Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001962 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001962
Unique NameTCONS_00001962
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2141

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001962 ID=TCONS_00001962|Name=TCONS_00001962|organism=Clytia hemisphaerica|type=transcript|length=2141bp
ATCACACGTGGTGGTTCATTGGTTAAAGCAGGTTACCAGTTACACTCCCA
TCCCACAAAGACATATGTACATGACATATACATAACAACATAATATATAT
TCAGcatataagaaaaatattaaaggCAATACGAGCCAGTACATTTGTAA
GGTTTCTAAAACACTCCATGTCAGGataaacaTAATGCCACTTGGAGATG
TGCGTTTGAATCCTGAGGACCCCTTTGAAAAGATAGTCTTGTTGGAGCAG
AGCTTACAGCAAGAAGGATTCAACAATGGTTTTGACAGCGGTAAACAATC
AGGACAGATTGAAGGTTTTCATACTGGTTTAGTTTATGGTAAAGAACTTG
GTAAGGAAATTGGATTTTATAAAGGATTTGTGTCTTGTTATTGTGAACTT
TTAACTGAACAAACTGCATCAAAGCGACAACTGAGTTTGCTGAAACAACT
TTCTGGTTTGCTTAATGAGATAGATTATGAAAATTCAGAAGATGAGGGAA
TGGATGATAAGATGGCAAAAATCAGAACCAAATTCAAACAATTGTCATCA
ATCCTTAAAGTGCCTGTCAATGTCAATAAAGATCCAGCTTTGTTGAGTTT
TTGAAGATAAATTGGCAAAGAAAGGTTTCCCTTTACAGATGACCATCACC
AGATGAATGACGATCATTACAAGCAAGATGGTGAACTCAACTACCGTCAA
GAAAGAAAAACCACCAAACAATCCCAACTGTCCACCCATATCAGCAATTA
AATTCACAATggtataaaattgttcttcttCCATTTTAATGAACGACTTG
TCTtcataaaatattgaaacagttaaaaggttttttgaaggATCTGGCTT
TCCTTCAGCAATTTCTCGTTGTCTTCTGATATCCTGTGGATAGTTTTGCG
AATAAACAGATGTTGAAAATAAGGTTTCTTCGCACGGTGGGTTACAGTCG
CATTTCATATTTCCGTCAAACCATTTTTCAAGCAATTCGTCCAAGCACTG
ATCACCTTGTGGGCAAAAAGGGACATCTTTAAACCTATACTCCAAGGGTA
GGCTGGGAGCCACACATGAGCATTCATCCCTGATAGCTGCATTGGCACAC
AATTTAGAGCAGAATCCATGGGTCATTCGGTCGATGTGAAAATCACTTTT
TCTGTCAGGTTCCACCATATGCTTGTCTTGGTTTCTCATACAAGACCCAT
TATTGAATGGATCAGCTCGATAGATGTATTTTTTCGTTAATGCGATGTCG
TATTTTTTGCCTGGGGCAATTGGTATTGCTTTTTCTTCAACATCGAATTT
TTCACCTTGTAGTCCAACAAACATTCTTAGTCCTGCACTATAAGTATTGT
CAATGTACTTTTCTTGCTCAATATTAAAATGGAGATGCAATCCACCTCTA
TGACCAGCTCTGGTGACTCGTCTCGGATTCTCAACGTCTGCATTGAAGAA
CCAGCATTTACCGTACCTTCCTTGCCAATATTCTCCCCAACCAAGATTTG
TATTCGCATCATTGTCAGAGGTCGGTGTGCAACTTCCCTTAACATGTCGA
AAATCACACCTTAAAATGGAGTCGTTGATTCTGTGGCCGTATATTGAAGG
GTCTGCTACATGACTCATCGCTTTATCTGGGTCGATAGATTCGAATGTTT
CGTTTAGTTGAGTCAACAACTCAACATACTTCTCTCTGACCACTGGGTTT
TCGTTGCAAAAGACAACCACTGGGAATTTCGGACGATGCTCATAAAccac
agtctgtttattgagcAATGGGCGATCCAGATACTTGGTGATTAAAGGTT
GTATCACCAAAATGAGAACAATGTAAGCTGCCAGCATTGATATAATCCAT
ACTACACTTCCTAATATTGTCTTTGTCGAGGCCAGAGGTGAATATCCATG
TGCTGATGTACTCTCTGCAAACTCTATCAGTAGCTCTTTGATGCTTTTGT
CCTTTTTTTCATCTACATTTTTCTCATTGTCATCGTTATGCTTGGGAAGT
GTGTTTTTCTGGTATGCCGCTGGTTGCTGGAAGAAAGACGGCTTGAAACT
TATGTCACTGTTGAGGTCGTTAGCTTGGCCGTGTTTTACTGTGATAATAT
CGTTTTGTGGCAtgactttgttacttctcatcCTCTGTtaa
Run BLAST on NCBI

transcript from alignment at sc0000012:950836..987370-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001962 ID=TCONS_00001962|Name=TCONS_00001962|organism=Clytia hemisphaerica|type=transcript|length=36535bp|location=Sequence derived from alignment at sc0000012:950836..987370- (Clytia hemisphaerica)
ATCACACGTGGTGGTTCATTGGTTAAAGCAGGTTACCAGTTACACTCCCA TCCCACAAAGACATATGTACATGACATATACATAACAACATAATATATAT TCAGCATATAAGAAAAATATTAAAGGCAATACGAGCCAGTACATTTGTAA GGTTTCTAAAACACTCCATGTCAGGGTAAGCAGTTCAATTTGATTTTTAT ACTTTTCCCTTGGTTCCTTCCTTTCTTTCTACTGTACTGTCTGATGACGA CAGCGATAGCAGAGTGCTGCCAGACATGATTTCTAACCTCTGTTCAACAA GTTTTCACTACACTTATACATTCAACATACCTGATTGTAAAGGATTCTTC TTTGCGGCTCATTTTATTACTTACAATCAGATTCTATATTTTCTCTCGCA ATCAACCAAAACAACAATACACCTTTCCTGTAATTTGTAAAACTAATGCA TGCGAATTATTTTGATGCTCTCTATCCTTTGGTCTCTGGAGGTAAACAAA CCCGTCTTTGCCTGTGCCTGCTGCGTTCTTAGGGAAAGTTGCAGTTGGTT TTTGAGCTTTTCTTAAGTTCTGTCTAACAAAATCCCCTCAAATTTTAGTA TGTTCAATCTATTCATGATATTATACCACTCTATCAGAATTAGACCAGGG TTATCGGCGTTAGGCCAACCAAAATTTTGAAATATTTAGGGGAGCCATCC AAACCTGCCACCAAAAACTAACTTTGATACACCTTTCCCGTAATTCGTAA AACAGATGCGCGCGCATTATTTTGATGCTCTCCACAGTTTGGTCTCTGGA AGTAAACAAACCCGTTTTTGCCTGCGCTTCCTTTTAGGGAAAGTTTTTTT TTTTTTAGCTTTTCTCAAGTTCTGTCAAACAAAGTCCCCTCAAATTTTAG TATGTTCAATCTATTCATGGTATTATACCACCCTGGAAATCTTTTGCCAA AAGAAGATCGCTATTAAAAGTTAAAAGCTGAAAACCCACTTTCCCTAAGG CAATGGCATGGGAATTTGATGTTCTGTTTACCGTCGCATTGTAAAAAATA TTTGATGCGGCAAAATTTCATTATTCATTATTCATTATTCCTACCTGGTG CTTCCCATCTCCAACGAAGTTGAATTTCACGATTCCACCGTGAAATCGAG CTGCTTTCACTTTCGGAATCAAAATGACATGACAAGACGCATCTAAAACG CGAATTTTTAAAACGCCCTTGTAGCCGCCCACTGCTTAATAAAATGCCTG TCCCATTTGCGGACGTGATTGGAACCATGTCTTTTACTCGAGGCGTACAT TTTGTTAGCGAAGATGTTATTTTTGATTCACGTTGAGTGTTTTGGATAGC TTGGCACAGGAAAATAAGAAAATAATGAGTTTTTAAGAAATAATGAACTT TTTTGAGCGGCGGCTCAAGAGCATGCGGGCGGTCAACGGTAAACAGAACA TCAAATTCCCATTGCCTAACCCCTCGCAGGCAAAAACGCGTTTGTTTACC TCCCAAACAATTTTATACACAACGGTGGAGCGCACATTTTTCCAGGCCAT TTCTGAGAAGTTTGAATCACGGGGAAGGTGTAATGGTTGTTTGTGGATAT GGGTGTAGGTTGTTGATGCTACTCGTGGATGTTTACTCATGGCAAAGAAA ATTTTACCAGAAATACCGTCAAAAGTAGTTTAATTCTCGTGTGGACAAAT TTTTGCAAATCAACCTCAGTTTCACCAAATTTCTTACATTTTCCTAAAGG TTTTGGCCAAAATTTGGATGATAAATTTCATGAGGACTAATTTTTCACGA AAATGGCCAAAAATCTCAAAGATTTAAAATTCAAGCAAAATTTAATCCAG TTATGGCCAGACGATCTCAATCGAACGGAATCAACGATCGAACGCAATCG ACTGATTGAATTTCGATTGTCGAATGCAATTGAATCTCAATCGAATGTCA AAATTCTGGGTAATATTCAATTGGTTCGATTGTTGTTCGACTGGTTCGAT CGTCGATTCCGTTCAATTGAGATCGTCTGGCTTTATTCTTGCAGCTTCCC AACATTCGATTGAGATTCGATTGCGTTCGACAATCGTATTTCAATCGGTC GATTGCGTTCAATTTGGTTCGATTGGTTTGATCGTCGATCGTCTGGTTAT GGTATCAATATTAGACAAGTTAATTCCATGCCAATTGTTACTTTGTCATG