTTTGATTGGTTTATATCATAAGCTCATGTGGTTCATGCTGTCTG TGGCCTGTTTGTTGCCTTAATTTGTCATTACAAAAATTTTGTTTTGTTTA TAAAAGAGGGAACTTTTTGGAAGCATTCTCCATAAAATGTTTTCTGTATG TTTTCTGTATAGCACTTGATCGAGACTTACCTTGACTATTTACGTTGTAA CCTAGTTTCTTGTAATCTTGAATTAGTTGGTATTTGCCTTGGCTTTGTCC CTTTTGTCTTTCCCTCCATTGTCACTTTGAAGTCATTCAGGTGGTGCATG TCAGTGAAAATCTTTTCAAGTTGAGGTGCCACCTGACCTGGCAGTTTTCT CCCCAAGGTAACAAACCAATGGAACCGACTAAGTGAATATATCCATCAAG GATTTATTTTATTCTGTCCACACAAACCACCTGGCAGGTTTTTACAATAG ATAATTAGATCTTCTAATTAAGATCCTGTTCTGCGGTGAGATTTTGAATA TCCTTGTTCTTTGTATACTAGTCACTTTTTTTTGTACCATCGCTCTGCTA ATAATCCCTTTGTGGAAATTGTCTTCTTTGTTCCATTTAGACTGAAAGGC TTTTTTGAAAATATGCCTATACACCATAGTTGTCATTGGTTTCTTTCTAT TACTTATGTGTAACTAAGATATTGTTAATGCTGGGTAATGGCCTATTCGT TGCCACAAATTTATATAAGTTGCCATTTCGAGAAATAAAATTGCTACACG GTGTTTTTATACTGGCGCAATCATCAGCAAAGTGAATTCTACAATCTCAA ACTAAGAAAAAAAAATATATTTGAATTTATCATAACAATAACAAATAAAC CAGCCGAGGCTGGAAGGTCAGCCAATAGAGCTTAGCTAGATAGCTTTAAT AAGTGGGTTAACAGATGTAAGAGATGCACTGAAACAGAGNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNCCCCCCCCCCCCACGAGAAGCTCAAAGTATACTTCTCTTTAGCATTG TCCATATAGTACGTACTCAAAGATTTTCCAAATATTTGACACCCCTCCCC CTTGTACGCAGAGAAAAATAGAAATGACTTTGTTTAAACAATAGATGTAC GCTTTTGCTGAACCCCCTCTCCCCCTTCACTGTGGATGGCCAGTCTGGGT AAATAAATTTTGTAGTTTAGTAACCGTCAAGTTACACAACATGCACACAA CCATCTTGAAGACTTTGCTGGTCGCAAATGNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNTTCTTAACAGAAAAATATTTTCGACTGACCGGCCGAACGACTCC CACTTTTTAAAGTAGAAATGACGGGAACCAAACAGTTTTTTGCGATTCGC CTTTATCTTTATCACAAACACGTCCAAGTCCAAAAAAGCACGATTGCATC CAGTCTTTATATCAAATTTAAACAGTAGCTTTACTTTTGTAAACTTTATC AAATCCCAATAACATTATAACACCATCAATTCCCCTAGAGGCAAACAAGA AAAATATATGTTTTTATTGCAAAAACTACAGTATTAAAAAGCACACAAAG TATATCAGAAAATTCAACATAAACAAAAACTTGAGCAAACGGCTTTAAAC CTTCAAAGGATATAGAAAAAGAATCCCCTTGATGAAAATCATGTGTTTGA TTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNATCATGTGTTTGATTTGCCGAGTTAAAAAAATA AATGACAGAAATTGAAGCTTGCAACAGATTTACACTGGAAATACTTTGGT ACAACACTGACTTATCACTTCTGACTATCGCTTGAGAGCCGCCGCCATCT TGAAACTACATTATGATCTGTAAAAACAACGCACGCTAAAAGTACCCAAA AAGTTAACCCGATCGGAAGAAAGTTTAGAAATCAAANNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAG ATCGGAAAATCGGATTTTTTTTTTGCCGTCTTATGATGATGGTGATGGAA GAACCGAATTTTACGGATTTGAATGCTCAGCTTAGGCTGACCAAAAAGTT GATGTTGTTACATGACAACAAATAAGGAGGCATAGGTTTTAAACTTCAAG ACCGTCAGTACGACTTTTCAGAAAGGCCGCAGTTTGGTGTTAAAAAGCTA ATTTTAATCGACACTAGGAAATCTTCAATAGGAACACTTGTGTCTCCAAA ATAATAATATTGAAATATGCTAAAACTTAGCTCATCGAATTTGGAATAGT CCTAATCCAATAGGTAAATGCCAGCATGAAGTTGAAATTGCTAAAATGCT AAAATATAAAATGTAAATATTTAGCATGGTACTGTAGGATAGAAAAACTT GATCTTGTCAATTCTTTTCAAAAAATCTGAAAACTTAATGAAATCCCCTC GATCAAGGCTTTGATGAAAGGAGCTATGACATCCTTATGTAATCCTTCTA TGGTAACTAATTGGTCGATTTTTGCTTGCTTTCTTGTGTCTAGAGTATTT TTATGTCCATGGACTGAATGCTTGGTAGTTGAATCCAAATGAGCAACTTT TTTCCTTAGAAATAAAAACACACTTTGAAACAACTATATTATACAAATTT CAAGATCTTAAATTCAGAAAGTATCAACTTTTGCAAAAAAGTGGAATTTG CTCAATTTGATCAAAATCTACAGTCTGACTATAAATGATTGGCTCAGATG ATATCACGCCCTAATGTTCATGAAAAATAATCATTATACCGAACATCATT TGACCGAACAAATATAAGACATGACTACTGTTAGCTACAAATCATACGTT TACATTACAATTTCTTGAGCTGACCGCATTGTGGGCAAACCAATCACAAT GCGGGCTGCTTCCTTTCTAGTCCCAATCCACCTGTCCATGATTCGTTCTC TTTGTGAATTCAAACTACGGGGTCTGCTACTAGTACCCATATTTAAGTTT GCGCGCCCACCGATGGGCGGATGACGGGCGTTTCAACACCCGTGACACAT GGTTTCATTGTCATTCCAGTGTGCCAACATCATGTTGCACATCAAAACTA AAAAAACCATCTTACAATGTGTCTTTTAAGGGTAAATGGTATCTGTGCAA ATCTGGAACAACCAAACATCCAGTACTTGGTCCTCCAACTTCCAATTCAT ACCAATGCAACGGTTGTTCAACTTTATCAAAGCAAATTAATTTTTCTTTT