Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000868 (gene) - C. hemisphaerica

Overview
NameXLOC_000868
Unique NameXLOC_000868
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000011:416724..497466-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000868 ID=XLOC_000868|Name=XLOC_000868|organism=Clytia hemisphaerica|type=gene|length=80743bp|location=Sequence derived from alignment at sc0000011:416724..497466- (Clytia hemisphaerica)
CCTTAAAACAACCTACCAAACAACCACACAAAATGCTTGCTTCGTTATTC AACAAGACACATCTACGAAAATACTCCATGGAATCCAAAACAGAACACCA CCACCAGCGTCCGTTCAAAAACATACCGCCCTTGGAAAGAGTGAAAAGTT TCCCGCCCCTGGATTACAATTCGAACGTGCATTCTATCTTGAACAATAAG ATGATCAGTGATTGGCTGTTAATAACAATAGAAGATAAAGGAACTAGCTT TGAACACGATGAGGTACTNTCAGTGATTGGCTGTTGATAACAATAGAAGA TAAAGGAACTAGCTTTGAACACGATGAGGTACTCAATTTTAATCTTCAAC TTTAGGTTGCTTGTTTAATTTGAAAAAGCAGTCGACGCTCTCTATTTCTA AGTTCTGCTACTCTCTAATTCGATGCTCTGCTTTTAGATACGCTGTATTA TTTGATAGTATTGAAATGTCAGCGTCAACAAGAAGATCTCGTAAACGAAG CTCTACTATTTGATACACTCCCTTATTAGATCCCTGTGTCACAGACCCGC TGGAACCCCAGCCCCACCTAATTTTGTCCACGGGGGGGGGGGGGAAAANT CCCTTATTGGACCCCTGTGTCACAGACCCGCTGGAACCCCCACTGAGAAA TTTGGCCAAAATTTTGTCCACGGTGGGAAGAATATCCCACATTTTCATCC CTACTGGGGAAAGTGACTTTTGGTTTCATCCCCTTCCAAAATTCAATGTA AAAATTGCATTCCAAAAACATCCCCCAATGGATTTTTCGACTTAGGAACA GTATAATTTTTATCCTCATTGGGATTTCGATAGAAAATTTCATCCCCGCT GTGGGGAAAAGTTTCACCGGGGCTGTGAGGCAGGGGTGTCTTATTTGAAA GTCCGATTTCCCTTTCAAGTTGAATGAGGTAACGTCAACTGTATTCTCAG ATTGACCAAAAGCCGTACAAATGTAGTTATTTGCTTGTCCTTCTTTATGG TTTTTGTGTGAATTTCATAGTTCCCTTTGTGGTATGCTTTCTGACAACAC CCAATGATATAATCTACATAACATGGACCTGAAGCTTCTTTTTTATTGAA TTCTCTACCAAGAAAGTCATGTGACACGGTGAGACTTGCTAATTCGAAAG ATGTTTTCCGCTTTTCAAACCATAAATGTAGTTATTTGCTTGTCCTTCTT TATGGTTTTTTCAATCCATTGGCACCAAATTGACGCCAATTCGAATTCCT TTTTTTCGTTGGGGAAAACTATAAAGTTTTGAATTTAGCACATCTAGTGT TTCGGGTTTTACCATGTAGATATCAGCATATCTTACCAAAGATTTTACCA GGAAGTTGAGTACACCACTGTCTCGCTGACCCGGTGGTGTTTCAAAACCC ACCGGGCTGACTGTGACAGTAGTAAAATTTCACCGGGTCTGGTTTTGGGG CTTCAAAATCTCACTAGGGTGAGAATTTTCACCTCGACTGCTTCCCTCAG AAAAATTTTAACTGGGTTGACCTTCATAATGTAATTAATGACCATTGTAT AAACATGAATTTCTAAATTCTACCGAGGGTGTAAAATCTCGATTAATTTT GACCCGGTTACTCATCAATATCTCATTGGGGCTCAAAAATTGTTTTTTCA TTGGGCGCCCCACCGGGGTGGATCCGACCGGGTCACTGACACAGTAATGT TTGAGTGGGATATGGTTAATTGGAATGAATTTCCATTCTAAGTGCTTGCG TAGCTGTCGTGTGCTGCTGATCTCATAGTGGGGTTGGTACATCAATGTGA TGTCATCAAACTTACTCACATTTTTATGAAGTGGTTGTGATATTCTTATA ATGTGATCAATCAATCAATCAAAATCTCCCTTCTTCACTACTCCGCCTCT GTTAAAAACAACAGATCAATATCAAACAGTGTTTTGGTTAATCGCCTTTA AAAATTATCATACACGTCGTGATGTGATCTGACTCTCTTAAACCTTAACT GAGCTTTTTATCATATGCGGTTAAATTTTTCTATAAGCATATTCAACTAG CATATAAATCAATCGGGCATGATGTTTTAGAAACGTCATACTCTCAGAAT CTAAACTTCCATTTATAGAACATATTCAATAGTCCATCACTATTTACTTA GATTTCAATCAGGTTGTAGATAAAACTTCAGTATTTACGAATGAATTTTG ATTGGAAAACTTTCACATTCTTACAAGGTTTTAACAGGATATTTTAAGAA AAACAATTTATAGATGTGTTCAATCTATAAAAAATAATAGTGTTAAACAA TTATAGACAAACTTCTAAATCCAATACAATCGTCAGGAATAAAAAAATGA TAGAGCAAAGAATCCTATTGGGAAAAAGTTTTTAAATATTTCTCCAGTTG TTGTATACATGCATCGTTAAATTCTTGCTGCAAGCTTCAACATGACCAGG ATTAGAAAGTATTTCAAAGTCAAAATACCAACAATGAAAGTGAATTTGTT TAATGAAGACAATTACATTCAAATGGGTGGATTGGGTCATAGTAGAAGTA GAAAATATTCTAGAAGATTGAATCGTTGGAAAGATAATTTGATGGAGTAT TCTATTCCTTGTTGTTCATGTTGCTTTACTTTGAACGGTGTTTTCAGGAG GCGAAAGTTGAACATTTTTGGATATGTGTATAATAAATCTTTGCGGTCGA ATTTGGTAAGTTTTTACATTGCAACATAACTTTGATTTTGATTGTTTTAT AAAAAATCTGATATGTTTTTGGTGACCATAGTGCAGTGGTAGAGCATCCG GCTACGATGGGCAAGGTTGTGGGTTCGATCCTCAGCCGGGTCATACCAAA AATTCCCAAAATTGTGCTTGGTGCGCCTCTTTGCTTGATGCTCAGCAACT AAAGAGACGGATCAAGGGTAAGTGGAGAAATCCAGGGAAAGGCGTGGTGC CCTCCCCTACCTTCAGTTAGACAGCTAGAAAAAAAAGAAGCTTTCAAGTC GCCCTCGACTGCGGTCGCAAACTTACTTACTTTGAAAATAAGCCTTTCTG GTAACGGTCTATTTCAAAGTTATTGAAAACTTTAACGTTTTTTACTTGCA CGGACCGGAGACTCATTCATTGCTCTCTTTTATAGATATCGGATAAAATT TTAAAATTTATTGGTTGTACAATACTTTACGACTAAAGGTTCATAATTTA TTGTCCTAATAGTTCAAACAGTGACCAGAAATAATTATTCACACTAGTTC TGGGCTCTGAATGGCCATGTGCTGTTTAAACACATTACACGATAATTATA GTCTCTGGAAATGTCGCAAGGCAACTTGACCCGTATCTTTTTGATTTGAT GTAATTATATTACATGCCTTATACAACCATCAAAAAAATATTTCTATTTT ATCAATTTGTTTTTATTTTTTCTTTCGATTGATATTGTTTTTAATCCGTG AAAATGCACCATCAGGAGTTAATACGGGCTTACTGTGAGATAAGAATCTC AAATTATTGAGTCTGTTATATCACAGAATCCAAATTATCTTGAAACTTTC GCCGTGGTAGAGTTTTTAATCTTACTTTTAAAGCTTTTTCTATTTCTTTC ATAAAACGCTCCATCTCAAGCAATTATCAAGGCTCAGTACAGTGTTCACT CACTGGCCCACTTTATTACACAAGGCTTCTCAAATTGCATCCAATTTAAC ATAAAACACAAAACGGGGAAATATTATTGTCTTGAAAACTCATTTATGTC AAATATTTGAGAGTAATGGCCATGTTTATCAGAAAAGTTGCTCAAACTAT AAAGTGAATGTTTCGCTTTTGTCAGTCTTGACTAAATTTTGAGAGAGGAA ATGAGGAATTTTTTGACCGTTGAAAAACATTCATTCTTACCAATGGTCTT ATACATAGTAAGTTTCTTTTTTCCGTTTTGAGTTTTTGATATTTTTATAC