TATTTTATTTCTTTGACTGCTTTGAAAACCAAAATAAACAGCCCCAATGC TGAAGTCTTGGGTTTTTTGTTTTCCGGCTTACACGCACGGCCCTCAAATT TTAGCATAGGGATGATAAAGTTTCTTAGGGGGAGGCAGCTTGGAGACTTC AAAAATTGTTGGGATGGGGGGTCATGCAGTTGGTTCCAGACATCATGACG GTTAGTACCGTGGTACTGTAGGTCATATTTGATTTTTGGAATTTGCGGTT AGTACCTTGTGGGTACACTTGGCTAAAATTGGTTCACGTGCACGACTTTG TAAAAATTTTGCATGCTTCACATGCATTGTCTTTGTTACGTTAGTGATTC GTCGCTCTCCTACTTATTTCTTCCTTGAAAGCTTGCATGTCAAAGATTGC TTGTTTCAAAATTATGTGCAGTTGGGTGTCCCATCCGCAACAAAAGCTCC ATTTATGCTTACAAGTGAAGATCTGGGAACTAGAGGACCCCCATTTTTTT TTGTTGTGACATATTAAATGGTTTCTTGCGTTAAAGACATTTATTGCCTT TAAATAATCTTTTTTAACTGGTAAAAACTAATACAGTCCAAAAATTTGTC CCGTCCGCAACGACACAACAGGGCTCTAAATAACGGTCGCCCAAATAGCT TCATGTCCGACCCAAAAATCATAATTTTCAAGCTAAAGCAACCCTGATCA GACATTATGTCGGACCCACTGGAAATCGTTATTTCGAGCCTTGCACAAAA GTCTTAATTTCTCTTTTTTTGAGACAACTTTAATGTTCTAACTGTATCAA GCCAATGAACTAGAGGGAACCACATGCTTTTTGCAGCAGTATCATTTTTC TTGAGATTACATGTACTAGCTATGAGCGAAAAAATTTTTGTCCTGTCCGC AACAAAGTGTCCCGTCTGCAACATTTTTCTCAGGATTGGGGCTGTAACAA ACAAATTCTATAACAATCCAAGGAAGGCTATTTAGTAGAGTTCACAAAAA TGTGAAGTTCTTAGAAATTGCATTTGCCAAAGTTGAGTTATGGGTCCTCA AAAAGTGCCGATGCGGACGGGACATTGTACTATTTTTCTGCAATTCACCC AGTTAAATTGCCAGCTTTCTGTTTTTATTAAGTTGTGCATTACTCACTAC AATGTCTTCTTAAGCTTTTTTCCCAGTCTTTTGTCAAAAAATGCAAAAGT GATATTTTTTATTTCTGGGGTTTTAGACCTAAATAATGTTGGCTTGGGCA GACTTGACTTTAAATGTTGGGCCTTGTAGCTTTGTATCATATATGTTAGG CTTTGTGTTTATCTATATATTAATATATGTAGTCTGTATGTCTGTTTTCT GTGTGTCACTTGTTTTCGCAAGCAATGTTTTTGTTCTTTTAAAAGATGAC TTTGAGTTGTTCGATAAGTTTTTTTTGATTGATTGATTATAATTCTTGAC TTGCTTTCTTTTTTTCTCTCTTTTCTTTTGTTTTATGTTTTTGAACTTAA TTAGCGACCTCTTGATTTATTAAGACATTTGAATTCTTTTCAAAACAAAG CAAAATCTTTTAACAAAATCTGTTTACTTAAGTCGTTATAGAAAAAAACA AAACTAAAATAAAACAACAAGACAGTTTGTCAGAAGAACAGCAACTTTTT AAAAAATTTTACCGCCAAAAACAAAGGAGTTCTTTATTCTTAACCCTATT CTACCTAGGGGGGGGGGCTTTTTCTGTTCGGAGGTCAAATTATTGGTAAT AAATAGCTCCTGAAATAAAAGAGCTTTTGCCATGAAATTTTCTGTAAATT CCTAACTTTTATTTAGCTTCAAAATAAAAAAAAATTTGACACCTAAAAAT TTTCACACCTTGAGCATTTCTGACAGTAAATGTCACAAAAATTGACACTT TTCCAATACAAATTTATTTTTTAAACCGTAATTTAATGAATATTTAGGAT AAATTAATCATTTTAAAACTCAGGAAACTTTTTTCTAAAGCCTTTGTTAG AATACAATAGCAATTTTCGGTCTTAGGTCACTTTGGGCATAATGAGTGAC GTCATCAAAAAAAAATTCCGTCAAAAGTTACCTTATGCGACAAGGATCTT GTGTGCCAAATTTCATCCAAAAAGACCCACTAGATCAAAAGTTAAGGGGT GGTACAGGATCAGCCCCCCCCCCTAGTTCTGAACAGCCCCTAAAGGCCTA GGTTGAATAAGGTTAAGAACATCCTGGAACATCTAAGAATTACGGCAAAA TAATTATCGAGTCATTCATTGTTGAATTCGAAAAAGGTATGACAAAGGTT TAATAAAAAGCAACCAGGACATATTTTAGAAAGGCATGGTAGCGTCCGTT GGTGACCAAAAAGGGCACTTTTTGTAGTATTTTACTACAAAAAAGGCTGA TTTTACCAAAATTTTAGTGATTTTAGAAGGGGTAGCGTCCGATAAGCGGA CACTAAAAGGGCATTAAAAATGGTCTGGCAACATAGAATCGCACTATTAC GTTATTTTGTCTGCGTGTCTTTCTTTCCTGAACTTGTGTCGTGTCTATAA TTTCACCCTCCTTTTAAACAAATTCATTCAAAATGAAGCATAAACAAGTT GCATTTCAATCGCTAAACTTTTTTTTAGTGGTGGGCCATTCACCTCAGAG AAACCTACCTTATTGAAACTAATTTTTGCGGGAATTAATTTTAGCTTTTT TCGTGGTTTTTCGTCAATCGCAAAAATTTGAGCCTGCGAATTTTTTCCAA TGAAAATCCAAGGAAAATGAAAGAAATTGTCAAAAAAAGGGCAAAACCGT GAAAATTAAAACCTGCAAAAATTTCAGAATGAAAAAAACGCTAAATTAAT TAAAACCCGCGAAATGCAATTTTTAGGATATTTTTTTTCAACCGTGAAAA TTAGTTCCCGCGAAAATTAGTTCCAATAAGGTAAACAAAAGGGATGAGCT GGAGTTTTTATAAGATACTTCACTAATTGGTCATTTGAAGTGATAGAGAT GACGCATTCTTTAGAAAAAGTAACAAAATTGTTTTATTACTGGTTAACGA CGAACAAAATGAAATAAGAGCTTGTAAAAACTCCAGCTTGTCCCAAATAA AACAATTTCTGTCACAACCATCACGTAACTACAATGAAAAGTTTCAAAAG TTTTCTGCAACTGTTTCCATCTAGACAAACTGCTAATGAATTTTTTGAAT CATTTTTTGTTTCTGAAACCGATTTGTATATGTTTTCTTTTCGTTATTAA CCCCACGGTCAATAGCAACTTTTTGCGTATTTCATTTTTCAAATGTTTAT ATTTGATGAAAAATGTTTCAAGTGGCCCCAGACCTTTATCTTGACATCAA AGTTTCCAAAATTATTGAAAACTAGGGCAAGTAGGGCTGCCTAGGGTATT AACAGGTTTTCAAATAGTGATTACCTTGAGCTTTGGCCGCTCAAGACCAG GTGCCAGCCTGGTAATAGTCAAATGTACTTAGTACTGCAGTGTACTAGGT CTAGGTGCAAAAAGGAGTGGTGTCAACTGGTGTATGTCAACTTTGTATTT TGCTGTTGTTTTTTGCTACAATTGGGCCTATGAATAATCTGAAGCATCTC AAGTTGAGCCCAGTGCGTTGCGCACGTTCGACTATTTGGAACACTGAAGA CAATTGAATGACAATTGATCCACCTAGAACTAGGTGTTTTGTGTGAATTT GATTGCTTTGACAATTTCAATCGGTTGACGAATTCTTTTCCAATCTAGGG TGTTTTAAATATCCCATCAATTCCTTTTCAAGTTAGGAAAACATTTTATA AAGTATTGAACTCCTTCTTCTTTTTTTTTAGATAAACATAATGCCACTTG GAGATGTGCGTTTGAATCCTGAGGACCCCTTTGAAAAGATAGTCTTGTTG GAGCAGAGCTTACAGCAAGAAGGATTCAACAATGGTTTTGACAGCGGTAA ACAATCAGGACAGATTGAAGGTTTTCATACTGGTTTAGTTTATGGTAAAG AACTTGGTAAGGAAATTGGATTTTATAAAGGATTTGTGTCTTGTTATTGT GAACTTTTAACTGAACAAACTGCATCAAAGCGACAACTGAGTTTGCTGAA ACAACTTTCTGGTTTGCTTAATGAGATAGATTATGAAAATTCAGAAGATG AGGGAATGGATGATAAGATGGCAAAAATCAGAACCAAATTCAAACAATTG TCATCAATCCTTAAAGTGCCTGTCAATGTCAATAAAGATCCAGCTTTGTT GAGTTTTTGAAGATAAATTGGCAAAGAAAGGTATATACTTCTATACTTTG GATAAATTTTGCAAATTTTCAAATATTTTAAATTCCTTGTCTATTTGTGT TTGTTTGTATGGGCAGGTTTTGATATCATAGTTTTTTTATTCTTAACCCC TCCCCCATTCCACATATTTTCATGTGCATTTAAAAATTCAAGCTCATCTC ATTTAAATGGCAAATTTTAGTTAAATTTTGATTTTGTTGATTGAAACAAA CGATGTTTTTAAAGATTTCNCAATAGTCAAATGTACTTAGTACTGCAGTG TACTAGGTCTAGGTGCAAAAAGGAGTGGTGTCAACTGGTGTATATCAACT TTGTATTTTGCTGTTGTTTTTTGCTACAATTGGGCCTATGAATAATCTGA AGCATCTCAAGTTGAGCCCAGTGCGTTGCGCACGTTCGACTATTTGGAAC ACTGAAGACAATTGAATGACAATTGATCCACCTAGAACTAGGTGTTTTGT GTGAATTTGATTGCTTTGACAATTTCAATCGGTTGACGAATTCTTTTCCA ATCTAGGGTGTTTTAAATATCCCATCAATTCCTTTTCAAGTTAGGAAAAC ATTTTATAAAGTATTGAACTCCTTCTTCTTTTTTTTTAGATAAACATAAT GCCACTTGGAGATGTGCGTTTGAATCCTGAGGACCCCTTTGAAAAGATAG TCTTGTTGGAGCAGAGCTTACAGCAAGAAGGATTCAACAATGGTTTTGAC