GGAGGAGAGTACAGATCTAAAGTTTCCAAATTAACTTGGAAGCATACAGT CCAGTTTGTCCGACTTTTTTATTTTTTTATTTTGAAAGCAAAATTTGATG ACTTCGGAACTTTTTGGAAGCTGTCTGCAAAGTTTCCAATATGAATACGC TGAAAATTACGATTTTCTTACCAGGTTTTAACGAAATCCAACCTTCGAAT CTTTGATAAATTTATTTCCTAAGGCGGTATTAGACGATTTCGAACCTGAA AAATTTCCAATATTGAATTCACAGGTGTTTCATGCCTTATAGAGCAACCG TATTTTTCGGATTTAAGGAGTATTAAAATTTAGCATTTTTTAAAGTATTT TGATTAATAAGTTATGATACTTAGACATGATTCTCAGGCTAGAAAATCAC TAAACAGTGAACCACTCGGCAGGTGCACAAAGAATGTACAATCATACAGG ACCATCCTACCACTGATTAATAAGTTATGATACTTAGACATGATTCTCAG GCTAGAAAATCACTAAACAGTGAACCACTCGGCAGGTGCACAAGGAATGT ACAATCATACAGGACCATCCTACCACTGATTAATAAGTTATGATACTTAG ACATGATTCTCAGGCTAGAAAGTCACTAAACAGTGAACCACTCGGCAGGT GCACAAAGAATGTACAATCATACAGGACCATCCTACCACTGATTAATAAG TTATGATACTTAGACATGATTCTCAGGCTAGAAAGTCAATAATCAGTGAA CCACTCGGGGCTAGAAAAAAAACAACAATATTCATTATTCCTCAGACTTA CACTTTTGTAATAAAGTTTTCTTCTCCACTTTTTGTCTTCTTCTTTCTTC CAATACAAAAATAGATAAGCACATATGGTAGTCAGCTTAAATTTTCTTCT CGACGAATATCAGCAAGTGGCGTACAAATCAAGGTACAATCAAACAGGAC CATCTTACTACTTTTTAAGTTATAATATTACTCTCTGAATCGCTGTCTGA AACATTTTCCGAATTATTTGAATCATTGTCCAACCCGATGATGAATCTCT CCTCGTTATCGAGTCCACTGAAGTCAATTCTCCATAATTTCTTTTTAACT TTTATTGAGCTTTTTTCGATTTTTGCCCATTTCGTAGGCGTGGCATTATC TAATGCCTTATTCACGAGGTCCTGAACATCTTTAATTTTATAGGTGGCGT TTTTTTCTAGCAACATACTTCTGATTTAACTTGAGTTCTGACAATTTCGG TAGGATTCAACTCCGAGAATGTGAATGTTTTCAATACAAAACCTTTCAGT GATTTTCTCCAAATTGAATTCTTTGGGAATGAAAATTGATTTGCTTTTTA CGAGTAAAATTGGTCTTCAAAAGGGATTTTTCCCCTCGACCAGCCTTGAG TCTCAGCTTTCTTCCATGATGTTTTTTGGGTTTTGGACATTTTCCGTTTC CCGAGAACGGTAGCGAGCGTCCTTTATGTCATTGAAATGAATGTCGATTC GAAATGATTGATTATAGTCGTTACATGTTTGATAGGGGAAATGTTAGTGA ATAAAAATTTTTCACATTGGATTCGGACATTAAAAGTAAAAGTATTTTTG TCTCCGCTGCAAATTATATGGAGACAGGCATTTGTATTTGGCGCGGAGTC CCTTTCCTTTGATTCACGTCTTACCCTTTTTGGAATTGTGCCAATTACTC ATATTCCATCTTGGTCGTGCGCATTCTCTGTGTGAGCTCCTCCTTTGTTT CATTCTGCTCTAATGCTTGCTCCAACAAAACTTTGTTTATTTGGTTGAAA AAATCAGTTAATCGGGGTGGTGTGCATAACATTAAAGCCTTTGGTCTTTC GTTTGTATTTACCGCTTTCTTTAATTTCTGGCGCTAGTACTTTAGGTGTA CAAACCTTCGCGAGCAGAAACTTTCGTGAGGACGAAAAATCGGGAAAAAG ATTTTTTCGCGAGCATAAACTTTCGCGAATGAGGCATCTTTTTATAAAAA AATTCAAGTTTTCAGTGCGTGAAACCAGTGTTACGATTGTTCAAATGTAC TCGTCAAACCACAATTGGTAGACTTTTGCATAATTTCTACACTAAATTTA TCTTTTATCATCAAAGAGGAAAGATTTTTTTTCGCGAGCATAAACTTTTG CAAATTGCTCTTTCAAGAATTTTCAAAGCATTTTCCAATTTTGTGACATC TTTTAAAAAGCTTTTTAAATTGAATTTAATAGATTATATCTCAATTTTCT TTGCCTCTCTTTGCCCAGGCTGGAAATGTGTTTATTTTTTGCCCAGTTTC AGCCTAATTGTTCTTATAAAGTGAGTTCTAATAAAAATGAAAAGTGAAGT GTGTCGAACAAGGATGTTATAACGTTCAAGGCTTTTCATGGCTTTCGTGG CTGTCCTACACTTTTGGCTGACGACTTTTCTTAATTCATTTGGTTTCTTT CTTAACTCAGTCATCTCTGTTGGGTGTTTTTGGTCCACTCTGGCAAGTGC CTTGTTGAGCTGAGTTGGCAACAGCGCGTCGCAAGTGATTTGCTGACCCT TGTACAAACGATTCACTGCTGAGTAACGGCGTTTCGACAACTCTTGCTCT GAGAAGGAATTTTGAAGTTCTTTTTTGATCATCTGTAGCTTGATTTGCGT AAAATTGTTTCAGTGCATCTTTTTCTTTAGAGCGTCCCCAATTAATTGCT TCACTGGACGATAAGTTATCAGACGGGCGATTTATAATTTTATGAACGAT ATGTGTTGTTTTGGGTTTTACTGTGGGTTGTGACTTTACAATGGTGTTAA CCCTGGACGTCCATATGACACTCCAATGTTGCCACGATCGTATTGCTTCA ATACGTACATCCTCCCAACTACATTTTCCGGTAGAGTGGCAGCAATTTTC TTCGGATCTAAATTTTTCATTGATTTAAGCCATAGCAACATGTGCACATG AGGCGTACCTCGATATTGAAAGTCAAACCTATAGAAAGTCACAGTAACAT TTTTCCCATTTTTAGTCGACCTTCTGTCCGCAAACACACGAGTACTCCAC CTATTACTGTTGCACCCCGAAATCAATCCTCGAGCAATATTTTCTAGAGT GTAATATGTGCACAGTCAAATGGTAAGGCAACAACTTGAGATCTATCCCG GCATACTTTTGTCCTTCTGTAAACCACTCAGGTTTTGGAAAGACATAAAT CGGTCGTACTGGAATTGAAGTAAAGAGTAGTCCAAACCATAGTCTACAAC