TTTTTGTACTCTTCTAACTTTGGTTTTTGTGGTTTTCTGAGTTTGTCGGG AATTCAGGTGAAGAAAAATAGGCAAAACATAAGTATATGTCATGCGCCGC AGCCTTATAGGTGCTTTTTTAACATCTTCATAATCCAACTGAAGGTCTCA AAAATTAAGCTGGATACAGAACTGAACTGTACTCCAAATTTTCTCTAAAT CTCCAATGGGCAAAGACTCTCACAATGAGAGTGACGCCCCCAAACAACCT CAACAACAACTGAAGGTCTCAAAAATATGTTGTGACATAATTCATTTGTA GACAATCCCCTGAGGACCGTTTTAGTTTCTAGGTAGTAAGTATATTCATC TAGTAGCTATCTAGGGAGTCTATCCCCTTTCTATTTGCGCTAAACCTGGG AGGTTGAATGTTGTGGTGTCGAGTGGTACCCATCCGCATCAAGCAAAACC CATTACCCCCAGATTTGAAATTTCATCACCAAAGCGATGGTAGAATGAAT GAAAACAATAGAAACTACGATTTCCAGTATAATTTATGCCAAGTCAAAAA GCTAGTTGTACCGAAATCTAAATCCAAAATTGTGATCAGATAGTCTTCCG ATCAACTATGGGAATCGTCCGTAATTTGGGAAAGACTTCATATTTCAATT TTTATTTCAAACATTGTGTGTTTGTCTATTTTCTGTAGTTTTTTTTGGTC AGAATACAATCTAGTGCTATCAATCATGACAAAATATCAAATGTTTTTCA AATCTTACCACAAAAAATTTAACTTTGATTTCTCCTTTTGTATCTGTTTG GACTCTCTCAGAATGTTTCATAAAGGAGTTTCTTTTTCACCTTTGTGACC TTATTTCCAGAATATTTGCCTGTTCTTTGGATGATATTGGTGTGAAAACT AGACTGGAATTAAGTGACTGTCATATATTTTCAGTAAGTAGCCTGTTGGC TGTTGGTCGAAAAGCTGAAGTAATTATACAAGAAGGACGTCACTGAAAAC TTTTTTATGCTTTGACGAAATGAAGAAGAAATTATTACAGAATTTTTTGA GAAGGCTTGTAAGAATTGTCTTCGGTGGGAGGTTTTGTGGTGCTCAGAAA AACACTGAAGATGCATTTTCGTCAGGACTAAAGGTATTATGTGCAAAATT ATTTTCACGATATTTTTTTCGACTTTTCAGCAAGTAGCCATCGAGGAAAT GGCATATATTTGTAAAGCCCGAAGGGCTAGATATCGTGCTTTTGCGGAAA AGTGTGCCGAGGTTAGATAGGAAATCCTACCTAAGTCACGTGACATTACA ATATAATTTCAACGCTTGACATATCAGAAGCTTCGCGAGTTTTCGAAAAC AGTAGCAGCAATATTTTTTTTGCGATATTCACTGTTCTTTTGCTTGGGAG AGCTTAAACACTCCATCTAGCCCTCCGGGCCTAATAAATCTATGGGAAAA GGTCGTGTCTTAGACGAACATTAAAAATGTTGAGTTACTCCTAAATGCCG GTGTACACACGAAGATTATCTTTCCTATGCAACATTTTTAACTTTTTGAC TTTTATTTGAATATAAAAGTGAGCACCAGCCTGAAAATAGTCATTTTGTC TTGTTTCATAGCAGCCGACAGCTGAATCCAACAGTTATGTAAGCAAAAGG TTCTTACTTCACAAGGTATAATGACCAGAAAAAAACTATTAGACTAATCT CTTCATTGTCATCTAATTTGCTCATTAGCAGTCTAATTTGTGGACGTTAT TTTAATGTTCCAAACACTAAATCATCCTCTAACTGCTCTTAATTGGCCGC AAAGTTCTGCTCGTAAAAGCAACTTATAAGAGCTAAATTGGTGAATTGAT CCAAATCTGATGGGGGTATGTAGGGCGGGTAGGGTTTTATTTACGCCCAT ATCAGTAGGGGCGGGAGAATCTTATGTAGATTTTACTTTAAAACTATTGA ACAGAATTTCATAGATATTCAATTTGAAAAACTCGAAATCATTAATCAAG TTTACTTGGCTTCATTAAGTCGTATACAAAGGCAACAGTTTTAATGACCC CATTAAAACAATAACCTTCCTTTATGATTTTCAGTGGCTGTGTGGCAACG TTTGATTATAGAGGTCATTAGTATTTCCTTAAGCATCTTTTAAATCCTCC ACTAATGTTTGCTAATGTTGCAATCAATGTTATTTTGATCATGAACTTTG AAGAGTTTTCTGGCGATCGATAAACTTAGTACGTGTGGTTTCATATTTTT ATCTTGTAGAGTTAGTGATCAGACTCATTTGATTAATGAAATGCTAGTTT ATTTTTGCACTTGTAAAACGATATCAGTGAGTATTTTGAAATTTTTAGCT TCATAGACCAACCCTTATTGTCTCAGTGACCCGATGAAGTTTTCAGATCT ACCAAGATCTCAAAAACTCACTGGATGAGAGCATTTAACCCGATTTTTGA CCGGCTTAGGAAAGAAGAATCGCGTTCAAGCATTATTCCTAGAACTCCTC AAAATCGTTTTTTTTTTCTATTGACCGGGATTAAGTCATAGTAGCGATTA GTGATCGGGGTAAGACCATAAATTCCCAGTTTTTATCGCGGTAGAGAAAT ACAATTAATTTTGATCGGGTTTACTCATTATCGGGTCATTATCACACCGG GCCATTTTTTGACAATTTGGAGGAGGGGAGGGGAGGATCTGACCGAATCA CTGATACAGGGGTACCATAGTCGAACAGTTGCTGTTTTGTTGTGAGAATA TCTCTGACATTCCCGTGTAAAAATCACAAAACATGTGGAATCAAAAGAAA CTGTCTTCATCGTGTTTATTTGGATTTTTTGCTCGATTTTTTTGGATTCT GGCTCAGCTTGACTGTGCATGATTTGTAAATTTTCTTTAACTGCAATAAA TGCAGTAAATGATGTGCGAGCAAGCGCAAAATAAGTATTTTATGTATTTT AAGGCTACATGCGAACAATATTCTTTAGTGTTCTGGCATAAATGTAAATG CCTCGCAGTTTACAATAGTTTCTGCAAGTTTACTTGATTGTTGTTGTAAT CACAGCAGGAATTCCGTTTCTCGGACAGATTAATTGGTCGGGGGGATTTT CTTCATGATTATTTACCAATTAATCTTGTCTCGGTTGGAAATGCTGTGAA GATTTGGATAGACAATAAACTCCGCACATTACTTTTTTCTGCAGACAGAC CCGATATATCCACGGAAGTTTCGAAATTCATACTTACGTTATGTTATTCC TGAGATGGTACTAATATATATTTTTCCGCCCGCGTTTACTATCCATTTAA GGCCATTTAACGGACGAGAGCATGCTTTAGAGAAATATGACTGTCCTTTA CTAAGAGCAATTCACGAGATTTAGTTTAAGATTGAACCTGGGTTAACAAC TGTGATTCAGCATTTTGTATTTCCATGGCATTCCTTTTACTTTTTATAAG AAAAGTGTACCGAACATGAATTGAAGAAGAAATTAGGAGCTAGAAGAATT GGAAAGGTCAAAGTTTAAAAAAGAAAACTTTTAAAGTAATTTTTGAAAAA AAAGTTTGGACAGTAATTTAATAATATAGACAAAAAGAGAAAAAGAAAGA AAGGAAGAACGATAAAAATCGATATCAAGCGAGCACAAATCTAATTTCAG TTTCTTAAAAAAAATTCATTTGAATATAACTAACCACCCTGCTGGGGGTA ACGTAACCATCCCAATCGTGAATATCAAATGAACTGTTTCACCTAGAATC ACTCATGTCGATTCTTTTAGTCTGGACAATTAAACATGTTTACAATAAGT TTGACACAAGTAATATGAGATTGAAATTTCATATTAAGATTCTTTTTTTG TGAAAATGAACAATCTTTGGAAAATTTTTAAACTCAAAGATTTTTTGAAT ATTTGTACTGAAATTTGCTAATGGCCTTTTTGGGATGGTTAACTCTACCA ACCGGACTGAAAGTGAGTAATTTTATATCATGACAGTGAGACCGAGGGGT TTTTTCATTTGAAGTTCTTATAAAAAATTATTCCGTCACGGTATTTATAA TAAGCTCGTTAGATCTACAGTGAGATGCATCCGTGGATCGAGAGGTAGAG TACGACTCCCTCAAGATGAAGTTTAAGTTTTTATTTTTCCTTTCTTATAC ATAATCCATAATTCTAGTAGAATTTTATTTAAATCCAAAAGATCCATGCC GGGACAGGCTCCGGTATATAGTATATTTTATATTTTTCAATACCGACTTG TATTTAATTTCTCTAGTATATTACGTTCCGATAAATGGAAAGATATAGCC TAAAACTTAAAAAAAAAAATGTAACATGACATACTTTGGAAAAAAAAATT