AGCGGTAAACAATCAGGACAGATTGAAGGTTTTCATACTGGTTTAGTTTA TGGTAAAGAACTTGGTAAGGAAATTGGATTTTATAAAGGATTTGTGTCTT GTTATTGTGAACTTTTAACTGAACAAACTGCATCAAAGCGACAACTGAGT TTGCTGAAACAACTTTCTGGTTTGCTTAATGAGATAGATTATGAAAATTC AGAAGATGAGGGAATGGATGATAAGATGGCAAAAATCAGAACCAAATTCA AACAATTGTCATCAATCCTTAAAGTGCCTGTCAATGTCAATAAAGATCCA GCTTTGTTGAGTTTTTGAAGATAAATTGGCAAAGAAAGGTATATACTTCT ATACTTTGGATAAATTTTGCAAATTTTCAAATATTTTATATTCCTTGTCT ATTTGTGTTTGTTTGTATGGGCAGGTTTTGATATCATAGTTTTTTTATTC TTAACCCCTCCCCCATTCCACATATTTTCATGTGTATTTAAAAATTCAAG CTCATCTCATTTAAATGGCAAATTTTAGTTAAATTTTGATTTTGTTGATT GAAACAAACGATGTTTTTAAAGATTTCCATTCATTGTAACCTTGCTCTTA GGCTATTCCTTTCTCAAAATCTTCCATTCTTAACAGTCTAACAGTATAAA AAGTTTTAACCATACAATGAGTGTATCAGAATCAGTTAATTGCACAAGAC TAAACTTGTGTAAATTAATCATTATCTTTTACTTGTATGCACAATTACAA GTTGATGTTTCTGTATCGTTGCTCTGCTAACAATTATGAAAATTGTATGG TAACAGTAGCATACCATAGTTTTTGATTGGTTTATATCATAAGCTCATGT GGTTCATGCTGTCTGTGGCCTGTTTGTTGCCTTAATTTGTCATTACAAAA ATTTTGTTTTGTTTATAAAAGAGGGAACTTTTTGGAAGCATTCTCCATAA AATGTTTTCTGTATGTTTTCTGTATAGCACTTGATCGAGACTTACCTTGA CTATTTACGTTGTAACCTAGTTTCTTGTAATCTTGAATTAGTTGGTATTT GCCTTGGCTTTGTCCCTTTTGTCTTTCCCTCCATTGTCACTTTGAAGTCA TTCAGGTGGTGCATGTCAGTGAAAATCTTTTCAAGTTGAGGTGCCACCTG ACCTGGCAGTTTTCTCCCCAAGGTAACAAACCAATGGAACCGACTAAGTG AATATATCCATCAAGGATTTATTTTATTCTGTCCACACAAACCACCTGGC AGGTTTTTACAATAGATAATTAGATCTTCTAATTAAGATCCTGTTCTGCG GTGAGATTTTGAATATCCTTGTTCTTTGTATACTAGTCACTTTTTTTTGT ACCATCGCTCTGCTAATAATCCCTTTGTGGAAATTGTCTTCTTTGTTCCA TTTAGACTGAAAGGCTTTTTTGAAAATATGCCTATACACCATAGTTGTCA TTGGTTTCTTTCTATTACTTATGTGTAACTAAGATATTGTTAATGCTGGG TAATGGCCTATTCGTTGCCACAAATTTATATAAGTTGCCATTTCGAGAAA TAAAATTGCTACACGGTGTTTTTATACTGGCGCAATCATCAGCAAAGTGA ATTCTACAATCTCAAACTAAGAAAAAAAAATATATTTGAATTTATCATAA CAATAACAAATAAACCAGCCGAGGCTGGAAGGTCAGCCAATAGAGCTTAG CTAGATAGCTTTAATAAGTGGGTTAACAGATGTAAGAGATGCACTGAAAC AGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNCCCCCCCCCCCCACGAGAAGCTCAAAGTATAC TTCTCTTTAGCATTGTCCATATAGTACGTACTCAAAGATTTTCCAAATAT TTGACACCCCTCCCCCTTGTACGCAGAGAAAAATAGAAATGACTTTGTTT AAACAATAGATGTACGCTTTTGCTGAACCCCCTCTCCCCCTTCACTGTGG ATGGCCAGTCTGGGTAAATAAATTTTGTAGTTTAGTAACCGTCAAGTTAC ACAACATGCACACAACCATCTTGAAGACTTTGCTGGTCGCAAATGNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNTTCTTAACAGAAAAATATTTTCGACTGAC CGGCCGAACGACTCCCACTTTTTAAAGTAGAAATGACGGGAACCAAACAG TTTTTTGCGATTCGCCTTTATCTTTATCACAAACACGTCCAAGTCCAAAA AAGCACGATTGCATCCAGTCTTTATATCAAATTTAAACAGTAGCTTTACT TTTGTAAACTTTATCAAATCCCAATAACATTATAACACCATCAATTCCCC TAGAGGCAAACAAGAAAAATATATGTTTTTATTGCAAAAACTACAGTATT AAAAAGCACACAAAGTATATCAGAAAATTCAACATAAACAAAAACTTGAG CAAACGGCTTTAAACCTTCAAAGGATATAGAAAAAGAATCCCCTTGATGA AAATCATGTGTTTGATTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCATGTGTTTGATTTGC CGAGTTAAAAAAATAAATGACAGAAATTGAAGCTTGCAACAGATTTACAC TGGAAATACTTTGGTACAACACTGACTTATCACTTCTGACTATCGCTTGA GAGCCGCCGCCATCTTGAAACTACATTATGATCTGTAAAAACAACGCACG CTAAAAGTACCCAAAAAGTTAACCCGATCGGAAGAAAGTTTAGAAATCAA ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNTGAGATCGGAAAATCGGATTTTTTTTTTGCCGTCTTATG ATGATGGTGATGGAAGAACCGAATTTTACGGATTTGAATGCTCAGCTTAG GCTGACCAAAAAGTTGATGTTGTTACATGACAACAAATAAGGAGGCATAG GTTTTAAACTTCAAGACCGTCAGTACGACTTTTCAGAAAGGCCGCAGTTT GGTGTTAAAAAGCTAATTTTAATCGACACTAGGAAATCTTCAATAGGAAC ACTTGTGTCTCCAAAATAATAATATTGAAATATGCTAAAACTTAGCTCAT CGAATTTGGAATAGTCCTAATCCAATAGGTAAATGCCAGCATGAAGTTGA AATTGCTAAAATGCTAAAATATAAAATGTAAATATTTAGCATGGTACTGT AGGATAGAAAAACTTGATCTTGTCAATTCTTTTCAAAAAATCTGAAAACT TAATGAAATCCCCTCGATCAAGGCTTTGATGAAAGGAGCTATGACATCCT TATGTAATCCTTCTATGGTAACTAATTGGTCGATTTTTGCTTGCTTTCTT GTGTCTAGAGTATTTTTATGTCCATGGACTGAATGCTTGGTAGTTGAATC CAAATGAGCAACTTTTTTCCTTAGAAATAAAAACACACTTTGAAACAACT ATATTATACAAATTTCAAGATCTTAAATTCAGAAAGTATCAACTTTTGCA AAAAAGTGGAATTTGCTCAATTTGATCAAAATCTACAGTCTGACTATAAA TGATTGGCTCAGATGATATCACGCCCTAATGTTCATGAAAAATAATCATT ATACCGAACATCATTTGACCGAACAAATATAAGACATGACTACTGTTAGC TACAAATCATACGTTTACATTACAATTTCTTGAGCTGACCGCATTGTGGG CAAACCAATCACAATGCGGGCTGCTTCCTTTCTAGTCCCAATCCACCTGT CCATGATTCGTTCTCTTTGTGAATTCAAACTACGGGGTCTGCTACTAGTA CCCATATTTAAGTTTGCGCGCCCACCGATGGGCGGATGACGGGCGTTTCA ACACCCGTGACACATGGTTTCATTGTCATTCCAGTGTGCCAACATCATGT TGCACATCAAAACTAAAAAAACCATCTTACAATGTGTCTTTTAAGGGTAA ATGGTATCTGTGCAAATCTGGAACAACCAAACATCCAGTACTTGGTCCTC CAACTTCCAATTCATACCAATGCAACGGTTGTTCAACTTTATCAAAGCAA ATTAATTTTTCTTTTGGAGGAGAGTACAGATCTAAAGTTTCCAAATTAAC TTGGAAGCATACAGTCCAGTTTGTCCGACTTTTTTATTTTTTTATTTTGA AAGCAAAATTTGATGACTTCGGAACTTTTTGGAAGCTGTCTGCAAAGTTT CCAATATGAATACGCTGAAAATTACGATTTTCTTACCAGGTTTTAACGAA ATCCAACCTTCGAATCTTTGATAAATTTATTTCCTAAGGCGGTATTAGAC GATTTCGAACCTGAAAAATTTCCAATATTGAATTCACAGGTGTTTCATGC CTTATAGAGCAACCGTATTTTTCGGATTTAAGGAGTATTAAAATTTAGCA TTTTTTAAAGTATTTTGATTAATAAGTTATGATACTTAGACATGATTCTC AGGCTAGAAAATCACTAAACAGTGAACCACTCGGCAGGTGCACAAAGAAT GTACAATCATACAGGACCATCCTACCACTGATTAATAAGTTATGATACTT AGACATGATTCTCAGGCTAGAAAATCACTAAACAGTGAACCACTCGGCAG GTGCACAAGGAATGTACAATCATACAGGACCATCCTACCACTGATTAATA AGTTATGATACTTAGACATGATTCTCAGGCTAGAAAGTCACTAAACAGTG AACCACTCGGCAGGTGCACAAAGAATGTACAATCATACAGGACCATCCTA CCACTGATTAATAAGTTATGATACTTAGACATGATTCTCAGGCTAGAAAG TCAATAATCAGTGAACCACTCGGGGCTAGAAAAAAAACAACAATATTCAT TATTCCTCAGACTTACACTTTTGTAATAAAGTTTTCTTCTCCACTTTTTG TCTTCTTCTTTCTTCCAATACAAAAATAGATAAGCACATATGGTAGTCAG