Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000989 (gene) - C. hemisphaerica

Overview
NameXLOC_000989
Unique NameXLOC_000989
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000012:165313..177357-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000989 ID=XLOC_000989|Name=XLOC_000989|organism=Clytia hemisphaerica|type=gene|length=12045bp|location=Sequence derived from alignment at sc0000012:165313..177357- (Clytia hemisphaerica)
AAGTTCTGAATGAGATGCTCTATGATAAAATGAGATGAAATGAATGAGAG CTCTATTCATAATATCTACATTTCCATAGGACTTGAGATAATGAAGGTAC AAGCTTTTTTTACATGTTCTTATTTTCACCAAGTGTTTTTGTCCATTTTC CTAAGAAATTGGGTATTTTACAGTCCGCAAAGCCTTATGTTCTTATAAAG TTTGTTCATAAAAAAACGTATAAGATAAACCCAAACCGAAGATTAAAAAG TGAGGCTGAATTCTATATTTTCTATTGTTTAGAAATCAAGTACATCATGA TGTTGCAATTATTCATCGCAATTTATTTGGCATCGGGATGTTTTGCAGAC ATTCTAGGTAGGCTGTTTATTATAAAAACCCCTTCATAGGGATCAGTTTA AATGTTTTCAAATCACAGGGCGAGGAGAGAAATCAAGGAACCAAATGATA TGGAAGATTGTTAACCCTTTATAAGGGGGGTTTGTACTTTTCCGGTGTGG CGGGATTGGCCCTTTTTTAGTACGGTATTACGGGATTTGACGAAAAAAGA GACGGGAAAACGGTATTTCAAAATCAGACGGTGACGGTATTTAGGTACAT TTTCGCCCTGTACAAGCCGGTGTGACGGTGTTATTATTTTTTCAATTTTC GGGATTCCGGGATTCAGCAAANGTGTGACGGTGTTATTATTTTTCCAATT TTCGGGATTCCGGGATTCAGCAAAAATTTTGACGGGAAAACGGTATTTCG AACCCCTACAAACCCCCCCCCTCCTTTATATGCCATGGTCATTTTTTTCT AAGTTTTTTAAAGAAAATCACTAGTTAAAACTTTAAAGGCTTATATCTCG AGATCTAGAAGGAGTTAGAAGCTTGTTCATAGCTCGTTTGATAGCTTGGA GTCTCCTCTTTCTTTAAGGCACCTTTGAGGCCGCCCGATTTAGGAAGGGC GGGGTGGGCTGCGCGGACCTGTCTAAATGATAGAAAGATGCCCAATGGTA AAACTTTAAATTAATTCGCTGGAGGACAGAATCAAGTAAAACAGGGCTAA ATTTGGTGGTTCTTGGATCACTCGTTGANACAGAATCAAGTAAAACAGGG CCAAATTTGGTGGTTCTTGGATCACTCGTTGACCAAAAATGGTCAAAAAA CGGTCAAAATCTTAAAAGAGTGGATTTTTGTCAAATCTTTGCATTTTTTT GACTTTTTGGCTTAAAATCTCGCTGGAAAGGCTCCTGTTGATTTTTTTTA NATGATCAAAAAACGGTCAAAATCTTAAAAGAGTGGATTTTTGTCAAATC TTTGCATTTTTTTGACTTTTTGGCTTAAAATATCGCTGGAAAGGCTCCCT GTTGATTTTTTTTTTTGCTTCACCATGAAGCCCAATCCAATTCATACGAG TTAGACTAACAATGATGATTTCTAACTCAAACTGTGCATTACAGCCCATG TCTGATATATACGACATTGGCATTTAAAGGGTTGATTTGAAGGGAATCTC AAATTTGATTTCAGAACTTTATATGGTTGAAATAATTTTTCATGTTAGGA AATTTTTGAGTAATTTATGTGAATAAGGTCATTAGTAGGGGATCTTAACT TGACCTGTGGAGCTGCTGGTACTTAGAAATGGTGTCAGGAAAATTGCCCC CGAGAAAATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGGGCAGTTTTCCT AGGGGGCAATTTTCCGGGGGGCAATTTTCCGGGGGCAGTTTTCCGGGGGG CAATTTTCTCGGGGGCAATTTTCCTAGAACCCTTAGAAATATGTTAAAAT TAGCTCTAAATTCAACCTATATCTCCTTAAAAAATGTTTTTCAATAGTTA GTTTGAAAAATAATTGACTGGAAATTTACCAAATAGTAACTTTTTTTTAA TTATTTTCTCTCCTTTAAAGTTGAAATGATCTCAAATATTTTTCAGACTG TGGTAATGGTTCCAAACTAAGCCGTATTGGATGTTTTACAAAGAATGATA ATGCCCCTACCAAGTTCATAATGAGAAAGCCAGTCTATGGTGATGGATCA ATAAAGAGGTATTTTCTTTTTCTTCAAATAGTCATAGCTTAAAAGATCAG GTTGAAATGAAACCTTCCGGCGAGTTAAGGGATTCTTTACAGCCAATTTT CACTATTCTGCCTTTTAGCTCCGATAATCGCCAGGCTTAGCTTTGTCCTT AAATCTTATTTTTTTTGCATTTATGTATGAGCCTTTTAAAGTCTTGTTAT TATTATAAATTACAGTTTGGCTTGTGACTGTGCAGCAAAAGCAAAAGAAG GAGCACTAGTTCTAACCGACTACGAGGAATGTTTTGAAACTAAGGCTGCG GATCACGGGAGTCGTTATCCTGGTCAAACTTCATACGAGAAATGTATCAA CACAGTCTTTCATCATTGTGAAAAAGGTCAAAATTGTATTGGTACCACTG ATTCTGTTTATATTTATGCAAAAGTAGGTATGTATAAATTGCATTTAGCC TGAGATCAGGTTGTGATTTGTCTTCTGTTCATCACGCTAAAGCTCAAACT AAACGAATGGGTGAAAAAACGATCTGAAAAATATTCAATCTCGATTTACT TTTAAACCTATAAGATTTTGCTATTTCAAGGCGAAAACAAGCTCTCTGAT TAAACTCCCAAAAAGGGCCCCCCCCCCCAAAAAAAAGTTCTTGTTGAATT TAATTCGCCATAACATTATAACAAATCAAAGGTTTTAGTTTACTGAAAAG ACACAATTAGTAATAAGAGATTTGAACCATACAACGCTCTGTTTTGTTTT CACTCAGTTATACCAGGTGAATCATTTTGACATTATGCCATGGCAAGGGA TACTCAGTAGTATAAAGAACATTCCCTACAATTTTAGATTTATTGAAATT AAAAATGATTTGAAAGAATTTGCAATAAAGTCAAAATTGGCCCAACCGTT CCCTTAAAAGTTCAGTGTTTGGCGACTATATTGTCTTTATCAAATTAAAC TATTCTTAACAATCTTTTAAAATCAATTTTAGTTGATGGAAAATGGAGTA CATGGTCCGCTGTCGGAGCATGTAATCGAAAATGTGGTCCAGGGCGCCGA CGATTCACAAGAAAATGTAATAACCCAAAGCCTGCTTTTGGTGGAAAATC ATGCGAAGGACCGAAAATCAAATTCGAGTCCTGCAACAATGGAGCGTGTC CGGTTAATGGAAAATGGAGTACATGGTCATCTTTCGGAGCATGTAATCGA AGATGTGGTCCAGGGCGCCGACGAGCAACAAGAAATTGCAATAACCCAAA GCCTGCTTTTGGCGGAAAATCATGCATAGGACCGAAAATCAAATTCGAGT CCTGCAACAATGGAGCGTGTATTCCAGGTATTCTTTTTAAATCACGGTGT AAATCACTTTTGATTGAGTGTATTTTATTGTAGGAGATGTATATATATGA CCCTGTCTCGCAGCTCCAATGAAACTTTTTCCCGTAGCGGGGATGAGAAG TTCTATCGAAATCCAAATGAATTCAATGAGGATAGTAATTCTATTGCTCT AAGGTGAAAAGATCCAGTGGTGATGGTTTTGGAGTGCAATTTTTTCCGTT CAATAATAAATAGGGATGAAAACAAAGTCCATTTCTCAGTGGGGTTGAAA TTTTTGGGGTATTTTTCCCACGGGGGACGAAATTTCGGTCAAATCTTCCA ATGAGTTGGGGGTCCCACCAGGTCTGTGACACAGGAGTGTATATTGCCTA AATTGTTTTTAAAATACTTTGTATCAAACCTAAACATTGGCCAAAATTAT CTAATTGCCCCGCAGGGGCTTTTGTTGATTCTCGCAGTGGGCTTGTTTGC CAGAAAAATATTCATGTTCATGTTCATGATGTTGTTTCTTTCGATTCTGA