TATAATAAGCTCTTACTGTGGGAACATTGCCAGAAAGAAAATAACAAGAA AAAGAGTTTAAAGCTTTTGTTATTTCCGCGTGTGATTTTAAACTGCCGTG ATTTGCTTTGATTATTACCAAGTGAATTTAATTTATGATTGATTTTTGAT TTTTCTACACGGCAAGTTTTTTGTCAAAAAAAAGTGTCAAGATATTAAGA CTTAAAAAAAAAGGTATACAATTCATTTTTGTTCTTTGTTTGAAAGATTG GAAACTGTTGATTATTGATGATGAAATTTAAACTCTTTAATATTGACCTT CATTTCTTTTCATCAAAACCTTCTTTACCTTTTATTTTCAATAAAGTCTC TAAATTTTTACAATTTTTGATTAACATGTCTGATGTTAGCGGTATGTAAT ATGAAATTTTAAGGAGGGGGACGAGTGGTGAGAGAATTGGAAAACATGGT ATGGAAGCGTTCTGATCTGTACTCACTTATTGAGGTATTTCATTTTTTTT TTCATTTTTATCATTATAGTGTGTTCTGAAAATGTTTGACAGTTCGTGCT TAATAACATTGCTCTTAAGGGAAAAATATAATTAAAAGTAATATTTCGTT GGAAAGATAATTTTTGTACTAGTGTAATAATTTTTTAAACATTTGAACAT GAAAGGAAGCATTTTTACAAACGTTCTTCCTTGAAGAGTTCAATCCAAGT TTGGATTATAGAAAGATTCGGATAATAGAAGTTCGAATTAATGAGAGTCC AATGTATAACTTTAAGAGGCTGATTTCAAATATATATTCTGATTCATATC TCTTTTCCAATTGTCTTTGCAATGGGTTTATTCGACGTTTTTATCAATTC ATCACCAATTGAAACTTTTTTGTCGGAGGACTATGACTTTTGAAAATTGT AGACCTTAGTATTCATGATATGCACCACTGGAGAGCCCTCCAAGAATTTT CAAAAATTTCCACCGAATACGTCACACTTCTTCTATTTTTTAAGTGACGT ATTATGCTATTCTCATATGATTTGAGAGTTGAGTGTTTGTGGACGAAGCG AACACGTTTCTTTCCTCTCGATGATGTCCGTTCATTTTGAGATTTGACCG TAATTTCTCTCCACGGTCTTATACATAATGAAACGCAATTGTTGATCCAA TCAGAAACGAGCAAGGTATTAAAATTTCCTTAACTAATATATCTACAAAA CTGTTCAAATCAGCGACAATGAAGTGTCAGGTCCGTTGAAAGTGATGTAT CATCAAACGTCCCCATATGCATCCAAATTTAATAACTTATATACCACTAA ATGACGGTTATTGTGGTAGACCTAACCTAATTTGCATTGTTAATTATCTT AAGCCTAATCAGGTTTCGGTACCAAATGATTAGGTTTTAATGGTTCACTT TAATCGTTTTTGCCCTGGTTACGACGTTGAAATTGATGTATCGCCAAACG TCCCCATATGCATCCAAATTTAATAACTTATATACCACTAAATGACGGTT ATTGTGGTAGACCTAACCTAATTTGCATTGTTAATTATTTTAAGCCTAAT CAGGTTTCGGTACCAAATAATTAGGTTTTAATGGTTCACTTTAATCGTTT TTGCCCTGGTTACGACGTTGAAATTGATGTATCGCCAAACGTCCCCATAT GCATTCAAATTTAATAACTTATATACCACTAAATGACGGTTATTGTGGTA GACCTAACCTAATTTGAACTTAAGCCTAATCAGGTTTCGGTACCAAATGA TTAGGTTTTAATGGTTCACTTTAATCGTTTTTGCCCTGGTTACGACGACA AGTCACTCTCCAATATATTTTGTTGGGTATATTTGTGATAACGATCATGA ATTTTTGTCAGAAGTCTTTTGTTGTATGACGAGAAAAGTTGAGTTTTTTG TATTTTCTGGTTGTACAATCTTTCCAAAATAAGTGAACTTGAGTCTTCAA AGGTGATTATTTTATTGCATTTTCGACCAAGTAGCTGTGCCACATCTATT ATAAAGTTATTCTCAAAATTAAGGAAAAATTAAAGGTTGTAATTAAAACT AAAGGCTTAAAAATGGGCTTTGTCCTTTCCGTACAAGAGGGCTGGGTTAC ATGGGAATTATGATATTAGACTGGCGTTTAAAACAATGTGCCAACATGCA TGGACTGTGATTGGATTCATGGATATTGTATTCTTATTGTTCAAACTGTA ATCAAGAAGAAAATCGATAACTGCCGGTCCGATTTGAATGAACGTCTCTT ACTTAAAAGAGACTGCTTTACATAAGAATGTACGAATGCTCAATATTCCC TCAATCTCCTCTTAAACTGATGTCGAACATCTGACGTCAATATAGCTACA ATCAGTGGCGTTGTGGCAGGAGGGGGGCGGTTGCCATGGCCCCCCCAGCG GAGCTTTTTTGAAGGGGCGCCGAAGAGCAAGGGGCGCCAAAAGAGATTTT TTAAACGCCCCAATCTAAAAAATCATACTTTATGCACCTTAAATTGCGCC CAGGACCAATTTTACTGACATAATTTTAAAATACTTGCAATTTTTTTCGC TCGCTTCGCTCGCAATACAGTTAATTGGTAACTTTTTTGTAATATAGCTA ATTTACAAGTTTTTTGTGTATAATATAGCATTATTAAATGAAAATCGAAC TGCGCCTCAAGAACAATATGCTGACAACAATATTGAAATCATAAAACATC AATTTTTTCGCTCGCTTCGCTCGCATACATAACATATTGTTTCTTTAAGT TTCTTTTCACTCTAGCAAGGGTTAAATTTGTCTATTTTTATTTAGTGATT TAGGGTATCTTGGCAGTTGATTTAAAAAAATTTTCTAGTCGGCCCTAACC ATGGTGGGGCCTGTTTTTCCCTTTTCCATTCATCAAAGATAAATCTACTC TTCTCCACTAAATATTTCCTTCCTCATTATGCCTAGGCAAATGAATTTAG TAAAAGTTTAGAAAATGGTGGGTGGCATGGGGACACCACTTTGGAAAATT GGAGGGGGGGGGCGCCATTTAGAAAAAAATGACTTTGGCCCCTACAGAAA AATTTTCCCACAACGCCACTGGCTACAATCGTCGCCAATATATTATGGCA CATTTCCGGTGATCAAATTTAGATAAATTTCAATAACCTCCCCCTCCCCG CCCCTCCGAACAATGTTGGTGGGAAAAAATATTGCTTTGCCGGTCCTTAG CTCGCCCGACAACATTGTTTGGGGGTGAAGAGGGGGCTTTACGCCATAAG TTTTGTCAATGATTGTAGTTAGGAATTAGTCGTTGGATAATGGTTCCAAA AATTTCTTGCAAACCTTACGTAACCTATTCTTATTTGACTCTTTGAAAGA TTTAAGAGAAGTCTTCATTTCGATTGTATTAGTGAAGAAATTACCTTTTG TTTTTCGAAACATGATTTAATTTTTTGGTATATACAACTTCAGAGAAAAA AATAGAAGAACAATTTGAAAAAATGGAATTGAAAGTAATTGCCGTTTTCA AAAAAATAAGCTTTTTTCATATATTCGTCTTTTTGTATCTTTCATACATC AATTATCGTCAAAACAAATAAGAAAAATTTAGTCTGATAGGTCGTCTCAC GTTAAGGTCGCAGATTGATAGCGTAGGTTTTTTTCTGACTGATCGGCTCC CACTAGCAAATTTTTGCTTGGTCATTTTGTAGAACTCGTCGTCGTCGAAA GAAATTTTAAAGAAGGCAGAACATGTTCGTTCATGTGATTTTGATTCTGT ATCCATTGATCATCACTGTCAATAATTTTCTTATTGACAACGAGCAAGGA TACATTTCATCTCAAGATATCTCAATCATCAAAGAAATCAGTAATGTCCA ATCACAAATGAATTGTCTTCACAAATGTGTTCGCATTTCAACGAAAGTTA AAGTCTTTTACAACCGCGAAAATATTTGTATTTGTTTTGAAGAAAAGACT GGGAACAAGAATATTGTGAAGAGGAATGGGGACGAATTATATGGGAGAAT CATGTCAGTTATAAAGGTATGAAATATCATTTTTGTCAAGAATCTCTAGA ATTTTAGCGAGTCTGCGTTATAATATTCCTCAAATCTCTCTAATTTTATC GTATCTCGTCTAAAGATATTGTGTTATAGCTTGTCAAGAATGAATTAATT CGCTTGATTCCAGGCTATTAACTTATATCATGGCCAAGTTATAGGTGTGA TTAAGTCAGCTATTCGATTAAGAGGGTTCGAATGGCTCTGGCAAATCTGA CGTCTGCATAATTGTCTTCGATTATGAATTGTCGCATCATTTTCATTTTT CCATTTTTATAGGCTCAAGAAATAAATCCAGTAGTCAATGGTCCATCTCG TATTATGACGACAAGCCAATTAACTACTGCGATTGCTCAAATAACTACGA