CTTAAATTTTCTTCTCGACGAATATCAGCAAGTGGCGTACAAATCAAGGT ACAATCAAACAGGACCATCTTACTACTTTTTAAGTTATAATATTACTCTC TGAATCGCTGTCTGAAACATTTTCCGAATTATTTGAATCATTGTCCAACC CGATGATGAATCTCTCCTCGTTATCGAGTCCACTGAAGTCAATTCTCCAT AATTTCTTTTTAACTTTTATTGAGCTTTTTTCGATTTTTGCCCATTTCGT AGGCGTGGCATTATCTAATGCCTTATTCACGAGGTCCTGAACATCTTTAA TTTTATAGGTGGCGTTTTTTTCTAGCAACATACTTCTGATTTAACTTGAG TTCTGACAATTTCGGTAGGATTCAACTCCGAGAATGTGAATGTTTTCAAT ACAAAACCTTTCAGTGATTTTCTCCAAATTGAATTCTTTGGGAATGAAAA TTGATTTGCTTTTTACGAGTAAAATTGGTCTTCAAAAGGGATTTTTCCCC TCGACCAGCCTTGAGTCTCAGCTTTCTTCCATGATGTTTTTTGGGTTTTG GACATTTTCCGTTTCCCGAGAACGGTAGCGAGCGTCCTTTATGTCATTGA AATGAATGTCGATTCGAAATGATTGATTATAGTCGTTACATGTTTGATAG GGGAAATGTTAGTGAATAAAAATTTTTCACATTGGATTCGGACATTAAAA GTAAAAGTATTTTTGTCTCCGCTGCAAATTATATGGAGACAGGCATTTGT ATTTGGCGCGGAGTCCCTTTCCTTTGATTCACGTCTTACCCTTTTTGGAA TTGTGCCAATTACTCATATTCCATCTTGGTCGTGCGCATTCTCTGTGTGA GCTCCTCCTTTGTTTCATTCTGCTCTAATGCTTGCTCCAACAAAACTTTG TTTATTTGGTTGAAAAAATCAGTTAATCGGGGTGGTGTGCATAACATTAA AGCCTTTGGTCTTTCGTTTGTATTTACCGCTTTCTTTAATTTCTGGCGCT AGTACTTTAGGTGTACAAACCTTCGCGAGCAGAAACTTTCGTGAGGACGA AAAATCGGGAAAAAGATTTTTTCGCGAGCATAAACTTTCGCGAATGAGGC ATCTTTTTATAAAAAAATTCAAGTTTTCAGTGCGTGAAACCAGTGTTACG ATTGTTCAAATGTACTCGTCAAACCACAATTGGTAGACTTTTGCATAATT TCTACACTAAATTTATCTTTTATCATCAAAGAGGAAAGATTTTTTTTCGC GAGCATAAACTTTTGCAAATTGCTCTTTCAAGAATTTTCAAAGCATTTTC CAATTTTGTGACATCTTTTAAAAAGCTTTTTAAATTGAATTTAATAGATT ATATCTCAATTTTCTTTGCCTCTCTTTGCCCAGGCTGGAAATGTGTTTAT TTTTTGCCCAGTTTCAGCCTAATTGTTCTTATAAAGTGAGTTCTAATAAA AATGAAAAGTGAAGTGTGTCGAACAAGGATGTTATAACGTTCAAGGCTTT TCATGGCTTTCGTGGCTGTCCTACACTTTTGGCTGACGACTTTTCTTAAT TCATTTGGTTTCTTTCTTAACTCAGTCATCTCTGTTGGGTGTTTTTGGTC CACTCTGGCAAGTGCCTTGTTGAGCTGAGTTGGCAACAGCGCGTCGCAAG TGATTTGCTGACCCTTGTACAAACGATTCACTGCTGAGTAACGGCGTTTC GACAACTCTTGCTCTGAGAAGGAATTTTGAAGTTCTTTTTTGATCATCTG TAGCTTGATTTGCGTAAAATTGTTTCAGTGCATCTTTTTCTTTAGAGCGT CCCCAATTAATTGCTTCACTGGACGATAAGTTATCAGACGGGCGATTTAT AATTTTATGAACGATATGTGTTGTTTTGGGTTTTACTGTGGGTTGTGACT TTACAATGGTGTTAACCCTGGACGTCCATATGACACTCCAATGTTGCCAC GATCGTATTGCTTCAATACGTACATCCTCCCAACTACATTTTCCGGTAGA GTGGCAGCAATTTTCTTCGGATCTAAATTTTTCATTGATTTAAGCCATAG CAACATGTGCACATGAGGCGTACCTCGATATTGAAAGTCAAACCTATAGA AAGTCACAGTAACATTTTTCCCATTTTTAGTCGACCTTCTGTCCGCAAAC ACACGAGTACTCCACCTATTACTGTTGCACCCCGAAATCAATCCTCGAGC AATATTTTCTAGAGTGTAATATGTGCACAGTCAAATGGTAAGGCAACAAC TTGAGATCTATCCCGGCATACTTTTGTCCTTCTGTAAACCACTCAGGTTT TGGAAAGACATAAATCGGTCGTACTGGAATTGAAGTAAAGAGTAGTCCAA ACCATAGTCTACAACACCCGACATGGCTTTATAATGGAATGCCCTTTTCA TTGACAATCGAGACTCGTTCCCCGAAATAGCGTTTTCGCACCATTCGTTT TTGACATATAATAAATGCCAAATTGCAATTTCAATAAACTCTACACGAAA TGCTCTATAATAAGGAATTTGCATTTCTTCTGTCACTAGTTGTTCGAGAA CATCGCTATAAAATTGGAAGTAGTGTTTGTTTTCCATCAATTTATCGAGA CATTGCTGTGCAAAGATTCTATCTTCCCCGTCGAGCAAAGCAACACGTTC TTCTGGCAACGACTTGTACAGGCCCGTTTCGCTTTTTGTACCCGTGTACA GTATCCTTCTTTTCTTTAGTTTCTTTAGAAAAACAGCAAGAAATTATTTT TCTGAATTTTTGACTGGGAAAACTGCGAAAATATACTAAGAGGATGGAAT ATGAGGACTTGAACATAAGTTCGTGGGGGAAATACACAAGTTTTCATGTT TTTTATTAGATTTGTGGTCTTTCGACCGAACCAAATCAACCATAAACAAG GTGTGTGTGCATGTTAGTTGAAGATGTTAGTTAGTTGTTGACGTCTTAGT GTATAGCTGGATCAGATGTGGATGTGATTTTCTGTTGCATCCTTGTCCAA GTCACCAATGTAGTGTGAATGATCACCCGCGATCAAGTATCCCCGTACTG TCCCGTTGCTGGCAATGTAAAAATACATCGTTGAAGTCGTCGAGTTTGTC CCAGTGATCGAATGTTCCAAAGTCCGAACTCTTTCAGTCTTCTCCATATT CTCCAATTATGTATCTCTTTGGGCGTTCTCCTCCGGGGACATCTACAACC AAAGACAGTGTTGCCATGTCTCCGTGGTATGTCAATTCAAGTTTGAAATC TGGTGTTGCAATCATGTTGATAGTATATCTAAGGCGTCAGTATATAGTTT TGTTCAAATTTAAAAATTTTCTCTTGGAGTGGAAAATTTGGAAAGTTTTG AGCTATTTTTTCAGCTTCTTTGGAAATGCAGATAACTTTGACATTTGAAG GGACATCAACGGGAATACACTTTAAAACAACAGATAAGGGACTAACGATA TGTAGTTCATGAAAAAGGGTAGATACAGATTCATCAGTAATAGTTGTTTG TAAAGCGGGTTGGACAGGATGAAATTGATGCAGCTCCTTAGCACGCAAAT CTTTTCGGTTGACATCAATATTATTTTTCTTATCATCTGAGCAGATCTTT TTCCTTATAACAATGTCTTTTAATTTTTTTGGCCCGATTTCCCTCTTGGT TTCTTGTTCCAATCACATGGAACGTCGGTACAGGCAGGGTCGAGATATCC TTTCTGGTCAGCATAATCTAGTTTATACATAACAGCAATCACGCGATTGC AAGAGCGGCTACTACCGTCAGCCATACAACTACACCAACATGTCAAAATG GTAACAGTGTTTTTCTGAATAGCTATCCACAAACGTTTTGTGTCGCTCAC TGTTAGTGAAGGCCTGAACTTCAGAGAATATATAAAAACTTTGTTTTTGG ATGAGGATGACTCGTAGATAAAGACGGTCTGAACAAAACCACTGTCAAAA TATGAAAACGCCTTCTGGTCTTTATAACACCCAACATAATCAATTTCAAA ATCTCGTACTTTTAGAATATTATCAAAAATAATTCCCAAATCCAATTTTG GCCGATTCAGGTAATCATCTGAAAGTTTTTCACTCTCGATATATAAGAGA TCACACAACTTGAACTCCTTCAACCGTTTATCATATTCATAGCCAAAACC CTCTTCTGCTCTTCCACTGGCCCGACGGTTGGCAGATTATTCTCAAAAGC ATATATGCATAACCTTTGTACCAGTAACAAGCATACCCCGTACAGATAGA TAATCTATAAGATTATTCATGCCAAGGTCCATTAAGTCTACATGTACCAC AGGAAAGAATAGTCTTATCCCAAGGTCGAAACTTTTAATTTTCCATCCCG GAAAATGCCATGGGATCGTGAAACAAGTTAAATTCCGTGTTGGAAAAGTT TTAGTTTCCAAGGTGCGAAATCGTCTAATTCCGACTTGGAAAACAAATTA CTAGAAAATTCAAAGGTTGTATTTCGTCAAAACCCGGCAAGAAAATCGTG ATTTCCAACGAAAGGTTTTTGAAAATGCGGGTCGTAAAAAGTTGATATCC CAGACATCAAATAAAATAAAAGATATATAAAAGACAAATACTTACAACAT TCAAAAACAAAACAAAATAACATAACAAAGCTTGACGATTCATTAAAACT TTCTTTCCTCGAGATGCGATGATGTTGTACACATCTATCATTTAAATTGC AACGAAATTAGAATAGTGAGTTTACGAGAAAAATGTGAAGGAATGTTGTA AAATTTAAAATTTAAAATGGCTCAAAGCCACGATAAGTTTAAACAAAAAG AGTACATAAAAAATTATTTAAAATTATTTTCTAAATCAATTAGTCTTCTG CCCGGCCGTCTCTTTCTTAAAATCTTCGTTCTTCCAATCAACAAACACAA CAACATTGTCTTTGTTGTCGACTGGCTTGTCGATGACCGCAGCCAAGCGC TTGTTTAGAATCGCCTTTGCGATATAAAACGCCGCTTGGTTAATAGCTGA