GCGGGCCGCCGCGGTTAAAGAATGCTCGCGCGCACCTATCATTTTATCTA TTTTGTTGCGACTTGTATTAATTCTCACGTTTTAGTTCTTACAACGTAAA CAATGGATGGCGCATAACATGAGCATTTTTCTTTTTCTTATAAGCATCTA CTTTATAAGCATCAAATCAATAACTCTTGATAGACGGTGATATACCCTTC GTGAATTAGTTCTTACAAAGTAAACAAGGGACGGCGCATAATATGAACAT ATTTATTTTTCTTATGATTTTTCTTATAAGCACCTACTTTAAAAGAATCA AATCAATAACTCTTGATAAAGAGCCATACATTTTTCGGTAATTAGCTCTT ACAAAGTAAACAAGGGACAGTGCACAATATGAGCCTGTTTATTGTTCTTA TAAGCATCTAGTTTATAAGATTCAGATCAATAACTCTTGATCAACAGCTT TATACCTTTTGGCATAGTTCTTATAAAGTAAACCAGGGACAGTGCACAAT GAGAGCATTTTTATTTGTCTTATAAGCACCTACTTCATAAGAATCAAATC AATAACTTTTGATAAACAGCCATATATCTTTCGGTACAGCGAATAGAAAT TTGTAGCTGTGCGCTTATTGGATGGCGCTCCAATAAAACGATCTGTTGGA ATGCGGCCTTCAAACGTTCATTCTCGATTATGAATGCGTTCGCGGGGCAT TCATAGCGACAGCTACTTGCCCGGGGGGTACTACCCTTGTCGACCGACGG GGGTGCTCCGCTGAGGTTCGAAAAATGGACCCTACGTGGGACTCGAAATT TGCGAAAAAAGTGACCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCAATAAAACGA TCTGGTGGAATGCGGCCTTCAAACGTTCATTCTCGATTATGAATGCGTTC GCGGGGCATTCATAGCGACAGCTACTTGCTAGTAAATATCAATGAAATAA GTAGTAGTTATCCTATATTGTACGAGTAAAAGTGTGATAACTGGTTTATC GTCAACTTGAAAAATATTAACAAACTTTTCTCTCTCCATTTTATTTGTCT TCTCTCTCTTCTTTGTTTTGTTTTTTCACAAATCAACATCAAAACATTAA CATCTTCGAAAATGATTCGAATGCTCATTAAAATATTAAAATATAAATAA TTTTTGTGAGTATTGAGAGGAAAAAAGAAAACATTCCTGAGAATAACTTT CGGGATAAGATACAAAAATAAATCCAAATATGATCTCTCGCTTACCAGAC CCCTTTTTGAACGCGGTCTTGTATGTGTACGGTACAATAAGCAGATATTC AATAGGTAAAAATTGGTTATTGAGATCCCGGGGGGGGTACTACCCTTGTC GACCGACGGGGGTGCTCCGCTGAGGTTCGAAAAATGGACCCTACGTGGGA CTCGAAATTTGCGAAAAAGGTGACCCTGNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGCAATCCCTTATTCTCA AATAAAAATATTGCTTCATACTGTTTTTACCTTCCAAAAACAACAAAAAT CTGGCGGACTGTTTTACAGTCCGCCAAAGCAAAAACATATTACCATATAC TACTGGGCCACTTAATCGCGCCATCCAGTCTATCAAAAAGCTTTAAGTGG ACCCCGGGCTAGAGGTCGATGTAATGTTCAACGAGGCGAAGCCGAGTTGA ATATATATCACCGAGGGTTAATAAATCCAATAGCCAACGAAAACCTATCG AATATATGTTTTATTATATACCTAGAGGCAAAAACAAAACTGAAATTATG TAAATAGTCAAACGATTCACATAAAACACTCCCATAATAGAACGGTCGAA TGTTTTTCTTTTTTAATGATTTTCTTAATTAAAAGAATCTAACTTTGAAA GCAAAATTTGAAGAAAAAAAAATTCTACCGTGGTATAATAGCCATGGTGT ATCAGGAATTATTCAATGGCTGTTTTTGCCTACTTGTATATAATAATATA GAATACAGCATTTATATATGCGTTTTTATATCTCAAGCAGACGACGACAT TGAGAGAAGTTACCAAAATCTGATTAAAACTGAAGTCTGTCTCAATATAG TTTGCAGAGGAGACAAAAAAGGCTGTAACTTTTGATAGAATTCGAATTAG