CGGCCGCCTCACTAACTATAACGACGGCTGCTCAACGAAAGATTACAACG ACCACCGCTCAACTAAAGATTACAACGACCACCGCTCAACTAAAGATTAC AACGATGCCATTCGAGGTCTTGCGATCATCAACAGGAGCTAGTGGATCAT TTAGCTTGATCAGTGACACCAATCTGACAACGTGCTTTTATACACAAATA GTGGATGATCCATATGTCGTTTTCCGACTTAACGTCCCTGTTTTAGAAGT CATTGTCACTGTCATCCGACCTGAATCTGTTATATCGCTTGGATCTAGTA GTAAAGAAGATTTCCAAATATATTCATTTGCTAACGGAAATTTAGATAAA TGTTCAAATAAAGTTGATGTCCACACAACCACACCTGTTTTTAACTTAAC ATGTTCAACTGATGATGTTACCAAAGCTTTCAGTAAAATAAAAATTGTCA AAGAGGAGGATTCACGTGCTTTGATGTTGTGTGAGATAGCAGTCATCCTC GTTCGATCTGTTCATTAAACCAATCACAATCGCGACCAGCTAAAGACTTC CGCAAACTAAACTATAGACTAAAGAAGAAGAGAAAACTAAAATCTAGTTG TAATTGTAGAAATAGATGATACTATTTCACACCCCTGTGTCACAGACCCG CTGGGACCCCAGCCCACTGAAAAATTTGGCCAAAATTTCGTCCCTGGTGG ACAAAAAACATACCGTGTAATTTCAGCCCCACTGGGAAATTGACTTTGAT TTCATCCCCATTCGAAATTCAATGCAAAAATTTACTGTCCAAAACCATCC CAACTGGATATTTTAAACGCGGGAACAATAGAATTTTTATCCCCATTGGG ATTTCGATAGACCGGGGCTGTGAGACAGGGGTGTTATTTCAAATATTTAC AATATGTTCAAAAAAAAAGTACATTTCTCCAAAAACTTTGGATGCTCTCA TAAAAAATGGGGGAGGGTACCTAGGCAAGTGAAGGGTACGGCAATGTGCC GGCCTTAAGGGTGTTCTTAAGGTTCCATTTGTGGAACGGGGTAATCTCTG TAAGTTCCATGAAGGGTCAGAAAATAGGAAAATTTAAACTTTTTCCCCTA AAAGCTGCAAATTAGTCCCATCAAGTGTCGTTAAATTCATAAAATTTTCA ATTTTTTTCTCTTTTTTAGTCCCGCTAAGGGTCCGATGGTCGAAGGTCAT ACGCGTCAGCTTGTAACCAGGGCCCACGCCATGAATTTGAAAGTGGGGGG GGGGCAATAAATATAGAGTCTAAGGAGGCGCAACCATGGTTGCTTTACTT TGCAGAAATGTGGGGGGCTGGTAACCCTAGTACCCCTAGGTATCGAGTAG AAACTCTTTGTTCGCTCAAAGCATACTTTCCCTATTCCCATGATGAAATA ATAGGTTTATCAGAAACGGAAATAATGTTCGTTAATTTTATTCCACTTTT TATCGGACAAAAACAAAACTCGACCCTCTTTAATACGAACCTCTATTGTC CGAATCTCTCTGTAATCCTAAGAATAATTCGTCTCCTCAGCTTGCATAGT CTTATTAGTGACTGTTTATAATTTAAAAGCTATCTCTCTCTAATTCGAAA AATATTTTTCTTATGAAGACCGAATTAATGAAATTTAATTCTATATTGAA CGAAGGATCGAGACAAAAATACCATTAGATTTAATAAATTTAAAAAAAAG TTAACCCGTATGTATTGGAAAATGAATTGTTATGCTTGCTCGTTCAAAAA TCAGCAAATTTGTAAACAAAAGCATAAGTCAGCAGGGGTTTTGTTTTGTT TTTGGTAGGCTGGCGAATGAAAAATTAACTCTGGTGATTTCTAGATTCTA GGCCGGCGAATTCTTAGCAAGCGCAGTGTATTGATTAGCATAATAATGTA CTTGAGGCGGCGAACCGAACTTTTCGAACGGCAAATTGTAATAATTTTCG TGCCTTGGACCGGCGAAATTAGCCGTTCGCTGGGCCTAAATAAGACCCCT GATGCAGTGTAGGCCATATTCTTTGTTTACACGTATGGAAGTCGGCTAAG TCATAGTCATTATAAAAAACCCCAGTCTGGCAATGTATTGTTTTAGCTTT TTGTTCAAATTTCTTTTGTTACAAACAAAAGACAAGTTGCGATTTTCATA CTTTTTGATTACGTTACCAAAATCTCCTCTTGGGATTGGTCTATTTTCTA ATCACATGATCAAAAAGTTTGCAAAATAAATCGATTTTGGTACGTATAGT AAGCTCTATCTTTCAACAATAAAAAGAGACAAAAGCCTTCCAGACCAGTA TTCTTATAATGACTATGGCTAAGTATAATTGCCAAATTAACACTGATTTA CATTGTAAATACTTAAAGAAATTCCCTTATGAAACGTTGAAGTTTGAACA TTTTCTCTTCATGCCATCTTCTTGCTATTTTTCACGTACCTTTCATTATA CCTTGAGTGTGATTTTTTAAGCTTCTTGGTTTACTGTAGGTTGCTTTGTG GGTAGTTGTGCGGAGATGTTTTGAATGTTGTTTTTTTATTCTTAAAAAAA ATATTGTTTGTTTATTTGTTTGTTTGTTTGTTCCATCCTTTAAAATGAAG GTGAACCCTGGTTTTTAACCAGGTGCATATAGCCATTTGTTAATTTATCA CAATTTTCCATCAACCAATAGAATTGGGCTTTTCCAGAAAAAAAACGTAC ACCCCCTGTTGAGGAGCTCCAATCTTTTGTGAACTACCCCCTTGGAATTC CAGGCAATTTTAGGATCATACCCCTCTGGAATTCGGAATTACAGATTTTC AATCATTACCCCAATGGAAATCCACTTATTTTTGGCGGATTTTTGTCTAC TGCTATGGAATTCCACTGCATTTAAACCATACTCCCTTGGAATGGAAATG GACCTCCTCAACAGGGGGTGCACGGTTTTTTTCTGGAAAAGCCCATTAAT GAATAATACGAGATGTAAAAGTTCAAAGCCCTAAATTAATGATCCTTTTT TAAATGACTTATTTTAGTCATACCCAACAGACCTTGAAACTTTTAAACAA AGAATTACTTTATTATTAGAAAATGACAATGTGTCATTGTCTCAAGATTT TAGGGTCACATCTAGAGGGATGGCGTGAGTTTTGACTAAACTATACCTAA CTTTTAGTAACATTGAGGGTGAAAAGTGTGGGGTATTTTTCTAATTGGAG ACGTGTTTTTAGTAAAAGCTCTTCTTTTCACAGCTTGATGAAGAGGAGAA CATTGGATCATCCGACGTCTCCCTTCTCCCTCCGTCAGCCAATGAGATGG GTTCATTGAAAAATAACGTCACCGACAACCAATCAGATTGCGTCATTGAA GATCCCAATCAACCAGATTACGTCATTGTTGAAGATGGTAACAACCAATG TGATTGTCCGGTGTCGAATTCTAGCCAATCAGAGGAGACCAATGAACCGC TATTTAAATACAGCACCCAATCAATTTCACCAGAGATTGTGGTCATTCCA ACAGACACTCCAGAGTTAATCAAAAGATTCCCAAGACGTCGCAGCTCTTC ACCTTGTCTCGGGAAAATGTCAAACCTAAGAGTCAGGTATGGCTCAAGAT CATCAAACGATGACGTCAATTCGAGCCAATCAGATTGCTCGACCGAAACA ATCAGCCAATCAGATTTGTCGACGTATTTGGTGATTGAGAGCCAGGAAGA GAAGAAGACGAGGAGGAGCTCATCACCATGTTTTGGACGAAGAAACGAGT TTATGGTTTACAGGGAGCAACGATTGTCATTTTTCTCATCAGAAGCTACT TCAAGAGGAAGGTAAGAACCTTTATCATTTTTTAACTTTTTTTACTTGTT ATTCTTGTGTGCTTAATTTTAAACAGGGGAATAAGCAGGGGTCGGGTANA GTTGATACTTTGATACTCTCTAGTTCGATTTTCAAGCATCTTCATCGAAT AAGAAGGGAGTTTATTGTGAATAGTAGAGTGTCGCGTAGGAGATTTTCTT GTTGACGGTGATTTTCAATATTTTCAAACAATAGAGCGTATCGAATAGTA GAACGTCGAATTAGAGGGCGTCAAATGTTTTTTTTACTCGTTACGTTTTT AAAACGTTCCAAAGACGTTTTCTTTAGGTCGGTGTTCACATTTGATACGG TGTTTTATTTGAATCGGTTCCGTTTCATTCTGATGAAAGGACTAGCGAGT TTATGTACAGCGGAGTGACTGAAACGATTTGGAACAACCTGCAGCCCTTA CCTGCAAAAACGAGGACCGTAAAAGTGCTGATTTACCAACGTCAGCCATT CAATCAGGATTTAAACAAATCAGAACCTAACCGTTTCCGGCGCGAAAAAA ACACTTACACCAAACTTGATGAAAGTAGAGCAAAAGTAACGGTCCATCTC