TTGCTTCAATTTTCTCACCTCACAATATATTCTCGCTACCTCATCCAGAG GTAGCTTCCCAATTTCCGAAATACCAGGACTAGAGTAGTCAACCGAAAAT GCACATCGCAAAATTCTAAATGCCAACCTTGGGATAAGATAATTTTTTCC TGTGTACTTTTGACATTTGTTTTGATGTATATATTACTGCTAAAAGGAAA AAGAAGTTATCATGAGAGGAATATCATTAACATACAGCTAATTGCCTAGG ACGCTACAACACAATCTGAGAACGGATAGGGAGACAAGGAAACAGAGACA AGTAGATGTATAGGTCGAAACGTGAAATGTATTTCCGAAATGAGAGTGCC GAAAGTATGTTGGTGCGATGACGTGGGTTTTGGGATGCCATTGGGGATGT TAATCGGTTAATGTGAGTTGCACCCCTCAAGTGTGTGTTGTAGACCTTAT CATTACACACATCCCATCTAGCAGTAGGGTTATTCACAATAGATGATCTA AATGCTTGATCGTAATTATACCAAGCCTTAAAGTTAAAAGTTCTGGCTGC CTGAGCAATGTATATTTGATATTTAGCCAATTGGCCAGCCAAGTGTGGAT GGAAAATAATAAACGCTTGAAAAAACAAAGTCTAGGCCAGAAACCAAGAA TGAATGTCAGTAACTCTACTTCTGTTAGACTGCAGCCCGTTGTGAATAAA AATCTTAGGCATAGTAGATACGTTGGAATCATCTAGTGAAATCGAATATG CGTTACGTGTCTCAGACGGCACATTATTAGGTAGTAGCAAATCAAAATTT ACAAACTCACCCTTTCGTATTTTTTCGAGGACAGCTGCAGGAATGGCGGG AAGATGTTGATCAGGGTTATTTCGGGGCTGAGTTGGCAACGTTGGTGGGT TGATTGGTGCAAAAATAGAGTCAGCGGAACTGGAGAGCGATGGAACAGCC CCTTGTTGATGTTGTTGGTCTGTAACAACGGCAAGAACCTCTCTGACAGT GAAGGATCGTGTTGTCGTGGTATTGGGTTTCCGGATCTGTGAGACCAAGT TTCTGTGACGACTGCTTGTGGTGTAGACGTTGACGAAATGCATGTAGGTG GAGCGTGATGAAGAGCATCCCCGCTGCTGAAGGTTTGTTGTGCCGTAGTA ACATGGATGGGAATGGTTGATGGTGGAATGTCTGGCGGTCCGCATGATGA CGTCTCTATGGTGGAGTTGGTTAGAATAGGTGAAGAAGCGGAACTGGACA AAGATGACTGGTGGTGGTGAAATAGGGCTGTTGCCAATTGGGTAGCGGTG CCAGAAGACTGTAGGTTTGCAGCATTAGCATGCAGACGTAACGATTCAAG TGGCAGCGCATTCCACTGTTCCAGTGATCGTTGCTGTGGCGGAATACTTG CCACACCATTAGAGTTATATTCAGGTGCAGGATTATCAGCCTGAGATGTG TTTGAAAATGGTGATGAAAACAATGATTGTAAACAATGATCTTGTGATGG ACATGGTTAATAACAGTTGAAACCGCAACTTAAGACGGATTATAAAGGAT TAAAACAGCAGTTCACGAAATCGAGTTTCTAGCTCAGTAGTGAAGGTAGA AAGAAAATGTTTACAAGTTCGTCTCAGAATATAAGGAGGCATGTGGCGCC AAAACACTATAAAATGATGAGTAAGGATAGGAATGGCGCGTTATATAGTT ACGGTACCGAAAACAATAATGGCGTCAAACAATTAACCAGAGTTAAAGAT AACTCCAAAACAAACTCACTGTCTTCTAAAAATAAGAAATAAACAAATCA TGTAAAAATCCTTTTATTTACAGAAATATCCTCTGCTTGAACAACAGTTG TAATAAAATCCTTTCAAACTGTAGTACAGACACAGTAAAAATTGACTCAG GATTTGTAAAGCTGATGATATTGTTCGAAATGAAAAAGTAAAGTAACTTA TGTTCAAATAATTGAGAAAAAAAATGAAAAATTGATTAAATCTTAATTGA CAAATAAATTTAAGGCTAATTAAAATAATGATATTTGATCATTAAATTTA AGGCTAATTAAAATAAAATTTTTCAAAACTTTGACCAACAGTAAGCCGTC ATCAGCGCGCACTGGTCCTTTATCAATTACAGTTTGCGACCGTGAAATGG CCTACTTTTTAGAGGTTCAAATATACATCTAGCGGCATCTCTTTCAATTC CTTGTACTTCTTACGTAGATATTCACCATGTGACGTGGTCAGGACGTCAT TGATTAGTGTAAACCCATATAGAATAACGCTTGCTTTTGAAATCCACCCA TCCTTGCGCCTTTTGCCGTCCGAATAGAGCATATGAGGAACCCATTTCTT ATTCCAGCTTCCCTTCCAATAATTGGCTCTCACTTGATTTTCCTCAACTT CGATGATCTTCCCTAATAAATCAAAAGGTCGATATTAATAGATGAAATAT GTTGGTTGGTAATCAATTGAGTCATCCATCTTGTGGAGCCCACTGAAAGA ATACAACCCAGCCCGAGCCAAAATTTACTTGTTCTTTATAAAAATGTTTT CTAGATATTTACCTATTGTAGGTTCTGTTTTGCTATCAATCAGCCATATT GCCACCATCTATCCTGATTCCATTTTTACCTCAGATACTATTTCTACTGC ATTTCCCTTTTGCATGTCTTGTCTGTATGCTACCGTCTTGTCTGTATGCT TTCATGTCCTGATATATCTTCTTCAATGCGTATTTTCGAGTCATTAGCCG TCAAATTGTTCAGAGTATTATGGGCTATAGTAGGGGGCTATGTCTAATTT CAAATTATTCTTTATTATAATTCAATACCTGTGGAGCTTCACCATGGTCC ATACCGTACACTCTTCGAGCAACTTTGATTCCAGGCTCCCCAGTATTGAC GGTGAAGTCCGTTGAATAGGTCATTTCCAACAATTTCGGAAGCCCCATTG AGTTTCACCTTTGCATTGGTACAATTCACTTTCGATATTTAACAAAATCA TTCCACTCCTCTTTCAGTTCGCTCTTGAAAAGACGAGATTCTCGGCAGTA TTTTCCAATATCGGTCTTCAGGGCCCTTCAGACGTGTACAATCTTGGCAA TCTTTGTTAACTTGTACAAGCTTTGGTGTGATTAGAAGTTTGATGTATTC TTCCTGATATGAACAGTAAAAAAGAGTATTAATAGTTCCACAAAATGGAA AATACCGCTACTCTAGATATCTTATTTTTACCTCCATATGTCTCATGATC GCAAATCCTTATGGTAAATCTTCATGGGATCATCCCCCCAGGAAGATCCC CATCTTCCTGATGCACTTCGCTTTCAGGAGTTCCAAGATCTGGCGTCGGA CGGGCTTTTTTCGATTGTACGGCTCCCTCTGGTCCCTCTCGTAAGTTCTC CTTGGATAACCATTCGTCCGAACCTCGTTTACGTTTCGTCTCAATGGGCT TGAAGAAATCGAGCTTAACTCGGTCAGGGAAGCCAACTCTCTCACGGATG ACATTCTGGCGGTTGACGGACATGACGGCGAGACGCTTGAATTGCTCCTT ACCATGAACTCTTCTTCTGAGGACGTAGTTGAAACAATTCGTAATCGCGG ACGTGCCAGTCTTGAGGAACAGGGATAGGTTGAAAGGGGGGTGGACAGCA GGGACGTTTTCTTGTAATTCTCCGGTGACGTCAGGTTTTCCGTTACAGCA GAATCCCTTCGCCTGCTGCTGGGTGGAATAGGTGACACATCCTCTATCGA CAGCCTTGGAGAACATGTCCTGGAGGTGCTGCCAGACGTATTGACGAATT GTTCTCCTATCCGTCTTCTCACGCCAAGTCCCCTTGTGACGGGTCGCGCG GATAAGAAGGACGTCGTGCGTATGTAGTTGGTTTTTAAGGGCATTTTCAC AGGCGTATGCCGCGGTGTCGGATTTGGTTGACCAATGTTCAGCAACGAGC AATCTTTCTGCGTTGATTGCGTCGAGTTTTTTCTTCGAAAGACGGAGTCC GGGGTAAATGGCGTGAATGATAACTGTAGGTGGTGTTGGGACTTCGGGGT TGTAGATATCGTCTAAATAAACAAGTCCCTTTTCTTGTATTGCAGTAAAA TGTAAAGCTAACATCTTGGGATTGGTGTGACCGGATTTTAGGGCATCGTA CAAATCGCTTTTCGACATAGCCTTTACCTCGCTAAAGACGCGCTTGACCT GTTGAAAAATAATCACATCGTCAAGCTCCATACAAGGTGAAATTTCAAAT TCGTATTCATAGCGTCTATTATCAGTATTATATAGTCCTTTCATATTAAA TAGTTCCTTGGGATTACTCATTTTAAAATTCCAAAAGAACGAATACATAA TGTTCAAATATGCGAAATAAAAAGCTGCATCAAAAGTTACGTTACGGCCT TCATATTTTTACATTCTTCTGAACCATCGTCTACGGTATCAATTAAATAG TCAATGTTTCGCATAGAGACGTTACGTACTAATAATACTTCATCAATGGC CGGAATATAACAAACCTCTTCATCAGCAACGAGTTTATCCATCTCGGCGT CCATGTTAGGGAAATCATCATCCATAAGATTTTCAGGGTCTTGGTAGCAT TCATCATCAACGATTTGTTGTGTTTGTTTTAATTCTGCCATGTCTGCTTC GTTATGTGGTTGAGCGTTCGGATATGCGTCTTCCCAAATGGTTGGTATCC AATTGTTGTCGAGTGATATCTTGACGGTTTCCCACTGATAATTCATCCAA CTTTTTCCGTGGAGGGGGAAGTGAATACATTTTCACCTTGATAGGGGGAC TAATGCAAATGGGGGATTTCAGGAAATCTTATGGGAAGTAGGGGTAGAAG GTGCAAAGATTAGGTATAATATTACAAATAGATGATCAGAGGTCATCGAG AAACCAAGCAAAAACTGTTCCGCTCATTTTGTAGGCCCATCTAATTAGCA