ACCCGACATGGCTTTATAATGGAATGCCCTTTTCATTGACAATCGAGACT CGTTCCCCGAAATAGCGTTTTCGCACCATTCGTTTTTGACATATAATAAA TGCCAAATTGCAATTTCAATAAACTCTACACGAAATGCTCTATAATAAGG AATTTGCATTTCTTCTGTCACTAGTTGTTCGAGAACATCGCTATAAAATT GGAAGTAGTGTTTGTTTTCCATCAATTTATCGAGACATTGCTGTGCAAAG ATTCTATCTTCCCCGTCGAGCAAAGCAACACGTTCTTCTGGCAACGACTT GTACAGGCCCGTTTCGCTTTTTGTACCCGTGTACAGTATCCTTCTTTTCT TTAGTTTCTTTAGAAAAACAGCAAGAAATTATTTTTCTGAATTTTTGACT GGGAAAACTGCGAAAATATACTAAGAGGATGGAATATGAGGACTTGAACA TAAGTTCGTGGGGGAAATACACAAGTTTTCATGTTTTTTATTAGATTTGT GGTCTTTCGACCGAACCAAATCAACCATAAACAAGGTGTGTGTGCATGTT AGTTGAAGATGTTAGTTAGTTGTTGACGTCTTAGTGTATAGCTGGATCAG ATGTGGATGTGATTTTCTGTTGCATCCTTGTCCAAGTCACCAATGTAGTG TGAATGATCACCCGCGATCAAGTATCCCCGTACTGTCCCGTTGCTGGCAA TGTAAAAATACATCGTTGAAGTCGTCGAGTTTGTCCCAGTGATCGAATGT TCCAAAGTCCGAACTCTTTCAGTCTTCTCCATATTCTCCAATTATGTATC TCTTTGGGCGTTCTCCTCCGGGGACATCTACAACCAAAGACAGTGTTGCC ATGTCTCCGTGGTATGTCAATTCAAGTTTGAAATCTGGTGTTGCAATCAT GTTGATAGTATATCTAAGGCGTCAGTATATAGTTTTGTTCAAATTTAAAA ATTTTCTCTTGGAGTGGAAAATTTGGAAAGTTTTGAGCTATTTTTTCAGC TTCTTTGGAAATGCAGATAACTTTGACATTTGAAGGGACATCAACGGGAA TACACTTTAAAACAACAGATAAGGGACTAACGATATGTAGTTCATGAAAA AGGGTAGATACAGATTCATCAGTAATAGTTGTTTGTAAAGCGGGTTGGAC AGGATGAAATTGATGCAGCTCCTTAGCACGCAAATCTTTTCGGTTGACAT CAATATTATTTTTCTTATCATCTGAGCAGATCTTTTTCCTTATAACAATG TCTTTTAATTTTTTTGGCCCGATTTCCCTCTTGGTTTCTTGTTCCAATCA CATGGAACGTCGGTACAGGCAGGGTCGAGATATCCTTTCTGGTCAGCATA ATCTAGTTTATACATAACAGCAATCACGCGATTGCAAGAGCGGCTACTAC CGTCAGCCATACAACTACACCAACATGTCAAAATGGTAACAGTGTTTTTC TGAATAGCTATCCACAAACGTTTTGTGTCGCTCACTGTTAGTGAAGGCCT GAACTTCAGAGAATATATAAAAACTTTGTTTTTGGATGAGGATGACTCGT AGATAAAGACGGTCTGAACAAAACCACTGTCAAAATATGAAAACGCCTTC TGGTCTTTATAACACCCAACATAATCAATTTCAAAATCTCGTACTTTTAG AATATTATCAAAAATAATTCCCAAATCCAATTTTGGCCGATTCAGGTAAT CATCTGAAAGTTTTTCACTCTCGATATATAAGAGATCACACAACTTGAAC TCCTTCAACCGTTTATCATATTCATAGCCAAAACCCTCTTCTGCTCTTCC ACTGGCCCGACGGTTGGCAGATTATTCTCAAAAGCATATATGCATAACCT TTGTACCAGTAACAAGCATACCCCGTACAGATAGATAATCTATAAGATTA TTCATGCCAAGGTCCATTAAGTCTACATGTACCACAGGAAAGAATAGTCT TATCCCAAGGTCGAAACTTTTAATTTTCCATCCCGGAAAATGCCATGGGA TCGTGAAACAAGTTAAATTCCGTGTTGGAAAAGTTTTAGTTTCCAAGGTG CGAAATCGTCTAATTCCGACTTGGAAAACAAATTACTAGAAAATTCAAAG GTTGTATTTCGTCAAAACCCGGCAAGAAAATCGTGATTTCCAACGAAAGG TTTTTGAAAATGCGGGTCGTAAAAAGTTGATATCCCAGACATCAAATAAA ATAAAAGATATATAAAAGACAAATACTTACAACATTCAAAAACAAAACAA AATAACATAACAAAGCTTGACGATTCATTAAAACTTTCTTTCCTCGAGAT GCGATGATGTTGTACACATCTATCATTTAAATTGCAACGAAATTAGAATA GTGAGTTTACGAGAAAAATGTGAAGGAATGTTGTAAAATTTAAAATTTAA AATGGCTCAAAGCCACGATAAGTTTAAACAAAAAGAGTACATAAAAAATT ATTTAAAATTATTTTCTAAATCAATTAGTCTTCTGCCCGGCCGTCTCTTT CTTAAAATCTTCGTTCTTCCAATCAACAAACACAACAACATTGTCTTTGT TGTCGACTGGCTTGTCGATGACCGCAGCCAAGCGCTTGTTTAGAATCGCC TTTGCGATATAAAACGCCGCTTGGTTAATAGCTGATTGCTTCAATTTTCT CACCTCACAATATATTCTCGCTACCTCATCCAGAGGTAGCTTCCCAATTT CCGAAATACCAGGACTAGAGTAGTCAACCGAAAATGCACATCGCAAAATT CTAAATGCCAACCTTGGGATAAGATAATTTTTTCCTGTGTACTTTTGACA TTTGTTTTGATGTATATATTACTGCTAAAAGGAAAAAGAAGTTATCATGA GAGGAATATCATTAACATACAGCTAATTGCCTAGGACGCTACAACACAAT CTGAGAACGGATAGGGAGACAAGGAAACAGAGACAAGTAGATGTATAGGT CGAAACGTGAAATGTATTTCCGAAATGAGAGTGCCGAAAGTATGTTGGTG CGATGACGTGGGTTTTGGGATGCCATTGGGGATGTTAATCGGTTAATGTG AGTTGCACCCCTCAAGTGTGTGTTGTAGACCTTATCATTACACACATCCC ATCTAGCAGTAGGGTTATTCACAATAGATGATCTAAATGCTTGATCGTAA TTATACCAAGCCTTAAAGTTAAAAGTTCTGGCTGCCTGAGCAATGTATAT TTGATATTTAGCCAATTGGCCAGCCAAGTGTGGATGGAAAATAATAAACG