AAAACAGTTTTGTGCTCGTTTGAAAGATAATCCAGAGTGGAATATTTGCA AAAAAGAAAAATCTTTAAAAAAATGGAAAAAAGAAGATGAAAAAAGAAGA AGAATAAAATCAACTTCTTATAGATTAATGCTGTGATCTTCATTTTTATA TCAGAGGTTCTTTAATCTTAGAACGTCATAAATGGGAAAGAAATCAAAGA ATATTTGTTTAGTAAAAAAATACAACTTAAAACTTTGCTTTGGTCGACTT TTTTGTTGTTTTTAGGTGGTTTTCGAAAAGTTAAGATCAATCCATCTTTG ATCTAGTCTAGCTTGAAAAGCTTGTAATAAGTTAAACAAGATAGGGCACT CTAATTTGTTTAACGCTCTCAAACTTCAAACTTTTAGAAGTCTTGTCGAG CCCATTCTTCTTTATGGCTCAGAGACTTGGACTATGACAAAAACTATGCT GAAGAGCCTGATGGCTGTTATACAAACCTTTTGCAAAGAATACAGAATCT TGATTGGCGCAACCACCCAACCCTTCACGAGATCTATCATGGACTCTTTC TCAGGTCAATGTTTCCGTGCACCAAATGAAATCGTATCTGAAATCCTACT TCGGTGTCCTGCTGGCCCTAGGCGCTCGAAAAAGCACACACTTCTTGATA TTTCAGGGCCGGCGAAACTGGGGGGCCGGGGGGCCATGCCCCCCCCCACT TTTTTGCTAAGAAAGGCCCAACCATGGTGGCGCCTCCTTAGACACTTACT ATTTGGCCCCTCCACTTTCAAAATTGATTCGCCGGCCCTGTATTTTGAAA CGAAAAACAGGAATAGAGATTGAGGAACTGAGTACTGCAATGGCTGATCG CAAACTGTGGATTGAGGGTTATTCTTTGTTTCCGACCTAGGTGATGATAA TGAGGATGCGTTTTTAGCCAATCAGATTTCTCATATTTCTCATGTTGACG ATAAAGGAAGGAAATTCCAAACGTTGTATATTTATCTTTGTCTTTTGATG TTTTTTTAAACTTATTACCCCTGTCTTTGTGCCTTACCAAGAACCCAGAT TGTTTTCAAAATAAAAATAATATACCACCTTTCTTTCTTTTTAGATTTAA GAAACCAAGGACAAAATTGTTGGAAAAAACCTACCTATTTCTGTGGTAAA AAAGGTCTTTGCAGTCGAAAAGGATGGGGTCGATGGCAAGACGCTGCATT CCCCTGCGTTAATAGGCACTGTTGTACTGAGCCAGCTCTTGTTAAGAACC TAGGTAAGATTAATTTTTCATTGACCTTAAAACTATTAGGAGTTTTAAGA ATTTTGCAGCAATTTAGATAATCCCTTCATTTAAACTCAGGGAATATAAT AGCTAGCCAGTGGATACAAGACATCAAATTTGGTTGGAACAAAGTAATTT TATAAAACGTTGAAGTTACCTGCAACAAAAACAATATGCTATCCAAAAGA GGGTCCCATTAACTTGCATGAGAAATGAGGCGCTAAAATTCTGCATCTTT ATACTACAGTTCTGTAGTTTCATAACACAATTATATTTAAGGCTCAAATT GCTGGTGGAAGTGTGGTAANTCTTTGTTTCCGACCTAGGTGATGATAATG AGGATGCGTTTTTAGCCAATCAGATTTCTCATATTTCTCATGTTGACGAT AAAGGAAGGAAATTCCAAACGTTGTATATTTATCTTTGTCTTTTGATGTT TTTTTAAACTTATTACCCCTGTCTTTGTGCCTTACCAAGAACCCAGATTG TTTTCAAAATAAAAATAATATACCACCTTTCTTTCTTTTTAGATTTAAGA AACCAAGGACAAAATTGTTGGAAAAAACCTACCTATTTCTGTGGTAAAAA AGGTCTTTGCAGTCGAAAAGGATGGGGTCGATGGCAAGACGCTGCATTCC CCTGCGTTAATAGGCACTGTTGTACTGAGCCAGCTCTTGTTAAGAACCTA GGTAAGATTAATTTTTCATTGACCTTAAAACTATTAGGAGTTTTAAGAAT TTTGCAGAAATTTAGATATTCCCTTCATTTAAACTCAGGGAATATAATAG CTAGCCAGTGGATACAAGACGTCGAATTTGGTGTTGGAACAAAGTAATTT TATAAAACGTTGAAGTTACCTGCAACAAAAACAATATGCTATCCAAAAGA