TCAACGTCCAAAGTTTCATACTCAATCATGATTCCTGCTTTCTGGATCTT TGCTGGGGTAGAGCGCTTAAATCTTTATTTCCACTATTCTGGTGGGTCAC CATATTGACAAATTTTCAAAAAATTGTCATTTTTCTCTAAATAGGACTAA GAAAATCAAAAATACCCCAAAAACTTTATCCCAACGCTGTTGGTTGACTT AAAGTGAAAAAAAGTTCTGGGTTCTATTTTCGGTATTTGCAAAGAATGCT GACGTCATAAGGTTGCGATGACGTCATCATTGATACCAAAATTTACATCA AAGATGTCGACTCATATTTGGTGCATACTTACAAAGCTTCAAATCAATTA AACAAATATTTCAAACGTTATCAAAAATGTTCGTTTCGGCCGAAGGTTTA ACTGTGTGATTAACGAGAAATGATTTTTACAGCTAGTTTTTGCTTATAGA AAACTAGTTTGACTCTTTCTGATTGCATTTAAATCATTTTTAAGCCATCA AAAATAATTTCGGCTTGGTTTTAATCCTTGACGTCCCACCAGCGAAATTT TGTTCTTTCACGAGCTATATTTTCGACTGCCGATAGTCTTGATTGATGAC CTAACTCAAAAATTTGGCACGATTCAAAGTTTAAGCATTGAGAAATCTTA AAAGCGCGATTTTTTAGCTTTTTGAGAACGTCAAGGACTTCAAAAGATTG CTTCTATGTTGAATCGAATTCCATCAAAATATGAAAACTTAGGCATCAAG TTTTGACATTGACGAATAACTATTAATGACTTAAGGCGCGAATAAAGACA CAACAACTAATCATGTTAAACTTAATTCACTTATACATAGTATTCATCCC AAGAGGGATGGTGGTGTTGGTATCTTCCACCCTGTCCTTGGCCACCATGA CCACCACTATGACCGCCTCTATTACCACTACGATTACCACCACGGTGACT GCCACGGTGACCACCACGATTCAATCGACCACCTCGAGCTCCTCGACCAC GTCCGCCCTAAAATAAAAAAAATAGATAAATGTCATGCATATAGGGCTTA TTAGTCAGCCCCGGTGACCTTTCAAATCGGTTCGAGGATTTTTTTCATCA TCCGATACTTTGTATATGAATGCACACTTTAATTCCGATTTCAAATTATT TTCGAGAAACAGGTTATCGGGGATTACATATAGCGCGCAAAAATCATTTT TAATTTAAGAAAGAAAGCGGCAGATTTTGTGATTGTGTTCTGGAGTAGAC TCTCAAAACCTCTGTTTTTGTATCTTTACTTAGAAATTCTTCCTCAAACT TTGTTTTCTTTTACCGAGATAAATTTCTTTAATCGAACTTTTCAAAGTCA CTCAAATTGTGAGTATTTGATTAAGTTCGACAAAACATTTAAGTTTGACA AAGCTCAACAACAAAAAACGCTCGACAAATTCAACAAAAATTCCGTTCGA CAAAGTTCGATAACAAGAAAAGTTTGACAAGTTCGAATCAATTCCGTCGT CAAAAATACGACATATTCTAACTCTAAGGCTTCGATTTCTTTTTGCCTGA GAAAGGTTAAAGATTCCTTTCTAACCCTTTGGGCTTATACTTCATTGGAT AAGACCGCCGAGAGCGTTCTGAAAATAGTGGCCTTTACTTTCCACTTTCA GGCTGAGAAATTTCGGCGCCGATTACGTAATCTCTTTTCAAGGATCAAGC AAAACATAGAGTCTCGTCAAGTGGCAACCATTCTTTGTCGTTGGCCCGGT TTATATTTCATTGATGCCACACCGTTGGACTTCACGATCTTGAAACAGTG TGGGTACACAATATTGTTTATTCTTCATTGTGGGTGGGAGTCACTTGAAG AATGGAGAACAATATCTCTGGAAATTTTACATTCTTCATCATAACTTTTG GAGCAGAAAAGATTTCTAAATGAAAATTTCCAGAGATATAGTTATATTTT AAGAGTAATATAACTATAGAGAATGTGAAAAATTAAAAAATATTTTAGAA ATAGCCAAGAGTAATATCAGCCAGGGGGTAATGCACTATCAAAATAATAT GGCAGCGTTTTAGAAAAATCTATAAAAGCTGTCCCAAAATTTATTTCTGG AGGTTGCTAGTATTTGGATAAGCTGTGGGATAAGTGGATAATTTTTTCAA CATTTCATTCCAGGGGGTTTGAACCTAAAAAATGGAAAGTTTAAGTTTTA AAATCGAAAAGTGATTTTTTCAAAAATCTAATCCATTCATCCCATAGCAA ACCATAAATGGAGCAACTCCTGAAAATTTCATGATCATAGCTCTTTCCAA TCCTGAGAAACGTCGTCAATGTGTGCGAAAATCCCCTGAAACCTATTTTG AGAAAATGGTCCGTAAAGTCAGAAGTAGATATATTTCTCTATTTCTCTGC AATAAATCGACCGTTTTGCAAAATTCTTTCTGTGTTTGACTAAAATGGAA TAAAGTACTACTTTATATAATGACGTGTTGCAATGTCCAATCAGACGTTT TCGTTGCAATGTCCAATCAGACGTTTTCGTTGCCATTTATTGGTACGCCA AGGGCGGTTATTCTCTCACGTAATATTGCTGTTGAAAATTCGCCTCTATC TTTGTTTGTTCCATTTGTACCATTCCTGTTTGATTTTCTTGATAGTGTTC TGTCTGATGACCTGCCTGACATTAATTATGACGTATAGATTTACTTCCCC TTTTCCCAAATTTAAAATTAAAGATAAGAAAACTAAAGAAACCGCACTTC TCTGTGTGGTTGCAAATGAAGAAGTAAAATGAGTCTATTAGCGCGGTAAG ACTAGACTGATGCCGAAGGCGTTATCTTGTTTTCTTCCCCTTCAAAAGGT CTCCATCAGCAGATCCAATTTTATGGTATCTGGCGTGTTAGATGAAATTG GGTATTTACCCAAAACATCCTTTTTAATGTCTTTTTCCGGGATGAATAAC AGCATGTTTTCTTCAATATAGTGGCTAATTCTCTATCTAGATTCCACTCA CTCTTGTCTTCGATGGATACAANGACGGCATGTTTTCTTCAACATAGTGG CTAATTCTCTATCTAGATTCCACTCACTCTTGTCTTCGATGGATACAAGT TCAAGTTTGGGTTTCTTACTTCTTATCTTTGGGTTTACTTTTTCCCTTTC TCTTTCGTTTCCTGGATTTCTTTCTTCTTCTTCGTCTTCTTTCTTCTTCG GAAGAACTTGATGACGAGGATGATTGGGACGAGTACTCATCACCACTACT ACTGGAATTCCTCTTTTTAAATCTCAGCTTTTCCTCATCCTCAGTGATTT TTGGGATATCTCCAGATTCGTTAGCTTCAGTCGTTTTTTCTGCATCTTCC AGACGCCATGGCCAGATGCCACTAGCCATAATGTCGCACCCAGGCCGAAA ATGAGATAATTAACTTTGAATTTATCTTGTTGTATTTGTAGATCTCCTAT GAATTGTTGACTACTTGATTTACGGTAAAAATGACACCTTTCACTTTCGG TTATACCGATTGTAAAATAATGCCCTGAGTATGGTTATCAATAATCCACT AATAATGTCTAACATCTTCAACACTCTCCTAACCTAATCATTCCGATATT TGCCAATTTTGCAGATGAGCTTGAATTTCTATTTTATAATTATATGACGG CGAAATTCAGAAAATTTCAGTTGATTCCAGTCTTTTTCCATTGTTTGATC GACGAACAAAAGCTTTCCAGATAGACACAACAGCGATTACAGAAGGTACT CGAAAATATTCATGGGGACCAATGTTACTCACATGAAAAGAATTTTAAGA AAACCCCGTCATGAGTACCTTTTGTAAACGCTGTTGAGACGAATGTCCAA AGTTTATTTCATTTCACTTAAATTATTGCCTAAGCAAATTTTTGTAGTAT TCAAAAAAAATTAAATAATATATTCATATTGAACTATATTTTTTATCGAT GAGTTTATTAAAATTAAAAATAAATTGTAAACAAACAACATTTGAATTTC TTCTCTACTTCATTTCTTCCCTTTTCATATCATTTAAATGAGTCGTTTAA TACCCAATGTGCTATTGTTATCTTAATCAAATAGCATTAAAATTTAAGTG AATTTAGGCAAATGGAGGGTACGGGTATGTGCCGCCCTTAAGGGTACCTC TTTTGGATTTCCAAAGTCCCGTTAAGGGTCGGAAAAATCAGAAAATCAAA TTTTAGTCCCACTAAGGGTCGGAAAGATCGGAAAATTTCAACTTTCTACC CCCTGAAAGATCGAAATTTGACCACAGACATTAGGAAAAAACGAAAGATC CTTTTTTTTGCTGACGTAATCAGAATTTCGAAAAATTTCTTTTTTGAAAT ACATCTTTGGTTAAAGTTTGAAGAATAAACAGTCCTTGAGAAATTCAATT TTTAGTTTTTATGACGTCATCAATTATGACGACATAATCAGTTTTTGCGG TTTTTCACGAAAATCAGCGAAAAAACAATTATGTTACACATCAGGTTAGA AACTACATTATAGTACCTTTCGTGTTCAGTCGTTTGTTTGGTCATTTTCT GTCGACTAATGCGATCTAAAAATTATGGTAATTTTAAGACATGCCGTTGT TGTATTTTTTAATCGATTTTCACCTAGATATTTTCATAAAATATACAGGG TGTCCCGAAAAAAAGTATCGAGTCGTACCATTTCTATAGAAAGAAAGTTC TTGTGTGTCTCTCTGTGTCATATTAATTGTCACGAGACATAGTTTATGAA TAACTTTTACAAAAAACAATTCTCAATAANGTCATATTAATTGTCATGGG ACATAGTTTATGAATAACTTTTACAAAAAACAATTCTCAATAACTTTACG TCATGAAAATTATAAAGAAAGTTAATTATTTTTAATCATAATAAGCAGAT ATTCAATGGGTAAAAGTTGGTTATTGGATTTATTGAATATATGTTTTATT ATATACCTAGAGGCAAAAACGAAACATTATATATGTCAATTGTTAAACGT