CTTGAAAAAACAAAGTCTAGGCCAGAAACCAAGAATGAATGTCAGTAACT CTACTTCTGTTAGACTGCAGCCCGTTGTGAATAAAAATCTTAGGCATAGT AGATACGTTGGAATCATCTAGTGAAATCGAATATGCGTTACGTGTCTCAG ACGGCACATTATTAGGTAGTAGCAAATCAAAATTTACAAACTCACCCTTT CGTATTTTTTCGAGGACAGCTGCAGGAATGGCGGGAAGATGTTGATCAGG GTTATTTCGGGGCTGAGTTGGCAACGTTGGTGGGTTGATTGGTGCAAAAA TAGAGTCAGCGGAACTGGAGAGCGATGGAACAGCCCCTTGTTGATGTTGT TGGTCTGTAACAACGGCAAGAACCTCTCTGACAGTGAAGGATCGTGTTGT CGTGGTATTGGGTTTCCGGATCTGTGAGACCAAGTTTCTGTGACGACTGC TTGTGGTGTAGACGTTGACGAAATGCATGTAGGTGGAGCGTGATGAAGAG CATCCCCGCTGCTGAAGGTTTGTTGTGCCGTAGTAACATGGATGGGAATG GTTGATGGTGGAATGTCTGGCGGTCCGCATGATGACGTCTCTATGGTGGA GTTGGTTAGAATAGGTGAAGAAGCGGAACTGGACAAAGATGACTGGTGGT GGTGAAATAGGGCTGTTGCCAATTGGGTAGCGGTGCCAGAAGACTGTAGG TTTGCAGCATTAGCATGCAGACGTAACGATTCAAGTGGCAGCGCATTCCA CTGTTCCAGTGATCGTTGCTGTGGCGGAATACTTGCCACACCATTAGAGT TATATTCAGGTGCAGGATTATCAGCCTGAGATGTGTTTGAAAATGGTGAT GAAAACAATGATTGTAAACAATGATCTTGTGATGGACATGGTTAATAACA GTTGAAACCGCAACTTAAGACGGATTATAAAGGATTAAAACAGCAGTTCA CGAAATCGAGTTTCTAGCTCAGTAGTGAAGGTAGAAAGAAAATGTTTACA AGTTCGTCTCAGAATATAAGGAGGCATGTGGCGCCAAAACACTATAAAAT GATGAGTAAGGATAGGAATGGCGCGTTATATAGTTACGGTACCGAAAACA ATAATGGCGTCAAACAATTAACCAGAGTTAAAGATAACTCCAAAACAAAC TCACTGTCTTCTAAAAATAAGAAATAAACAAATCATGTAAAAATCCTTTT ATTTACAGAAATATCCTCTGCTTGAACAACAGTTGTAATAAAATCCTTTC AAACTGTAGTACAGACACAGTAAAAATTGACTCAGGATTTGTAAAGCTGA TGATATTGTTCGAAATGAAAAAGTAAAGTAACTTATGTTCAAATAATTGA GAAAAAAAATGAAAAATTGATTAAATCTTAATTGACAAATAAATTTAAGG CTAATTAAAATAATGATATTTGATCATTAAATTTAAGGCTAATTAAAATA AAATTTTTCAAAACTTTGACCAACAGTAAGCCGTCATCAGCGCGCACTGG TCCTTTATCAATTACAGTTTGCGACCGTGAAATGGCCTACTTTTTAGAGG TTCAAATATACATCTAGCGGCATCTCTTTCAATTCCTTGTACTTCTTACG TAGATATTCACCATGTGACGTGGTCAGGACGTCATTGATTAGTGTAAACC CATATAGAATAACGCTTGCTTTTGAAATCCACCCATCCTTGCGCCTTTTG CCGTCCGAATAGAGCATATGAGGAACCCATTTCTTATTCCAGCTTCCCTT CCAATAATTGGCTCTCACTTGATTTTCCTCAACTTCGATGATCTTCCCTA ATAAATCAAAAGGTCGATATTAATAGATGAAATATGTTGGTTGGTAATCA ATTGAGTCATCCATCTTGTGGAGCCCACTGAAAGAATACAACCCAGCCCG AGCCAAAATTTACTTGTTCTTTATAAAAATGTTTTCTAGATATTTACCTA TTGTAGGTTCTGTTTTGCTATCAATCAGCCATATTGCCACCATCTATCCT GATTCCATTTTTACCTCAGATACTATTTCTACTGCATTTCCCTTTTGCAT GTCTTGTCTGTATGCTACCGTCTTGTCTGTATGCTTTCATGTCCTGATAT ATCTTCTTCAATGCGTATTTTCGAGTCATTAGCCGTCAAATTGTTCAGAG TATTATGGGCTATAGTAGGGGGCTATGTCTAATTTCAAATTATTCTTTAT TATAATTCAATACCTGTGGAGCTTCACCATGGTCCATACCGTACACTCTT CGAGCAACTTTGATTCCAGGCTCCCCAGTATTGACGGTGAAGTCCGTTGA ATAGGTCATTTCCAACAATTTCGGAAGCCCCATTGAGTTTCACCTTTGCA TTGGTACAATTCACTTTCGATATTTAACAAAATCATTCCACTCCTCTTTC AGTTCGCTCTTGAAAAGACGAGATTCTCGGCAGTATTTTCCAATATCGGT CTTCAGGGCCCTTCAGACGTGTACAATCTTGGCAATCTTTGTTAACTTGT ACAAGCTTTGGTGTGATTAGAAGTTTGATGTATTCTTCCTGATATGAACA GTAAAAAAGAGTATTAATAGTTCCACAAAATGGAAAATACCGCTACTCTA GATATCTTATTTTTACCTCCATATGTCTCATGATCGCAAATCCTTATGGT AAATCTTCATGGGATCATCCCCCCAGGAAGATCCCCATCTTCCTGATGCA CTTCGCTTTCAGGAGTTCCAAGATCTGGCGTCGGACGGGCTTTTTTCGAT TGTACGGCTCCCTCTGGTCCCTCTCGTAAGTTCTCCTTGGATAACCATTC GTCCGAACCTCGTTTACGTTTCGTCTCAATGGGCTTGAAGAAATCGAGCT TAACTCGGTCAGGGAAGCCAACTCTCTCACGGATGACATTCTGGCGGTTG ACGGACATGACGGCGAGACGCTTGAATTGCTCCTTACCATGAACTCTTCT TCTGAGGACGTAGTTGAAACAATTCGTAATCGCGGACGTGCCAGTCTTGA GGAACAGGGATAGGTTGAAAGGGGGGTGGACAGCAGGGACGTTTTCTTGT AATTCTCCGGTGACGTCAGGTTTTCCGTTACAGCAGAATCCCTTCGCCTG CTGCTGGGTGGAATAGGTGACACATCCTCTATCGACAGCCTTGGAGAACA TGTCCTGGAGGTGCTGCCAGACGTATTGACGAATTGTTCTCCTATCCGTC TTCTCACGCCAAGTCCCCTTGTGACGGGTCGCGCGGATAAGAAGGACGTC GTGCGTATGTAGTTGGTTTTTAAGGGCATTTTCACAGGCGTATGCCGCGG