ACTCCCATCCTGTACCAACTCCCATGGACTTTATTGCGTCCAAAGAAGAG TTTTTGCATTCATGATCAGAATCTAAACTCAGTGAACCATCTGCAACCTG TCGGTTCTAGAGCGATATAATAACTGATTCGATCTTGAGAATCTTTCTTA AAAAATCAGAAGTTCGAACTAACATTGCATATAATACTCGTAAGCAATGC TTACCTCAAGCAATAAAAAGTAAATTGACCTCCCCCTGTGCTTATTCTTG CACCAAAATAAAATGTAATTTGAATGTTCTATGAATGTTATGATTTTCAT ATTGGCCTGTGGTCAGTTTTTAACCTATACCGATGGCTATATTGATGGCT AAAAATTACTATATTGGTTCAAGTTATAAGAATGTTAAGGCTAGAAAGAT GCTACGGTATCTGATTAGTCATTAAGATACTATCAACTTTCTCTATTATT CAAATCTTTACGTTTTCGAACTGAAATATTGGTGCCCACAGACGGAAATT GGTTTAAATTCTCTGTGATTCAAGTCTTTCTCTTATTTTGGATAAAATAT TTTGTCCCTTGAAGATCGAATTAAAGGGTATCAACTGTATTTCTAAATGT AAGTAACCTTGGTATAGTCCCACTTTAATTCATTTGTAGAATCATAATCA CTTTGAAACACAAAATGATAAACTATTCTTATAGAAAGTCGCTTGCATCG GTATTTTGTCGATTTCAGATATCCGAGCACAGAGGTGGTATTTATGTTTG TCCAAATTGTAACTTTCAGGCTGACTTTTTCGGTTAGAGTACATACCTTT TTAAAATGTTCTCTGGAAAAGATATTTGTATGTTATTTTGGGATGTCATT CGTAGTGGTGTACTGTATATCTAGCTTGCGCAAACGTTTTTTCTACGTCA ATCCAACGTTATATCGTATTAGCAAGTTTATGTATTCGAGATAAATCGAA GAAGACAGTATAAATCAAAATTGACAATGTCGCCAAAATCGTAGTCTAGC AAGCTAGACGACTAATTCAGACATATTAGAAATAAAGCAAAAAAGTAAAT TTTAGTCGTCTAGAAACCTTTGTGCACTAACTCCAAACAAAAAAAAGTGT CAATATCGCAATTAAAATTTTTTCCCGCTCAAAAAAAATTCTTGAAAATA AAATGTGTGTGGATGTGTGTGTTAAAAATGTTTCATTTGTGTTGATTTTA TTTTGAGAGTTTGTTGTTGCTGAATAAATTGTTTTCTCGCTACGCAAGTT TCTGCGTAGCTAGGCCCAGTATCTATAAGGCTGGAACACCGGATTCTTCC AGTCGTTTATACAAACTAAATCCCGTATCATTATTTGTGTTTATTATTAG TAATACATGCATTATAAACGACTCCAGTCTACCAAAATCACCGTCCACTT TGCTCTACGACAGTAAAAACATCAAAATACCGTCGTCTTTTTAGATGAGC AAAGGCGATATAGAGCCGTACATCAACTATCGAATTTCTTTTATGTCGAC TTCACTTACCGTCGCCCTCGATATCCTCCAATACATAAACTCACAGAACT TGTAGAGGTCTGTGATTCAGACTATGATACCCTCCGATACCTAATCTCGC TTTTGATGTTATACGGTTGACGATTGGTGTGGCAGAATTGGGTTTCCAGG GCTTTTCTTTGGACACCATTAACATTCTTAGTGAAAATACCACCGCTAAT TAACATGTGGCTGAAATGTGGGATTACTCCAATTTTTGACAATCTCAATT AAGTAAGGTATTCCAGTTTATTAATATTCCGAAAGTTTCTCTCAGTGGAG GATATAGTGTTTGGTGAGTTGTTTTTGTTAGTTAGACAAAATGTGTGTGA ATACTGTTTGAAAGAAGTTGGTGTGCCTCCGTTGTTAGTTAGTCATATTA CATCGAGTTTTATAGTTNGTTAGTTAGACAAAAATGTGTGCGAATACTGT TTGAGGGAAATTGGTATGCCTCCGTTGTTAGTTAGACATATTAAATCGAG TTTTATAGTTTCAGTTTTAGGCAATAATGTCCATCTCGTTTTGAACCTCA CTGGTGTTGAGTGTATTGAGCAAAAGTAAAGCGCCTGCTAAAATGTATGA TTCATTTTTCATTTTTCAAATAAACATGGCGTATTTTTCTGTTATTTCAT TGCTGTTCTGATTCAGAAAACATTGACACTTTCAGCGATATCGTAGTATA TCTAACCCATTGGAGTCCTTTTTTGCTATACATTAAGTTGGTTGGCTTTG ATTAATCGGTTGCTAGACAGTTTAATTTTATGAAACTGTCTTGAATCATG TTAACTATCGCGTCTATAAGTATATAACTCACTGATGATGTAGAGTAACT GTAAGAGAAACGTAATTCATACTTTGTGGTTTACGCATTTCTTATTGTAT TTTCATACGTACGAAGTAGATCAGTTTCTTTGTAACAAACGGCATTCAAG ATGATCACAAGGGTATTTTGTCTGGAAATGATCACCGAGATGAAAATTGA TGATAGATACTATTCATAACTATCCATCATCGAATTATTGAACGAAAGAA GTTTACGAATTTCTTTTAGGTATTTTTTACGTACGAAGTAGATGATTCAA GATGGTATTTTGTCTGGAAATTATTGATGATAGATACTATTCATAACTAT CCATCATTGAATTATTGAGCAAGACAAAGACATCATCAACATCAGTTTTA TTTTTTGAAACGAGTTTGTACATTGATACCGTCAATTCTGACTTGATGTT GCTTTTACACCGCATTTTTGATTTGTTTAGTACACTACCTTGTCTTAGCT TGGATGCTCTAATATCCTCTGACAAACCGTTTTTATATCAACTGAGGTTT TGTAGGGGTCGTGATTCACAAACCATGCGATTGCAGGGAATCTAATAACG AGGCTAGTAGCTAACTCTCTCCCGGGAGAAAATATTACTTTTTTTGTTTA TTTTGATCTTCTATTGGTTTGACCGCCTTCCTTTGGGTTTTAAATTTACT CTAAATACTCTTTTTTCTCAGTTTTAAGTGGTTTAAAGTAGATGCAGATT ATTTTTCATTATTTTTTTTAAACCTTTCCTTTTAACATTGGGTTAACTTT GAGAGTTTTTATGAGATTTTTACGATAGGTTACTCTTTTCTGAATTGCTG ATAAGTCATAATAAGGCGAGACCAATTTGATTATTTGTTTTACGGGCCCA ACCGACCCTGAAATTCCAAAAATGGATATAAAAATAAAATTTATTTTGGT AGTACGTTGTTATTTTCATTGCTTTACTGACTGCCAAATTTTCAGTTTTT TCCAAGGTTTTGAGAATTTCAATTTTTCATTGTATCCATGAATTTGAGGT TTTAATGTGTTTGTATTTTCTATTTTGCATTTTTTCAAGATGTAGTAGTT TTTGCTGTCTTTTTAGGCGAGATTTTATAAGTGAAATTCTACTTTTATTT TTATTTTTTTGTCGACCGATCGACCCTCTTTTTTGGGTACTTTAAGGGCA GAAACTTTCGTGTTTTTCGCGATTTTGATCCTTTTACGCGAAAGTTTCTG CCAGGTAAAAGTTAAACCTGAAAAACGCGAAAGTTTTTTTTCGCGAAAAA TAAACTTCTCTACTCAGTTTTGCACTATTTGCTAAATTTTAGCATGTTTT ATGAGTTTTTGTTACTAAAAAAGAAACTTTCTGCCCTTAAAGTAGCTTGG CTTGTAAAACAACAAATTAAATGGTCCCCGTCTAATGTCTTTAAGATTTC TTGGTAGATTTGAGCAAGTAGAGAATGATAATCCTCGTTTTCCTACTAAT CAAATCAAATCTTCGTTTTTGAAGCATTGTGAAAAATCAGTTTCCTGAAT GTACCAGTCAATTATAGAGGTATTAAATTCTCTTTACTTTAAAGGAGACA CGGTATTACCGGGGAAAGAAATTCACAGCAATACGCTAAGAAAATACAAA AAGATAATCTTCGCTTGTTATATTATATATCTCTCATGTTACATTTTCTT ATTACTGTTACTGTAATTGATGTTATGAATTGTTTGCATAACACTCTAAT TACACGGAGGAGGCTACAATATGTTGGTTTTCTTATGATTTTTGAATGAT AGAGCTTTTCTTTTGTTTTAGGATTTTTAGTCTGAGTCTTTTTTTAGATG GTGAATGATTGCTGGTACATTTTCCTATCATATTATGAATTTTCGAATTT TCACAAAAATTATCAGAATAATTTGATTTAGGCTTTTAAAACATAATGGT TGAGACAAACACAGCTTTGTGTGTATTTACAAGAAACTTGTATTGTAGCC AGTTTATGAAGTTTTGTTTGTTTTCGTGAGAGACAATTTCATTTTCATTT