TTCACATAAAATACTCCCATACAGGGCCGGCGAATCAATTTTGAAAGTGG AGGGGCCAAATAGTAAGTGTCTAAGGAGGCGCCACCATGGTTGGTGGATA TTTTTTTTCTTAGCAAAAAAGTGGGGGGGGCCATGCCCCCCCCCCCCCCC TTCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCCCTTCCCCCCCCCCCC CCCCTCCCCCCCCCCCCCCCCCTTCCCCCCCCCCCCCCCCTCCCCCCCCC CCCCCCAGTTTCGCCGGCCCTGCCATATAATCGAACGTTCGAAAGTTTTT ATTTTTTAATGATTTTCTTAATTACTTTGAGTCATAAAATGTGTTCATGA AATTGACAATAGATTCATTTTAATGAATTTCTTTGATATAACAACAAAAA CGACAAAAAAAATCAAACTTTGAAAGCAAAATTTGAAAAAAAAATTCTAC CGTGGTATAATAGCCAAGCTCTCCCTCTTTTTTCTTTGTCATTACGATTA ATTTATACATTGTAACTACCTTTAGTAATGGGCCTGTGTGATGGAGAACG TTCTTATATTTTAGCGATAACACACACAAACTTTTCTACTCAATTGCATG TTCAAACTCGATACTTTAATTAGGGACACCCTGTAGACCATATCTGACTG CGTTCATAATTAAAACCATGGAGCTAACTTTTATTACCTCTAAGCTAAAA CTAACTCAATTGAATACAAAGAGTGAACAAATATGCAAACGAGGTAATAC GTACCGTGAAAAGCACAGCTCAAAATCATATATTTACGCTGTGCCGACGA ATCGAGATTCTATTCATCGCGCAATCAGCGAAGACAAAAGTAACCATGAN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNTTAAAGTGACATTTCCATAATTAAAAGTTTAGTAA TTACTGTTATACATTTGGGGATCATGTAAAAGATTTCTTTCGAAATAAAC ACACTTCAACTACACTTGGAGGTTTCTGGGGAATTCGTAAATAGTAAATT GCATACTGATACAGTCTGCTAGACATTAATATAGTAATATTTGCTCTTCA TCTTTGATTTTTTCTACAGTGATTAGATTGACACATGCGCNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNGATTAGATTGACACATGCGCGATAAAATTTATATTATTTGTCTTCA GAGGTTACTATTTTCTTTGAAAACTTAACCTCTGATACTCAGGGTAGGTA ATACGCATTTATAATTGCACGGTTTTTTTAAGAATCACACTTTTAAGAAA CATGAGGCTCAGAATGCCTAAAAACTAAGATACATGCTGAGCCTGAGAAT GAGAAAATAATATTTTTTAATTCGGTTTTTTTAAGAACGTTCCAATCCAG CCTTTCATAAGGCTGATTATGTCAAAAAAAGTTTAGAAACATGTAAGAAA CATTTAAGGCTCAAAAGGCCGATTTCTTAAGAAACATTGAGGCTGCTTGG TAAAACTAGTTTCTTAAAAAAAAGAAAACATGTATAATTTCTTTTCCGAA ATGTGTATATCAGCCTCATTTTCATAATTATTTAAATATTTACCTTTTTC TGTTTGTTCATGAACAGTAATGAACTGATGGAAACCAGCAAAGTAAATCA TTAGTCAAATTTCAAACATCGTGGATAGCTAGGAAAACTACACCAGTTAG TCAAGCGCATCTATTACTATAGGGTAGCGTGAAAGTTATTATTATTTGAT TTTCTTTCATTCAAAAAATACTTCTTAAAACTGTAAAAAGCAAACCGGGG GAGGCACTCAGGCGAAATTGGGAACGGGGACGTGCCGCTGGTCAGGGTCC CTTTTTTAGGCTTTGAAGATATCTGATAGGGTCCAAAATTTACTAAAGTC TATTTACGATAAGTGTGCACTCTTTTTTCTTTTACCTATAACTTTTGAAG GAATTCTTTGATCTTTATAAATTTGGTATCATTAGAAAGATATTAGTGAG TGGAACAATTTGAAATAAAAAAATCTTTAAAAAAATTCTAAAAATGAAGA TGAAAATGAAGAAGAAAAAAATGAAGATCTTGTAGAAAAGTGCTATAACT ATCATTTTCACTGAAGTGAATCTTTAATCATCGAATAGCCATTCAGTCAA AAGATATCAAACAAAGTTATGAGCTGATTGACGTCTAAAAACGCAGTTTT CTGCAGTTTTTTGCTGTTTTTTCACAGTGATGATCTCCTAAGATGAAAGA ATCTCTCCAGTAAAAATGAAAGTTATAGCACTTTTCTACAAGATGTTCTT CAATTTCAACATTTGTAGGGTCGTCTTTTGGTTATTTTTGACAATTTTCA GGGTGGACATTAATAGAAAAATTTTAAATCTTTGTCTACATTTCGTCATT TTAGCCACTTTTCGGGGTGAAAATGGGAAATTTGTTTCGATTTTCTTAGC GATATGGTCCCAAATTTACCAAACAATCATATCTGTCAGGGTCCACTTTT CAAACTCCAGCAAAATACTGAAAGATAAGATTAATAAGAATTATCTTCCA TTACAAAATATTTACACATGACTTGAAAACTACTTTATCTGTTGCCATTA CATAGCTAGGAAATCGGTACCAGTAGCAACAAAAGATATATAACAATAAT TGCGCGCGAACAATTTTTTTAACCGCGGCGGTCCGCTCAGAATCGGAATA AACAACAACATCATGAATATTTTCAGGCAAGCAAGTCCGTCGTTGATAGC TAGGGAAACTAACCTTCTCTGTCGGTCTTACATAGCTAGGAGATCGGTAC CTAATTAAGCATTAAATTTAAGATTTACCGGGACCCCTTCCGACTGGAAA AATTGGCCAAAATATCGTCCCCAGTGGAAAATCATACTCTAATCTTTTGT CCCCGCTGAAAATAATGAAATAAACAAATTATTGCTGTAAAATACTTTTG CTGTTTTTTGCTTTTTCTATTTCCACTGACTTGAAAACAATAGAGTACAA ATCACGAACCCTAAAGCACATGGGAATAGGAATACCCATCAAGTTTTGGT CCGTTATTTTTATCCCAACTGGTCGAAAACATCCTACCGGGGCTTTGAGA AGGGGGTACCTATCAAAACGCATGTATTTACAGTTGTAAGTCAATTTTCT TCTTATCTGCTGAGAGTGCTCAATGATATCAGAGCTTGTTGGTCAGCCTA AGCTGAGCATTCAAATAGGTAAAATTTTCCAGTTCCATCATCATAAGACG GCAAAAAAAAAATCCGATTTTCCGATCTCACTTTGNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTGATGGTGT TATAATGTTATTGGAATTTGATAAAGTTTACAAAAGTACAGCTACTGTAT AAATTTGATATAAAGACTGGATGCAATCGTGCTTTTTTAGACTTTGACGT GTTTGTGATAAAGGCGAATCGCAAAAAACTGTTTGGTTCCCGTCATTTCT ACTTTAAAAAGTGGGAGTCGTTTGGCAGGTCAGTCGAAAATATTTTTCTG TTAAGAAGCAGCTATACATCTTATTGAAAGGGAATTCGTAAATTTAAAAT TGAGAAACCGTGGATAAACTGGTGTTTTCGGTTTACTCTCCATTAGCATG CAGCTCTCTACTTCGATTTGAAAACTTTTAAACACAGAGCGTGCAGAGGT TGACAGTGGAAATCCAGCAAAGCAGCGGAAAAGCTTTCCGACTCTCCAGC TCTACCTGCTGACCGTAAATCAGATGACGGGAACCAAATGATGACATCAC ATCTCCTATTATTGGACTTGCAAAATTATGACAAATGGTCTTTGGAATTC GATCATTTATATTAATATTAATATATACAGTTCTTGTTGAAATTGATCAG ACTATTTCTCACGCAGTTCCGGACGCAGATTGTGTTTTTCTAACCTTTTC TAACCTTGGCGCACATTTTGACTGAATGATGGAATGGAATGAATGGCGAT AACAGTTTATAGNNAGCGGTTTGCGTGATTGGGACTTTTTTCTTGCGTGA TGGCGTGATCAGAGATTTTTTTTGGCGTGATGGCGTGATCAAGATTTTGG CGTGATGCGTGATAGGGCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNTGAATTTATTTATTATGGTTGTG TGTTTTATTCCGCCAAGGCGGTGAATCATTCGCCCAAATTCATAGACCAA TCAAAAGCGAGTTTAAAGCAAAACGGGGAAAAAATGAGCTTCCCCCCATA GTTATGAATTTTAAGTTTTGCTTTCGATTATCATTTGCGATCAGCAAAGT CTTCAAGATAGTTGTGTGCATGTTGTGTAACTTGACGGTACTAAACTACA AAATTTATTTACCCAGACTGGAGGGGCCATCCATATAGTACGTACACAGT GAAGGGGGGAGAGGGGGTTTAGCAAAAGCGTACATCTATTGTTTAAACAA AGTCATTATTCAACATATTTAGTCTACTCTGTTTCAGTGCATCTCTTACA TCTGTTAACCCACTTATTAAAGCTATCTAGCTAAGCTCTATTGGCTGACC TTCCAGCCTCGGCTGGTTTATTCCAATTAAAAGAATAGAGACTTTGATTT ATTATTTAGAACTTTAAGTTTCATTCCGAGCCCGTATAGACGACAATTAT CAGTTAAAAAATCCACATATTTACAGTTGTATAAGATTAAAAAGTTATAA TAAGTAGGTTATTTGTTAAAGTTAATAGTCTTATCATGATTATGTACATT AAAATAAATTACAAATAATCGATAGTAATTCTTCTATTGCATTACTTCAG GGGATGAAGATTTCGCAAAAAGAAACATTCGAGAATCGATCTCTCCGAAA TATTTTGCGCAGAAAACTTTTCCCAATCTCAAATTTGATCTAAACTGTGG