TGTCGGATTTGGTTGACCAATGTTCAGCAACGAGCAATCTTTCTGCGTTG ATTGCGTCGAGTTTTTTCTTCGAAAGACGGAGTCCGGGGTAAATGGCGTG AATGATAACTGTAGGTGGTGTTGGGACTTCGGGGTTGTAGATATCGTCTA AATAAACAAGTCCCTTTTCTTGTATTGCAGTAAAATGTAAAGCTAACATC TTGGGATTGGTGTGACCGGATTTTAGGGCATCGTACAAATCGCTTTTCGA CATAGCCTTTACCTCGCTAAAGACGCGCTTGACCTGTTGAAAAATAATCA CATCGTCAAGCTCCATACAAGGTGAAATTTCAAATTCGTATTCATAGCGT CTATTATCAGTATTATATAGTCCTTTCATATTAAATAGTTCCTTGGGATT ACTCATTTTAAAATTCCAAAAGAACGAATACATAATGTTCAAATATGCGA AATAAAAAGCTGCATCAAAAGTTACGTTACGGCCTTCATATTTTTACATT CTTCTGAACCATCGTCTACGGTATCAATTAAATAGTCAATGTTTCGCATA GAGACGTTACGTACTAATAATACTTCATCAATGGCCGGAATATAACAAAC CTCTTCATCAGCAACGAGTTTATCCATCTCGGCGTCCATGTTAGGGAAAT CATCATCCATAAGATTTTCAGGGTCTTGGTAGCATTCATCATCAACGATT TGTTGTGTTTGTTTTAATTCTGCCATGTCTGCTTCGTTATGTGGTTGAGC GTTCGGATATGCGTCTTCCCAAATGGTTGGTATCCAATTGTTGTCGAGTG ATATCTTGACGGTTTCCCACTGATAATTCATCCAACTTTTTCCGTGGAGG GGGAAGTGAATACATTTTCACCTTGATAGGGGGACTAATGCAAATGGGGG ATTTCAGGAAATCTTATGGGAAGTAGGGGTAGAAGGTGCAAAGATTAGGT ATAATATTACAAATAGATGATCAGAGGTCATCGAGAAACCAAGCAAAAAC TGTTCCGCTCATTTTGTAGGCCCATCTAATTAGCATCAACGTCCAAAGTT TCATACTCAATCATGATTCCTGCTTTCTGGATCTTTGCTGGGGTAGAGCG CTTAAATCTTTATTTCCACTATTCTGGTGGGTCACCATATTGACAAATTT TCAAAAAATTGTCATTTTTCTCTAAATAGGACTAAGAAAATCAAAAATAC CCCAAAAACTTTATCCCAACGCTGTTGGTTGACTTAAAGTGAAAAAAAGT TCTGGGTTCTATTTTCGGTATTTGCAAAGAATGCTGACGTCATAAGGTTG CGATGACGTCATCATTGATACCAAAATTTACATCAAAGATGTCGACTCAT ATTTGGTGCATACTTACAAAGCTTCAAATCAATTAAACAAATATTTCAAA CGTTATCAAAAATGTTCGTTTCGGCCGAAGGTTTAACTGTGTGATTAACG AGAAATGATTTTTACAGCTAGTTTTTGCTTATAGAAAACTAGTTTGACTC TTTCTGATTGCATTTAAATCATTTTTAAGCCATCAAAAATAATTTCGGCT TGGTTTTAATCCTTGACGTCCCACCAGCGAAATTTTGTTCTTTCACGAGC TATATTTTCGACTGCCGATAGTCTTGATTGATGACCTAACTCAAAAATTT GGCACGATTCAAAGTTTAAGCATTGAGAAATCTTAAAAGCGCGATTTTTT AGCTTTTTGAGAACGTCAAGGACTTCAAAAGATTGCTTCTATGTTGAATC GAATTCCATCAAAATATGAAAACTTAGGCATCAAGTTTTGACATTGACGA ATAACTATTAATGACTTAAGGCGCGAATAAAGACACAACAACTAATCATG TTAAACTTAATTCACTTATACATAGTATTCATCCCAAGAGGGATGGTGGT GTTGGTATCTTCCACCCTGTCCTTGGCCACCATGACCACCACTATGACCG CCTCTATTACCACTACGATTACCACCACGGTGACTGCCACGGTGACCACC ACGATTCAATCGACCACCTCGAGCTCCTCGACCACGTCCGCCCTAAAATA AAAAAAATAGATAAATGTCATGCATATAGGGCTTATTAGTCAGCCCCGGT GACCTTTCAAATCGGTTCGAGGATTTTTTTCATCATCCGATACTTTGTAT ATGAATGCACACTTTAATTCCGATTTCAAATTATTTTCGAGAAACAGGTT ATCGGGGATTACATATAGCGCGCAAAAATCATTTTTAATTTAAGAAAGAA AGCGGCAGATTTTGTGATTGTGTTCTGGAGTAGACTCTCAAAACCTCTGT TTTTGTATCTTTACTTAGAAATTCTTCCTCAAACTTTGTTTTCTTTTACC GAGATAAATTTCTTTAATCGAACTTTTCAAAGTCACTCAAATTGTGAGTA TTTGATTAAGTTCGACAAAACATTTAAGTTTGACAAAGCTCAACAACAAA AAACGCTCGACAAATTCAACAAAAATTCCGTTCGACAAAGTTCGATAACA AGAAAAGTTTGACAAGTTCGAATCAATTCCGTCGTCAAAAATACGACATA TTCTAACTCTAAGGCTTCGATTTCTTTTTGCCTGAGAAAGGTTAAAGATT CCTTTCTAACCCTTTGGGCTTATACTTCATTGGATAAGACCGCCGAGAGC GTTCTGAAAATAGTGGCCTTTACTTTCCACTTTCAGGCTGAGAAATTTCG GCGCCGATTACGTAATCTCTTTTCAAGGATCAAGCAAAACATAGAGTCTC GTCAAGTGGCAACCATTCTTTGTCGTTGGCCCGGTTTATATTTCATTGAT GCCACACCGTTGGACTTCACGATCTTGAAACAGTGTGGGTACACAATATT GTTTATTCTTCATTGTGGGTGGGAGTCACTTGAAGAATGGAGAACAATAT CTCTGGAAATTTTACATTCTTCATCATAACTTTTGGAGCAGAAAAGATTT CTAAATGAAAATTTCCAGAGATATAGTTATATTTTAAGAGTAATATAACT ATAGAGAATGTGAAAAATTAAAAAATATTTTAGAAATAGCCAAGAGTAAT ATCAGCCAGGGGGTAATGCACTATCAAAATAATATGGCAGCGTTTTAGAA AAATCTATAAAAGCTGTCCCAAAATTTATTTCTGGAGGTTGCTAGTATTT GGATAAGCTGTGGGATAAGTGGATAATTTTTTCAACATTTCATTCCAGGG GGTTTGAACCTAAAAAATGGAAAGTTTAAGTTTTAAAATCGAAAAGTGAT