CAGCGATATATTTTGGGTACGCAAATTTGGAAGTTTACTACGGCTAAGGG ATCGTCAAACCTCTCTTCAATTATAGAATAGGAAAATAGAGAAAAAAATT TTATTCTGACAGTCCCTGTATCAAATAGCGAGCTAATGTGTTTGCACTTT CGAGGCTGGTGGAGTGACTGAGATGATTTTTGTTCGATGCCATGATTGTT CTGACCTTCAGTGGTTTGCTTGAATGCGTGATTATTTGGCTTTTTAACTT GCGTGAATGCGTAAATTTGAAAAAAAAACTGTGTGGTTGCGTGGATTGAA GGTCCGCTGGGGGGCCTCCAAAATCGAGGACGGTAAAAGTGCTGATTTAC CGTCGTCCTCAGTCAATCAGGATCTAGATAAACTAAAAGCTTACCGTCTC CGTGGCAAAAAAAACAACAAAAATACATAAAACTCGTTGATACTTTTTAG GGAACTGTCATCAACGAGACTTTGAAATCACACTAAATAAAGATTGCGAC GTCGAAGTTGGCCAATATGATTCAGTATTGAAATCTATCCAAGTCATCAG TGATATATTTTTATGATATATTATGTTTTGTTTCTTCGGCTGAGAAACTT TTATACTCGTGTCTATCAGACAAGAAGCAATTACTTCACCTACAAATTAC ATTTAGTCAATCGGAACTAAAGTCTATTCAAGGCATTGCTTAGAGGCGTG GAATGTCTTGACCTTCGGAAGTTCTTTAAATGCCTAAATGACAAGTTCAA GGAAAAAGTAGGTTCGTCTCGTTTACCCCAAACACAATTAAGAGGCTTTT GTATGGAGAGGAATGAGCGAATGCGGTTTTTTAGAACTGTCATCTTATGC GTGGGTTCTTAAGGGCTCTGACCATAGTGAATTTTTCATAATTGCCGTGT TTAAAATGTGTTTTCTGACTGGTGTAACCAACAAAACTATGGCATGTTAT NGTCGTCCTCAGTCAATCAGGATCTAGATAAACTAGAAGCTTACCGTCTC TGTGGCAAAAAAAACAACAAAGATACATAAAACTCGTTGATACTTTTTAG GGGACTGTCATCAACGAGACTTTGAGATCACACTAAATAAGATTGCGACG TCGAAGTTTGGCCAATATGATATTGAAATCCATCCAAGTCATCAGTGATA TGAAATGTTATTACATGTTATGTTTCTTCGGCTGAGAAATTTTATGCTCG TGTCTATCAGCAACGTTGCTATCAGAAAGGAAGCAATTACTTCATCTACA AATTACATTTAGTCAATCGGAACCAAATTCTTTTCAAGGCACCACTGAGA GGCGTGGAATATCTTGACCTTCGGAAGTTCTTTAAATGCCTACATGACAA GTTCAAGGAAAAAGTAGGTTTGTCTCGTTTACCCCAAACACAATTAAGAG GTTTTTCTATGGAGAGGAATGAACGAATGCGGTTTTTCAGAACTGTCATC TTATGCGTGGGTTCTTAAAATGTCGTATATGATGTGTTTTTTTTCGAAAA CTTCTTCGGCTTTAAACGTCAGCTTATTATGTCAGGAGTATTAAGACATG TTGTTGGGGTTTATTAGATCTGAGGTTTTCTCTCGATTTTCGATTTCCAA ATTCTTTTCTAACATTCATGCAGTCTCTTCTACTCAACATTTTCTGTTTT TCAACTTTTTCTCTTTTCCTGGAACTTTTGGGTCTGGGTCATGAAAATAT GTAGGTTCGATCTTATATCTTGAAAAGATTATGAGCTCGAGATAGAAATA GTGGGATCTTGCATAAGGGTTGTATAAGTAACAAGTACGGCTAAAGGTCT GTGAAATTAAAACTAAGGTAGTAGAGAGAGACTATGACAGTTAAGCCTAT GTTTTGATGTGGTGTTGCTTATATCCCGTGGAGAAGGGCTTGCACTTGGA ACAAAGGAAGATATGACGTAGCCTAATGAATCTATGGGGTACTATGGGTA TTTCGTTTGTTTTCTTCGTTGGTTTCATCATGCATTTATCAAATCTCGCA GTTTTCTGTCTTCACAGGGAACAGTTACGTTTGGCGAACAGCAGTACCTT ATTTTAATTTTATTGGTGAGTTTTGAGCAAAACAAAATTGAAGATATTTC AATGACCCGGCCTATTTTTCTATTCTTGCCAAATTTAGGTTGTTTTTGAT GTACACAGGCTAACAGTGATTGTATATAATTGTTTTAATTTGGGGAAGGT TGTATTTATAATTTGTAGCCGGTATTATTTTCTCATGGTTTGCAAACTGT AACAACGATGTTGGATGGATTGCAGAAAGGTCTGCTTTCAAAATTTGGTT GCCTTTTGCATAATATTTGAAGAAGTGCTAAAATTTAGGGCACAATTTTA CTATTTTTAGCTTTGGTAATGCTATAACGTATATTGAGGTGATAAAAGTT TTTGCAGTTACTTGAATTTCAAATATTTTGCAGTTGATGTTCAATTTCGC CACTCACATGTCAACTTTACACTTGATTAGGTTCTTAGACTTTCATAACC GCTTGACATTTTTTTGGTTTTTTGACGAAGAAATGACCTTGTTTTTTCTA TCTGTAGACATGGCTCTTGTAGAATGCGTCGTGAGGTACTTTTTACACAC CTATAAGTCGTGGGTTACTGAAAATCTTTCCTGTTATTCAATGTAACTTT TTTCAGAAGTGTTAAAATTATTTGGTCCTCAAAACCGAAGGCGTCGCGTG AGATTAAAAGGGGTTGGTATTCTAGGCTATTTTGAAGAGATCTGTGGTTT TTGAACCTTATTCCACAAACGATTTTGATTAGAGAGTCCATACTGTGTAT CGAATCGTATTTATTTGAAAATAAGGATACTTACTGTTTGATATGGAAAA GAATGATCAAAGATGTATTTCGATTGATTTGGTGAATTTTCTAATGATAT TAGGATATAGAATTTGTTGTAATTTATCTTTTTGACTGGCGGATGAGAAA TTTTTAATATACAGTACCGTATTTGGCCCCCAAAACGGAGACGGCCCCCA AAACGGAGACGGCCCCCAAAACGGAGGTCGTCATTAAAATGAGGATTCTG ACTTGTAGATTTATCAGAATTAAACAATTTTTGTTTATTTTGAAAGAATG ATGGTTATACTTAAAAATGAGCATGTTTTTGATGGTTTGAGACAGATTCA AAATAACATATTTGCGCCTGAAGGGAATATTTTAACACCAAAATTAGATA AAAATTGCATATAACTCACTCTAGCTCCTTAGATATTGAAAATAAGTTAT GAAAATGGGAAAACAAATAGGAAACTTTCTACACCTAATGCCGTTCAGAA AATGCAGATACATCCGTGACTTTAGAGAATGAGTAAAAGATATAGCATCT TAAAGGTCAATCAGTATTTTGGGGTCCTAGAACCAGCATTGATAAAACCG AACATTCTAAATATGAGAAACAGCAAAATATCTTGGAATTCCATTCCCAT CAGCTAGAGTTAAAAGCTTATAACAAAAAATTAACACTATGTATAAAATT TTTCGCTGAATCAGCAAAACCGGCAAATTCTGTCATTCTTTTGCAAAATA TAGGAGAAAAATACCTTTAAAGCTTAATATTTTCAGTTTCAGTTGAGCTT TTTTTCTAAAATTTTCACAGCTTATTCCATAATGGAACTATTTTCAAAAG AGATTGATTTTCAAAAACTTGTTTAAGACGTTTATTAAATCAAAATTGTC ATTTTGAAAATCCCTAAATTTTCAGTTTGGACTTTGCAAAATCGAAAATC TTGAAATATTTCATAAACATCATAAATTTTATTATCCATCGGGTCGTAAA TTTAAGGGTAAACACAAATATGTTCATAGTTTTTCCCCCTATTACCACTG GGCTTAATAATTTGATTTTAACTACACCTACGTATTGGGGGCCCCAAACC TCCATTTTGACAACCAGGAGTATACTTTAAAAATTTTATCAAACAAATTT ATGCCCAAAACCCTCTAAATCACATTTCCAAACTATGGTCAAAATTTTGT ATTCATATCTTAAAGAGATCTCGAGAAATCGCTAAAATTTCAAACCTCCG TTTTGGGGGCCATTAGAAAAAAGCTACCTATCTTTAAGCGATTGAAAAAT ATTGTTGAAATTGAAAATTTGGAAAAAGAACTGTCGGGAAATAAAGTAGA GATGTTAAAGTTTTTCATGCAGCAAAATTTTTTGTAAAACCTCTTTTCCT CTAGATTTGAGAGAAATTTTAAATTTGATCGACGTTTTGGGGGCCACATA CTGTAATGACAATTATTATTTTTTCCACTTTAACTTTTTGAAGCTAGTGC TCCTAGAAATAGTTCCTCTATTCGGAGGGTGTCTTTTTTAGAAAGTATAT AGCAGCTGGAAGAAAAAGTCATACAACATAAACCATCTAACGTCCATTTG