TTTTTTGTTATTCTTTAGGTTTCCCTTTACAGATGACCATCACCAGATGA ATGACGATCATTACAAGCAAGATGGTGAACTCAACTACCGTCAAGAAAGA AAAACCACCAAACAATCCCAACTGTCCACCCATATCAGCAATTAAATTCA CAATGGTATAAAATTGTTCTTCTTCCATTTTAATGAACGACTTGTCTTCA TAAAATATTGAAACAGTTAAAAGGTTTTTTGAAGGATCTGGCTTTCCTTC AGCAATTTCTCGTTGTCTTCTGATATCCTGTGGATAGTTTTGCGAATAAA CAGATGTTGAAAATAAGGTTTCTTCGCACGGTGGGTTACAGTCGCATTTC ATATTTCCGTCAAACCATTTTTCAAGCAATTCGTCCAAGCACTGATCACC TTGTGGGCAAAAAGGGACATCTTTAAACCTATACTCCAAGGGTAGGCTGG GAGCCACACATGAGCATTCATCCCTGATAGCTGCATTGGCACACAATTTA GAGCAGAATCCATGGGTCATTCGGTCGATGTGAAAATCACTTTTTCTGTC AGGTTCCACCATATGCTTGTCTTGGTTTCTCATACAAGACCCATTATTGA ATGGATCAGCTCGATAGATGTATTTTTTCGTTAATGCGATGTCGTATTTT TTGCCTGGGGCAATTGGTATTGCTTTTTCTTCAACATCGAATTTTTCACC TTGTAGTCCAACAAACATTCTTAGTCCTGCACTATAAGTATTGTCAATGT ACTTTTCTTGCTCAATATTAAAATGGAGATGCAATCCACCTCTATGACCA GCTCTGGTGACTCGTCTCGGATTCTCAACGTCTGCATTGAAGAACCAGCA TTTACCGTACCTTCCTTGCCAATATTCTCCCCAACCAAGATTTGTATTCG CATCATTGTCAGAGGTCGGTGTGCAACTTCCCTTAACATGTCGAAAATCA CACCTTAAAATGGAGTCGTTGATTCTGTGGCCGTATATTGAAGGGTCTGC TACATGACTCATCGCTTTATCTGGGTCGATAGATTCGAATGTTTCGTTTA GTTGAGTCAACAACTCAACATACTTCTCTCTGACCACTGGGTTTTCGTTG CAAAAGACAACCACTGGGAATTTCGGACGATGCTCATAAACCACAGTCTG TTTATTGAGCAATGGGCGATCCAGATACTTGGTGATTAAAGGTTGTATCA CCAAAATGAGAACAATGTAAGCTGCCAGCATTGATATAATCCATACTACA CTTCCTAATATTGTCTTTGTCGAGGCCAGAGGTGAATATCCATGTGCTGA TGTACTCTCTGCAAACTCTATCAGTAGCTCTTTGATGCTTTTGTCCTTTT TTTCATCTACATTTTTCTCATTGTCATCGTTATGCTTGGGAAGTGTGTTT TTCTGGTATGCCGCTGGTTGCTGGAAGAAAGACGGCTTGAAACTTATGTC ACTGTTGAGGTCGTTAGCTTGGCCGTGTTTTACTGTGATAATATCGTTTT GTGGCATGACTTTGTTACTTCTCATCCTCTGTTAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001011XLOC_001011Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001962-exon-sc0000012-1575043694:987196..987370TCONS_00001962-exon-sc0000012-1575043694:987196..987370Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1575043694:979833..980281TCONS_00001962-exon-sc0000012-1575043694:979833..980281Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1575043694:950836..952352TCONS_00001962-exon-sc0000012-1575043694:950836..952352Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1510915933:987196..987370TCONS_00001962-exon-sc0000012-1510915933:987196..987370Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1510915933:979833..980281TCONS_00001962-exon-sc0000012-1510915933:979833..980281Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1510915933:950836..952352TCONS_00001962-exon-sc0000012-1510915933:950836..952352Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1491911889:987196..987370TCONS_00001962-exon-sc0000012-1491911889:987196..987370Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1491911889:979833..980281TCONS_00001962-exon-sc0000012-1491911889:979833..980281Clytia hemisphaericaexon
TCONS_00001962-exon-sc0000012-1491911889:950836..952352TCONS_00001962-exon-sc0000012-1491911889:950836..952352Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:950836..987370 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0.0201781 0 0.0444307 0 0.0948878 0.119687 0.198918 0.127796 0 0.046794 0.362928 0.0971581 0.0740856 0.141256 0 0.0216777 0.411819 0.359091 0.303083 2.55435e-08 0.457795 0.325806 0 0.393876 0.0446929 0.0245872 0 0.0397453
Blast
BLAST of TCONS_00001962 vs. Swiss-Prot (Human)
Match: ASIC1 (Acid-sensing ion channel 1 OS=Homo sapiens GN=ASIC1 PE=1 SV=3)

HSP 1 Score: 97.0561 bits (240), Expect = 5.818e-21
Identity = 117/459 (25.49%), Postives = 192/459 (41.83%), Query Frame = -2
Query:  683 FAESTSAHGYSPLASTKTI-LGSVVWIISMLAAYIVLILVIQPLITKYLDRPLLNKQTVVYEHRPKFPVVVFCNENPVVREKYV--------ELLTQLNETFE------------SIDPDKAMSHVADPSIY---------GHRINDSILRCDFRHVKGSCTPTSDNDANTNLGWGEYWQGRYGKCWFFNADVEN-PRRVTRAGHRG-GLHLHFNIEQEKYI-------DNTYSAGLRMFVGLQGEKFDVEEKAIPIAPGKKYDIALT-KKYIYRADPFNNGSCMRNQDKHMVEPDRKSDFHIDRMTHGFCSKLCANAAIRDECSCVAPSLPLEYRFKDVPFCP--QGDQCLDELLEKWFDGNMK-CDCNPPCEETLFSTSVYSQNYPQDIRRQ---REIAEGKPDPSKNLLTVSIFYEDKSFIKMEEEQFYTIVNLIADMXXXXXXXXXXXXLTVVEF 1921
            FA S++ HG + + S + + L   +W +  L +  VL+ V    +  Y     + K   V   +  FP V  CN N     +          ELL  LN  +E             I  DKA      P  +         GH I D +L C FR   G      D               RYGKC+ FN+  +  PR  T  G  G GL +  +I+Q++Y+       + ++ AG+++ +  Q E   +++    +APG +  +A   ++ IY   P+  G+C        V  D   DF  D  +   C   C    + + C+C    +P      D P+C   Q  +C D  L+   + + + C C  PC  T +   +     P     +   ++  + +    +N+L + IF+E  ++  +E+++ Y I  L+ D+GGQ+GLF G S LTV+E 
Sbjct:   21 FASSSTLHGLAHIFSYERLSLKRALWALCFLGSLAVLLCVCTERVQYYFHYHHVTKLDEVAASQLTFPAVTLCNLNEFRFSQVSKNDLYHAGELLALLNNRYEIPDTQMADEKQLEILQDKANFRSFKPKPFNMREFYDRAGHDIRDMLLSCHFR---GEVCSAEDFKVVFT---------RYGKCYTFNSGRDGRPRLKTMKGGTGNGLEIMLDIQQDEYLPVWGETDETSFEAGIKVQIHSQDEPPFIDQLGFGVAPGFQTFVACQEQRLIYLPPPW--GTC------KAVTMDSDLDF-FDSYSITACRIDCETRYLVENCNCRMVHMP-----GDAPYCTPEQYKECADPALDFLVEKDQEYCVCEMPCNLTRYGKELSMVKIPSKASAKYLAKKFNKSEQYIGENILVLDIFFEVLNYETIEQKKAYEIAGLLGDIGGQMGLFIGASILTVLEL 453          
The following BLAST results are available for this feature:
BLAST of TCONS_00001962 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
ASIC15.818e-2125.49Acid-sensing ion channel 1 OS=Homo sapiens GN=ASIC... [more]
back to top