TTTTTCAAAAATCTAATCCATTCATCCCATAGCAAACCATAAATGGAGCA ACTCCTGAAAATTTCATGATCATAGCTCTTTCCAATCCTGAGAAACGTCG TCAATGTGTGCGAAAATCCCCTGAAACCTATTTTGAGAAAATGGTCCGTA AAGTCAGAAGTAGATATATTTCTCTATTTCTCTGCAATAAATCGACCGTT TTGCAAAATTCTTTCTGTGTTTGACTAAAATGGAATAAAGTACTACTTTA TATAATGACGTGTTGCAATGTCCAATCAGACGTTTTCGTTGCAATGTCCA ATCAGACGTTTTCGTTGCCATTTATTGGTACGCCAAGGGCGGTTATTCTC TCACGTAATATTGCTGTTGAAAATTCGCCTCTATCTTTGTTTGTTCCATT TGTACCATTCCTGTTTGATTTTCTTGATAGTGTTCTGTCTGATGACCTGC CTGACATTAATTATGACGTATAGATTTACTTCCCCTTTTCCCAAATTTAA AATTAAAGATAAGAAAACTAAAGAAACCGCACTTCTCTGTGTGGTTGCAA ATGAAGAAGTAAAATGAGTCTATTAGCGCGGTAAGACTAGACTGATGCCG AAGGCGTTATCTTGTTTTCTTCCCCTTCAAAAGGTCTCCATCAGCAGATC CAATTTTATGGTATCTGGCGTGTTAGATGAAATTGGGTATTTACCCAAAA CATCCTTTTTAATGTCTTTTTCCGGGATGAATAACAGCATGTTTTCTTCA ATATAGTGGCTAATTCTCTATCTAGATTCCACTCACTCTTGTCTTCGATG GATACAANGACGGCATGTTTTCTTCAACATAGTGGCTAATTCTCTATCTA GATTCCACTCACTCTTGTCTTCGATGGATACAAGTTCAAGTTTGGGTTTC TTACTTCTTATCTTTGGGTTTACTTTTTCCCTTTCTCTTTCGTTTCCTGG ATTTCTTTCTTCTTCTTCGTCTTCTTTCTTCTTCGGAAGAACTTGATGAC GAGGATGATTGGGACGAGTACTCATCACCACTACTACTGGAATTCCTCTT TTTAAATCTCAGCTTTTCCTCATCCTCAGTGATTTTTGGGATATCTCCAG ATTCGTTAGCTTCAGTCGTTTTTTCTGCATCTTCCAGACGCCATGGCCAG ATGCCACTAGCCATAATGTCGCACCCAGGCCGAAAATGAGATAATTAACT TTGAATTTATCTTGTTGTATTTGTAGATCTCCTATGAATTGTTGACTACT TGATTTACGGTAAAAATGACACCTTTCACTTTCGGTTATACCGATTGTAA AATAATGCCCTGAGTATGGTTATCAATAATCCACTAATAATGTCTAACAT CTTCAACACTCTCCTAACCTAATCATTCCGATATTTGCCAATTTTGCAGA TGAGCTTGAATTTCTATTTTATAATTATATGACGGCGAAATTCAGAAAAT TTCAGTTGATTCCAGTCTTTTTCCATTGTTTGATCGACGAACAAAAGCTT TCCAGATAGACACAACAGCGATTACAGAAGGTACTCGAAAATATTCATGG GGACCAATGTTACTCACATGAAAAGAATTTTAAGAAAACCCCGTCATGAG TACCTTTTGTAAACGCTGTTGAGACGAATGTCCAAAGTTTATTTCATTTC ACTTAAATTATTGCCTAAGCAAATTTTTGTAGTATTCAAAAAAAATTAAA TAATATATTCATATTGAACTATATTTTTTATCGATGAGTTTATTAAAATT AAAAATAAATTGTAAACAAACAACATTTGAATTTCTTCTCTACTTCATTT CTTCCCTTTTCATATCATTTAAATGAGTCGTTTAATACCCAATGTGCTAT TGTTATCTTAATCAAATAGCATTAAAATTTAAGTGAATTTAGGCAAATGG AGGGTACGGGTATGTGCCGCCCTTAAGGGTACCTCTTTTGGATTTCCAAA GTCCCGTTAAGGGTCGGAAAAATCAGAAAATCAAATTTTAGTCCCACTAA GGGTCGGAAAGATCGGAAAATTTCAACTTTCTACCCCCTGAAAGATCGAA ATTTGACCACAGACATTAGGAAAAAACGAAAGATCCTTTTTTTTGCTGAC GTAATCAGAATTTCGAAAAATTTCTTTTTTGAAATACATCTTTGGTTAAA GTTTGAAGAATAAACAGTCCTTGAGAAATTCAATTTTTAGTTTTTATGAC GTCATCAATTATGACGACATAATCAGTTTTTGCGGTTTTTCACGAAAATC AGCGAAAAAACAATTATGTTACACATCAGGTTAGAAACTACATTATAGTA CCTTTCGTGTTCAGTCGTTTGTTTGGTCATTTTCTGTCGACTAATGCGAT CTAAAAATTATGGTAATTTTAAGACATGCCGTTGTTGTATTTTTTAATCG ATTTTCACCTAGATATTTTCATAAAATATACAGGGTGTCCCGAAAAAAAG TATCGAGTCGTACCATTTCTATAGAAAGAAAGTTCTTGTGTGTCTCTCTG TGTCATATTAATTGTCACGAGACATAGTTTATGAATAACTTTTACAAAAA ACAATTCTCAATAANGTCATATTAATTGTCATGGGACATAGTTTATGAAT AACTTTTACAAAAAACAATTCTCAATAACTTTACGTCATGAAAATTATAA AGAAAGTTAATTATTTTTAATCATAATAAGCAGATATTCAATGGGTAAAA GTTGGTTATTGGATTTATTGAATATATGTTTTATTATATACCTAGAGGCA AAAACGAAACATTATATATGTCAATTGTTAAACGTTTCACATAAAATACT CCCATACAGGGCCGGCGAATCAATTTTGAAAGTGGAGGGGCCAAATAGTA AGTGTCTAAGGAGGCGCCACCATGGTTGGTGGATATTTTTTTTCTTAGCA AAAAAGTGGGGGGGGCCATGCCCCCCCCCCCCCCCTTCCCCCCCCCCCCC CCCTCCCCCCCCCCCCCCCCCTTCCCCCCCCCCCCCCCCTCCCCCCCCCC CCCCCCCTTCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCAGTTTCGCC GGCCCTGCCATATAATCGAACGTTCGAAAGTTTTTATTTTTTAATGATTT TCTTAATTACTTTGAGTCATAAAATGTGTTCATGAAATTGACAATAGATT CATTTTAATGAATTTCTTTGATATAACAACAAAAACGACAAAAAAAATCA AACTTTGAAAGCAAAATTTGAAAAAAAAATTCTACCGTGGTATAATAGCC