TTATATCCAGGTACCGTTAGATAAACATTCTTTGCTAGCTGGTAGAGTGG ATTTTCGCTTATTCTTAGTTTCCCGGTAATGGGAAATCCTCGAAGAATAC TTTTCTTTACTCGACTTCCTCTAAAAGTTCGAATTAGAGAGAGTTAGAGA CTGTATTATAATCCAGTGATTATAGCATTCTTTACCAAGAACCTTTGTTT TCATTTTCAACGCAACAATCTATTTAAGTAGAATCGGGCAATATCCTGTT CATCAAATTCTTGTTTTGTTTGATTTGTTTTTTGTGTATAATAATTCTTG GGTAATCGGGGTAATCTTATCACATCCACTTTGACAATAATTTCGTTTTT CTTTTGTTGTTCCAGTTCTATGATTTGTAAAAACACGCCATTGTATGAAT AAGATATCTGATAAACTTTGTGAAATAAAGGTTGAGGATCTCCGAAAATG AGATGATCAGGGAGATTTCGGAAAATTCAGACCCTCCTGATGTTTACAGT ATCCGAGTACCGCTTCCTTCATCCCGCTAGCTAGAAGAGTCTCAAGCTAT GGTTCTGATGGAGAGCTCAGTTAGGAATCCAGTGATCTGTATAAGTATGT AAGTCAGAGGCGACATGAAGGCTCTTCTTTCGATAGCTATCTACCCGAAG GTAGGGGAGGGTGCCACTCTTTCTCCCTGGATTTCTCCACTTACCCCTGA TTCTTCTCTTAATTGCTGAGCATCAAGCAGAGAGGTATCAAGTACCAATT TGGAAATCTTTGGTATGACCCGGCTGGGATTTGAATCCACAACCTTGCGC AGGTCAAGCTTGCTCGGCTTGCGATGACACGTCCTCTCCACTGTTGCCGA TGTCCCGTGGTATTTGCAAGGTCTTCCTTTGAGCAGCCTGCATGTTTCAA CGGCCACCTAAATTGCGTGGACTAGATGCGTGCCCCTTGAAAATATCTTT CCAACGATTTTCAATTGTATCTATATGAGTTTTGGTTCTTATAAAAAAAA GTTTTAACTGCTGACCGTAACTAACAACATCCTCAACAGTTATTGCCATC CTTCCCTTCTTAATACCGCGATGCAATCTGTTTGAAACAGGATTAAGCGT CAGGCAAAATGTAAACATGTTGTATTTTCTTGATGCCAGAATAACGATGG ATTATTTGCTTTAAAGTTTCGGTGTTTGTTTTTCCAAATTGAAGAGATAG AGTTTTGGTTTCATTACAAATACCTTTTTCTGGTTGCACTCGCTGACCAT TAAATTGGCTCTGATATTTTGTATTTCTGGTCAAGAGAAATCGTCTCTTC TAAGTTAGTTCGTATTATTTAGGATCTTGACGAAAACGATAGTTGTTTGA AAGTTTAAACTTTGTGTGTGGAAATGAAAGAATGAACGAATGAAAGAATG GTGTTTTGGTCTTTTGGAACTCGTGAAGCTAAAGGAACCCTCTAACTTGA TACACGTTTTTATGCCTTTTACGGATGTTCTTAACTTTTTTGAGTTTTGA GACTGAAATGTTTTTACAATGTTCTTAATTTCACCAATTTTAATTATTTA TGTGCAATTTAGAGTCCATAAAGCCTTAAAATGTTTTGGCCGTCGAAACC TTATGTTCTAATATAGTTTGTTCTCATAAAAAACTTATAGTAGAGCAAAA AGGCTATCTTGTGAACACGGTCACGGATTTGGATCGGAATCGTTCTTTTT TTCTTTCCATCTCTTGTATCTATTCAGAAGTTTCAATTTATTTTGATTTT GAGACGTTTTTTTCTCAAGAACGGACAAGTATACCTTAGGGTAATTTCGA GTGGAATTCATATCAATGATTTCCTCTCCAATATATTTTGATATTGATTT TCCGGTGACGTCTTATGCTACCCGTCGGGAATTCATGTGTAGAAAACCAA CATGTCCATTTAAAAGAACAGTAAGAATTCTGAATAAACAAACTAACATT TCATTCAATATTTAGTACTTATAGTTTCCTTCCTATGGTAGTAACCTCCA AGAGAGATTATTAAGCTAACATGGAAATTTTGCGATAATGTAATTAGAAT TACTTCTAAAAAGTGACGATTGAAAATGGATACAGTATTTTACCATAAAG AACAGTTTTGAAATAGATTGTGCATGCTGGCCTGTGTCTACATCCTATAT TTCTTCGCTCCAAGCGTGAAACTACTCTTCAAGAGTAAGGTCTAAATGCC TTCCTTGATCTTATTGTGTAAATTATTGTATATTGCAAAAGTTTAGATAT TTGGGAAATCTTTAGTTCATCAGATGTCATCATTGTTCCCCAAAGTCCTA AACGACTGGAGCTATTAATTGTGTAGACATCTAATGTTATATGCTAGACT AGACTTGTGATGTGGAAACTATTGCTCGATCTATCAATACTTGCAAATCG TTCATTCTAGTGGTTGGTGCTGATTTTTTATAATATCTCATTTTAGGAGC AATCTTTCTTCAGATTTTATAGTTAGAACATAGTCCCCAGTGGTGGGTTT GATAGAGGGTTTTCATTTCCTTGTAAGAAGTATGGCTAAATGAAACACTC TCCGTCATAAATTTTGTACCGTCAGATCCACCGCTGGTCTCAGCCAGCAA ACATCCTACATAATGTTAGAAACATTAGATGGACGTCTCCTAGACGTCTG GTTAGATCCATTTGGTTTCTCATATTCTTATAAAAACTGCTCAAAACAAA TTGCTCACACTTTATCGTTTCAGTCTGTCATATAAAACTGTTTCTAACCC CCTACTTAATGCTCTTAAAACTTTTAGTGCGATACAGTAGATAAATTATT CAAATAATACACTCAATCTAGAGAGATTTTCGTATTCAAACAATCGTCTA AAACCAACATATTTGATACAAGAGAAGAGGTATATTGATGGTATAGTCTA TGGTTTATTGAATACCATATTGTTTTCTGAATTGAATGTTATTCGTGGAA ACCTTTTTACATGGTCTACCATAATCTAATGATTTAGAAATCGTTGTTGG TTTTTCACTTTTGGAGTCTTGCTGCTCAGGATAAAAAGAAATCTTGGTGT TGTTTGGTTAACATTTGGGAATTTTTTGATCCCAATGGTTGGATATAGGA TATAGTACATGGATTTTGAAATCTGTATTATTGGTATAGCCTGTAATATT ATTCGTATGGCTATGAGAAATATAATGGGTTATCGTACTACACCTGAACA TCATAACATCATGCATCGACCATCATTCCGACGGTCTGTCGGCTGCACTT TAACTTCTCATCCTGCGTTGACGACAGGTGATTTATCTTTATCCAAGAAG ATTTCATTATTTTCGTCGGCAAGCGAGGCGGATGATGATGAGGAAGATGA ACAGGATTTTGTGAACGCGCTACCTATTTGGATGCAAGAAGCGCAGGATA ATATGAGGTAAGGTTAGGAAAGCAGGCATCTGCTCTGTAACCCATTCGCT GCAAAAGGACGATTATATCGGTCGAAATACCGAGGTAACTTCAAATCGCC TACTTTTTCTACGGACATTTGTTTTTCCTCTTCTATTGCAAAAAGTTATT GGGAAACTAACTTTTATTGGGGTAACTATCAAGGACTGTTTCAACCGGGG AATATGAATATGGAACTGTGATATCCTTTATACAACCTTTTCAAAAAACG TATTTCAGCTTTGACATGTTACTTGCAGCAAAATATACAGGGAGAATGAT GATTGCAAATTAGCTGCTTAATTTTTCTTAACGTAAAATAGGGAATATTC CTTAAATTGTTTATGTCTTCGTCTTCGGAGCCTCAAATTGTCTGTTAAAT ATATTTTAAAATGTACAAGTTTTTTTTGACTGATAGTGGAAGTTATTCAA TGTTCTTTTTAAAGAGACACGGCTGTCATGTAACATACTGCAGTTGTTTT TGTTTATTTTACTTGCGGTTACTGAAAAAACCATAATTTGACTCAAAAAG CCATGCTTTGACTATAAATGGACATTTTTTCACGTGTTGTCATTTTATAG TTAGAGAGCTTATAGAGCATTCTTCTGCAAGAGTTCTTACGGTTCTCTTT CTTTACCCAGAAACATCCAAGACTACCGAACTAGTCTGTTGATCAATCAT GTCAGAAGGCGGGAAGATAAGGGTGGAGGGTGTTTGTTAAAATAGGAGCT GCGTAGGAGAACGAGCAAAAGTTGGTAAGAGGTTAGCCTTCAGCCCTTAC CGCCAATAACTTTTCTTCCTACGCTTCCCTTAACTCTCACACTCACTTTT CCCGCGTGATACCGTTCCAGCCCGGCTGGTGTGCCAGTCTACAATAGTGT TTTGCTCAAATGACTTTTTCTTAGTTGCCGAATACAGTATGCAAACCTAG