GGGTCCCGTTAACTTGCATGAGAAATGAGGCGCCAAAATTCTGCATCTTT ATACTACAGTTCTGTATTTTCATAACAAAATTATATTTAAGGCTCAAATT GCTGGTCGAAGTGTGGTAGAAAGGGTGGTTACTGTCCTGGATTTTGTGGC GTGAACGGGCGTTGTTGTCGAAGAGGATGGAATGATGCTGGGTGCGCAGG AATGGCCACACCGTGCAATGGGAAGCATTGTTGTACAACTAAAAGACGAG ATGTCCAAAATAGCGGTTGGTTCATATTTACACCAATCTTTGTACAGGGT GTCCCGAAAAAAAGTTACGTGTTCGAATATGATTCTGAGTAGTAGGTTGT TGCGTGTGTTTAACAAAATGTAAGAAAATGTATACCACCACAATAATTGT TTTTACAACAGTCATCATTATGATAAAAAAGAATTAACTTTCTTTACAAT TTTCATGACGTTAAAGTTATTGAGAATTGTTTTTTGTAAAAGTTATTCAT AAAAGATGTCTCGTGACAATTAATATGACACAGAGAAAAACTTTGATAAA AATAGCAAATTTAGTTAAACACACACAAGAACTTTCTTNNAAAAGAGGGA GAGCTTAAAATACAATTTTGTGAACACGCACATAAAACTTTCTACTCATA GTTGTGTTTCGACTCGATACTTTAATTAGGGACACCCTGTATAGAAGTGG TACGTCTCGATACTTTTTTCGGGACACCCTGTAGAAGTGGTTCGACTCGA TACTAACTTTTTTTCGGGATGCCCTGTAGAAGATTTTGACTTTTTGTCTT TGAAACTTTCGGTGTAGATTTAGCATAATACAGTTGGCACTCTCTAACTT GAATTTCAAGGGAAATTTTATTTTCATAAAGTAGGGAGCCTATTGAATAG TAAAAGAGTATCGTTTTTAATAGTTTCTTTTCGGCGGTGACTTTAAATTA TGGAATAGTAGAACATCGAATTAGAGAGCGTCAAATGTATTCCTGAAAAA GTGGTTCTAAAAAAGCTCTTAATAACTTAAAGAATATTTAGAACCAGAAA TTCGAATTCATTTTCCCATTCCAACCAACCAATGTTCTTTCAACGTTCAT CTAACGTTATATGTTTTACTCTGTTTTCTCATACAGGTAAAAATTGCTGG TGGAAATGTAACAAGAAAGATGGGGAATGTTCGACAGGTTTTTGCGGTAA AGACGGAGTTTGTTGTCGACGTGGTTGGGATACTTACAGATGTATCCGGA CTACTGGTGCATGCAGATACAAACATTGCTGTGTCGGTACAGCGGCTATG GGAATCCAAAAACCTTGAGCCGTCTTTTGATCGAGTCTCTGGAATTGGAT TACAAATGGTTACTTAAAGAAAATGATTACGTTGTGAAAACGTATCATTT CTAAATTATAATAAACATCATTTTTAGATTTTGTAGCAGTATTTAAACAG TATATGAAAGTAGATTTTTGTAGTTCTTATGGAAGTTGTACGTGCATTAT CGTTTAAGAACTAATAATATAAAGATTGAAATAATATTTATTTCTTTTTT AACACTATAACTTTCGTATATAGAATAAATAGATACTGAGAAAAT
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001919TCONS_00001919Clytia hemisphaericatranscript
TCONS_00001918TCONS_00001918Clytia hemisphaericatranscript
TCONS_00001917TCONS_00001917Clytia hemisphaericatranscript
TCONS_00001916TCONS_00001916Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001916-proteinTCONS_00001916-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:165313..177357 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.01 0.89 0.7 0.88 0.14 0.15 42.49 49.59 235.37 103.35 321.52 333.68 18.07 10.8 77.66 79.72 0.99 0.98 0.9 0 0.41 0.55 0.59 0.46 0.28 0.23 0.2 0.1 0.21 0.16