AAGCTCTCCCTCTTTTTTCTTTGTCATTACGATTAATTTATACATTGTAA CTACCTTTAGTAATGGGCCTGTGTGATGGAGAACGTTCTTATATTTTAGC GATAACACACACAAACTTTTCTACTCAATTGCATGTTCAAACTCGATACT TTAATTAGGGACACCCTGTAGACCATATCTGACTGCGTTCATAATTAAAA CCATGGAGCTAACTTTTATTACCTCTAAGCTAAAACTAACTCAATTGAAT ACAAAGAGTGAACAAATATGCAAACGAGGTAATACGTACCGTGAAAAGCA CAGCTCAAAATCATATATTTACGCTGTGCCGACGAATCGAGATTCTATTC ATCGCGCAATCAGCGAAGACAAAAGTAACCATGANNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN TTAAAGTGACATTTCCATAATTAAAAGTTTAGTAATTACTGTTATACATT TGGGGATCATGTAAAAGATTTCTTTCGAAATAAACACACTTCAACTACAC TTGGAGGTTTCTGGGGAATTCGTAAATAGTAAATTGCATACTGATACAGT CTGCTAGACATTAATATAGTAATATTTGCTCTTCATCTTTGATTTTTTCT ACAGTGATTAGATTGACACATGCGCNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTAGATTGA CACATGCGCGATAAAATTTATATTATTTGTCTTCAGAGGTTACTATTTTC TTTGAAAACTTAACCTCTGATACTCAGGGTAGGTAATACGCATTTATAAT TGCACGGTTTTTTTAAGAATCACACTTTTAAGAAACATGAGGCTCAGAAT GCCTAAAAACTAAGATACATGCTGAGCCTGAGAATGAGAAAATAATATTT TTTAATTCGGTTTTTTTAAGAACGTTCCAATCCAGCCTTTCATAAGGCTG ATTATGTCAAAAAAAGTTTAGAAACATGTAAGAAACATTTAAGGCTCAAA AGGCCGATTTCTTAAGAAACATTGAGGCTGCTTGGTAAAACTAGTTTCTT AAAAAAAAGAAAACATGTATAATTTCTTTTCCGAAATGTGTATATCAGCC TCATTTTCATAATTATTTAAATATTTACCTTTTTCTGTTTGTTCATGAAC AGTAATGAACTGATGGAAACCAGCAAAGTAAATCATTAGTCAAATTTCAA ACATCGTGGATAGCTAGGAAAACTACACCAGTTAGTCAAGCGCATCTATT ACTATAGGGTAGCGTGAAAGTTATTATTATTTGATTTTCTTTCATTCAAA AAATACTTCTTAAAACTGTAAAAAGCAAACCGGGGGAGGCACTCAGGCGA AATTGGGAACGGGGACGTGCCGCTGGTCAGGGTCCCTTTTTTAGGCTTTG AAGATATCTGATAGGGTCCAAAATTTACTAAAGTCTATTTACGATAAGTG TGCACTCTTTTTTCTTTTACCTATAACTTTTGAAGGAATTCTTTGATCTT TATAAATTTGGTATCATTAGAAAGATATTAGTGAGTGGAACAATTTGAAA TAAAAAAATCTTTAAAAAAATTCTAAAAATGAAGATGAAAATGAAGAAGA AAAAAATGAAGATCTTGTAGAAAAGTGCTATAACTATCATTTTCACTGAA GTGAATCTTTAATCATCGAATAGCCATTCAGTCAAAAGATATCAAACAAA GTTATGAGCTGATTGACGTCTAAAAACGCAGTTTTCTGCAGTTTTTTGCT GTTTTTTCACAGTGATGATCTCCTAAGATGAAAGAATCTCTCCAGTAAAA ATGAAAGTTATAGCACTTTTCTACAAGATGTTCTTCAATTTCAACATTTG TAGGGTCGTCTTTTGGTTATTTTTGACAATTTTCAGGGTGGACATTAATA GAAAAATTTTAAATCTTTGTCTACATTTCGTCATTTTAGCCACTTTTCGG GGTGAAAATGGGAAATTTGTTTCGATTTTCTTAGCGATATGGTCCCAAAT TTACCAAACAATCATATCTGTCAGGGTCCACTTTTCAAACTCCAGCAAAA TACTGAAAGATAAGATTAATAAGAATTATCTTCCATTACAAAATATTTAC ACATGACTTGAAAACTACTTTATCTGTTGCCATTACATAGCTAGGAAATC GGTACCAGTAGCAACAAAAGATATATAACAATAATTGCGCGCGAACAATT TTTTTAACCGCGGCGGTCCGCTCAGAATCGGAATAAACAACAACATCATG AATATTTTCAGGCAAGCAAGTCCGTCGTTGATAGCTAGGGAAACTAACCT TCTCTGTCGGTCTTACATAGCTAGGAGATCGGTACCTAATTAAGCATTAA ATTTAAGATTTACCGGGACCCCTTCCGACTGGAAAAATTGGCCAAAATAT CGTCCCCAGTGGAAAATCATACTCTAATCTTTTGTCCCCGCTGAAAATAA TGAAATAAACAAATTATTGCTGTAAAATACTTTTGCTGTTTTTTGCTTTT TCTATTTCCACTGACTTGAAAACAATAGAGTACAAATCACGAACCCTAAA GCACATGGGAATAGGAATACCCATCAAGTTTTGGTCCGTTATTTTTATCC CAACTGGTCGAAAACATCCTACCGGGGCTTTGAGAAGGGGGTACCTATCA AAACGCATGTATTTACAGTTGTAAGTCAATTTTCTTCTTATCTGCTGAGA GTGCTCAATGATATCAGAGCTTGTTGGTCAGCCTAAGCTGAGCATTCAAA TAGGTAAAATTTTCCAGTTCCATCATCATAAGACGGCAAAAAAAAAATCC GATTTTCCGATCTCACTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNGGATTGATGGTGTTATAATGTTATTGGA ATTTGATAAAGTTTACAAAAGTACAGCTACTGTATAAATTTGATATAAAG ACTGGATGCAATCGTGCTTTTTTAGACTTTGACGTGTTTGTGATAAAGGC GAATCGCAAAAAACTGTTTGGTTCCCGTCATTTCTACTTTAAAAAGTGGG AGTCGTTTGGCAGGTCAGTCGAAAATATTTTTCTGTTAAGAAGCAGCTAT ACATCTTATTGAAAGGGAATTCGTAAATTTAAAATTGAGAAACCGTGGAT AAACTGGTGTTTTCGGTTTACTCTCCATTAGCATGCAGCTCTCTACTTCG ATTTGAAAACTTTTAAACACAGAGCGTGCAGAGGTTGACAGTGGAAATCC AGCAAAGCAGCGGAAAAGCTTTCCGACTCTCCAGCTCTACCTGCTGACCG TAAATCAGATGACGGGAACCAAATGATGACATCACATCTCCTATTATTGG ACTTGCAAAATTATGACAAATGGTCTTTGGAATTCGATCATTTATATTAA TATTAATATATACAGTTCTTGTTGAAATTGATCAGACTATTTCTCACGCA GTTCCGGACGCAGATTGTGTTTTTCTAACCTTTTCTAACCTTGGCGCACA TTTTGACTGAATGATGGAATGGAATGAATGGCGATAACAGTTTATAGNNA GCGGTTTGCGTGATTGGGACTTTTTTCTTGCGTGATGGCGTGATCAGAGA TTTTTTTTGGCGTGATGGCGTGATCAAGATTTTGGCGTGATGCGTGATAG GGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNTGAATTTATTTATTATGGTTGTGTGTTTTATTCCGCCA AGGCGGTGAATCATTCGCCCAAATTCATAGACCAATCAAAAGCGAGTTTA AAGCAAAACGGGGAAAAAATGAGCTTCCCCCCATAGTTATGAATTTTAAG TTTTGCTTTCGATTATCATTTGCGATCAGCAAAGTCTTCAAGATAGTTGT GTGCATGTTGTGTAACTTGACGGTACTAAACTACAAAATTTATTTACCCA GACTGGAGGGGCCATCCATATAGTACGTACACAGTGAAGGGGGGAGAGGG GGTTTAGCAAAAGCGTACATCTATTGTTTAAACAAAGTCATTATTCAACA TATTTAGTCTACTCTGTTTCAGTGCATCTCTTACATCTGTTAACCCACTT ATTAAAGCTATCTAGCTAAGCTCTATTGGCTGACCTTCCAGCCTCGGCTG GTTTATTCCAATTAAAAGAATAGAGACTTTGATTTATTATTTAGAACTTT AAGTTTCATTCCGAGCCCGTATAGACGACAATTATCAGTTAAAAAATCCA CATATTTACAGTTGTATAAGATTAAAAAGTTATAATAAGTAGGTTATTTG TTAAAGTTAATAGTCTTATCATGATTATGTACATTAAAATAAATTACAAA TAATCGATAGTAATTCTTCTATTGCATTACTTCAGGGGATGAAGATTTCG CAAAAAGAAACATTCGAGAATCGATCTCTCCGAAATATTTTGCGCAGAAA ACTTTTCCCAATCTCAAATTTGATCTAAACTGTGGTTTTTTGTTATTCTT TAGGTTTCCCTTTACAGATGACCATCACCAGATGAATGACGATCATTACA AGCAAGATGGTGAACTCAACTACCGTCAAGAAAGAAAAACCACCAAACAA TCCCAACTGTCCACCCATATCAGCAATTAAATTCACAATGGTATAAAATT GTTCTTCTTCCATTTTAATGAACGACTTGTCTTCATAAAATATTGAAACA GTTAAAAGGTTTTTTGAAGGATCTGGCTTTCCTTCAGCAATTTCTCGTTG TCTTCTGATATCCTGTGGATAGTTTTGCGAATAAACAGATGTTGAAAATA AGGTTTCTTCGCACGGTGGGTTACAGTCGCATTTCATATTTCCGTCAAAC CATTTTTCAAGCAATTCGTCCAAGCACTGATCACCTTGTGGGCAAAAAGG GACATCTTTAAACCTATACTCCAAGGGTAGGCTGGGAGCCACACATGAGC ATTCATCCCTGATAGCTGCATTGGCACACAATTTAGAGCAGAATCCATGG GTCATTCGGTCGATGTGAAAATCACTTTTTCTGTCAGGTTCCACCATATG CTTGTCTTGGTTTCTCATACAAGACCCATTATTGAATGGATCAGCTCGAT AGATGTATTTTTTCGTTAATGCGATGTCGTATTTTTTGCCTGGGGCAATT GGTATTGCTTTTTCTTCAACATCGAATTTTTCACCTTGTAGTCCAACAAA CATTCTTAGTCCTGCACTATAAGTATTGTCAATGTACTTTTCTTGCTCAA TATTAAAATGGAGATGCAATCCACCTCTATGACCAGCTCTGGTGACTCGT CTCGGATTCTCAACGTCTGCATTGAAGAACCAGCATTTACCGTACCTTCC TTGCCAATATTCTCCCCAACCAAGATTTGTATTCGCATCATTGTCAGAGG TCGGTGTGCAACTTCCCTTAACATGTCGAAAATCACACCTTAAAATGGAG TCGTTGATTCTGTGGCCGTATATTGAAGGGTCTGCTACATGACTCATCGC TTTATCTGGGTCGATAGATTCGAATGTTTCGTTTAGTTGAGTCAACAACT CAACATACTTCTCTCTGACCACTGGGTTTTCGTTGCAAAAGACAACCACT GGGAATTTCGGACGATGCTCATAAACCACAGTCTGTTTATTGAGCAATGG GCGATCCAGATACTTGGTGATTAAAGGTTGTATCACCAAAATGAGAACAA TGTAAGCTGCCAGCATTGATATAATCCATACTACACTTCCTAATATTGTC TTTGTCGAGGCCAGAGGTGAATATCCATGTGCTGATGTACTCTCTGCAAA CTCTATCAGTAGCTCTTTGATGCTTTTGTCCTTTTTTTCATCTACATTTT TCTCATTGTCATCGTTATGCTTGGGAAGTGTGTTTTTCTGGTATGCCGCT GGTTGCTGGAAGAAAGACGGCTTGAAACTTATGTCACTGTTGAGGTCGTT AGCTTGGCCGTGTTTTACTGTGATAATATCGTTTTGTGGCATGACTTTGT TACTTCTCATCCTCTGTTAA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001967TCONS_00001967Clytia hemisphaericatranscript
TCONS_00001966TCONS_00001966Clytia hemisphaericatranscript
TCONS_00001962TCONS_00001962Clytia hemisphaericatranscript
TCONS_00001961TCONS_00001961Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:950836..987805 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
4.14 3.65 2.96 2.81 2.78 1.81 0.43 1.14 0.53 0.37 0 0.22 0.76 0.55 0.15 0.3 0.2 0.3 0.82 0.83 0.81 0.32 2.24 1.48 0.48 1.06 0.31 0.13 0.76 0.88