TTTTATGCCCCTGTCAAAATGTAAAATATAAAACGGCCGAAGAGGTAAAT CAAGGAAATCTCTCTTTTTTAGCGGTATACCTCAATTTCTATAATGTATA CAATCTCTGACGTCACATTATTTATACCAATACCGGCGAAATATTCAATA GAATGAATCAGACATTCAATAGATGTACCTGTTCACCCAATGTTCTTACG CAACTTGAATAATGGTATTATTGCGGTCAGGAAAACCTCGTCCTTTCGAA ATTTTTCGATAGGTGCTAGCATCTTAATTCTTCGAATCCCGAAGGTCCCT TTGGTTAGAGCTTACACAATTCTGGACAAAAGGTTAGAGACTTTTCAAAA GTTCCCCAAAGTAGCGAAATAAGAGCATTTTAGGAACTGAGGGGTAATTG ATGAAGCTGAAAGAAGAATTTGTTATGCTATTCAATTCGGAGCTTATAAA ACTGGTGCTTCCTATTGTATGAAAAGGGAGACACTGGACAAACAACGTAG GACTATTAACATTTTTCACGTTTTCTCGAGTTTTAGAAAGGAAAAAGTTC AAACATACTTTACTACGAAAACCTTTCCAAATTTTTTACTCTAACCCATA TCTCAGATTTGATTTTACAAAATCACGCGAGGCAATGGAAAACCAATAAC AACAAATTATCATTCCGATGCTAAGCTTCCTTTAATGCAATAAACGATTT TCTAAACAAGATATTTAACAAATATTGCTAGATCTTAAAGACTTGAAGTT TCGTTTTGCCATGTGACCCAAAAACTTATGTTTGGTCAAAGTCTACTTAA TCACACCTTAGGAAAACAGGGATATTGTTCGATTGTTGTTTTACGTGATT GGCGGCCGCCCACAGTCTAAAAATGTTTCAGTTGAACCTGCCAATCCCCC CAAAAACGAGGATTGGGGTTCAGGCCTACTGCTGCAAAATTTATGACGTG GATCCAAACCTTTCAGATGTTGAAAATCGACTTTCAAAGCTTTAGTGTGT TGGAAAAAAGTGTCTACGTCGGGTGCCAGATCTTCGCACGGATAATTTTG CACTCTATCTCTTCCTGGTCAATTCCAATTCTAGCCAAGAACTTGTTAAT GGTGCTTGATGCTTAAGTGGCGCCTTTTGAATATCTCTCAAGGTTGAGCT TGGATTTTTGCTAAATTGCTGCGAATTTCCTTACCTGCCAGATTTATTGA AGGAATTAAAATGTCTGCTGCGACGTTAAGAGTTTTGATGTGTAATCAGT AAGAGAATTCTTAGATCGCGTGCTACAGAGGATAAAACTCAAAGCGATCC GTAACCATTTCTATCGTTCTTGTTATAGGTCTTACAGCCAGCGTTATGAT TTGTGTTCCAGTCCACGATTGGCTGAAGTTTGTTCACCACGTGCTCGATC CAAAACATTTGACACAATCAACGAACATCCGAAGCGAGACTCCGTAAGTT TCCTTTTAAAATACATTATTACTTTTATTGTATAATTTTGGAATACAATA TTCAGTTAGCAAATCAGCAAACTTTCCTTTAACATTGCTCGGTTTGGATT TAGTTGTCTTGGAAACTAACAGAAGAGTATCGTAATATATTGTCAATGAC TATAGCAAAGATGGCTTTACTCGATAAATCTATCAGTTCCTTCTTATGAT GAGAGAGCAAAGGTGGAGCGTTCGGCTACGGTGCGCAAGGTGGTGGGTTC ATCCTAGGCCGGGCCAATGACTTCGTTCTTAGTACAAAAGGATACTTAAT GCCTTTCTGCTAGACTCTCAGCAATTGAAAAGAAGGATCAAGGGGGGTAG AGAGAGTGGTGCCCTTCCCTACCTTCGGGTAGATAGCTATCGAAGAAGGA GAAGCCATCGAGTCGCCTCCGAATGCGGTTGAAGACTCACTTACTACTAA GATGAGAATATCAAAATTTCACATTAAAAACTACAGCTGTATTACCCATG AAACATAATTGGATGGTTGTATAATGTTATCATATACATATTGATAGCTT GTATCTTCTCATCGTTGTAGATCATGCAGTTAATGTATCGTGATCATTAA AAACTCTCTCGCCAACTTATACAGTCTGCATTATGAAACTAACGGCTTGT CAGCTTTAAGTTATCTGCGAAGTTTTTAATTAATTTGGATTTAAATTTTT TTTGATATCTGATACAAAACAATAAGGATGGATTTGATGCTTGTCACGAA AAGCTGTGATCCGATCTTCTTAACATTATTGATTAGATTGGGAAGAGGTT TTCAGGTTTAAAGGAGTTTGATTATGAGTAACTGGTCAAACTCTTTGGAG ACTGTGCGGTACTGAAATCGACTGTAAAGCTCAAGTGTTTAATCATATTC CGTATAAAAATCCCTGGTCTGGTAGCCAATTGTTGTAACTTTTTGTTAAC TTTTTCCTTTGTTAATAACGATTATAAAAATCGATTTGCTCAGTTTTTGA TTACGTTACTAAAAGTTGCTTCAAAAGTTAATCACACGATCAAAAAGTAA GCAAAACAAAATAATTTCTCAACGCAAAGTTCAAGTTCGCAACAATAAAA AGAAACAAAAGACTTCCAGACCGGGGTATCTTATACAGTTAATATATGGT TAATCGAACCTTTTTCTTTTAATACTTCATTCGGCATTAGAGCTAAGGCG CGCCTAGCACCTCGGCATATATTGCCTTCCTGCGTTTTTCTAAAAGAATT TTTTACGAACTGGGAAGTATATGTCGATTATATAACTCGATTTGTATATC GCACGTTCATTAAAAAATACTTAATGATACCTTCTAACTAATCACCTCTA ATTAGCAAGGTGCTTATCTCGTCTTTGCGCAATGTGCTAATTTTTCCTGA AAATTTTAATCTCATATCTTGATTAAAGTTATATTTTTAAAACCATTGAA AAAGTGTTTTTTTCATTCTTCGTTTACCAAGAACCTTACAAAAAATGGAT CCTTCACTTTTGGAATTGCTAAATATAATTTTCATTCATTTCTACGATTT ATTTACTTCAATATAAATGTTTTCTTAGTTTGGACTATACACGGTCATAA CAATTATACCTGGTAATTATACAAAATTTCCTGCCTTGAAAACTATTAGC GACATTACCAATATAACTTATGTTATAAGATTGTAATTGTAATGTAATGA TGGTCGGTAGGTTGTTAATAAAGTATAATAAAGATTCTGCTGATGTGTTG TTAAATTTTGGTTTAAGGTTAATTTAAATTTTAAGGTTTCTTCTAAAAGC TTTTTGGATTTTTGTTGAAGTTTTACAGGTTTTTGAAATTTTGTGATTAG ATATCATGTATTGATGTTTTTGGTGAATTGTATTTATGTACTGGAATTGT CAATTCATGATAATCATTACGTAATGTTTTCTACGGAAAGACCCCGGTTT TTGCCAGCAGTGGCAAATTTTATACAACTTTTGTCTAGTTTAGATTAGCC ACTATTGGCTAAAACCGTGGTATTTCCGTAGAAAACATTACGTTATGAAT ATCATGAATTCTTTTGTTCTGCAATTTGCTCAAAACTGTGATGTAACACT TTTAATAGATGCTCGTAAATTTGAAAACTTAATTTTTGAATCTCTGTGAG AAGACTGCAGAGAAGGGAACTGTCTGAAATGAACACTCTAATGTTATTGG TCCCTCCTTAGTTATATTGAATATAAATAAATGCTTTGGGTTTTTCAGTT GTTTTTTTTGTTGAATACTACTGGTTACCGACAGGTAGTGAGAAGATTCT TTATCGATGAAAAGTATCTGCCTTCTAGAAGATTTTGAACGGTTAAAAAC CTTTGGGCATCTGTGAATCCGGACGTTCGCTGTTATCTGAATATGCTTCC CCTAATATGGATTTGGTTATTTTGTAGCGATTGATGGGTAGTATAACAAA AGCAGTGGCAATTTATTTGGTTCAAGTCTTAAATAATATGAGTTTGAGTT TCATTTTTCATTGTTTTGTATCGTAAGGTCTTATAAATGATTTGTAGTAT TTGAAACTCCATCTTTTTTCATTGAAGTTTCCAAGCAATTAAATGTCAGG ATATTGAAAGGAAGTTAGTACTCAGAGTATAGCTCTCAGGAAATGATTTA GCATTAAGGGTAAAGGGTTAACTAGAAACCTAGTCTTTCTTGAGCCTTGT GTGCACTGACCTTTATACGCTATACATGCTACCATTAGGATGCCACTTTC CAAAAAAATTATTCGATGAAAAGATTTTTTTTTGGAAAATGCCTCCAGGG TTTCTATAAAGGTCGCTTGAAATTCTCNNNNNNNNNNNNNNNNNNNNNNN NNNCCCCCCCCCCCTGGGGATACCTTTTTTGGACTTTCAAAGTCCCACTA AAGGGTAGGAAAAATAGGAAAGTTTTAACTTTTTGCCCCCAGAAAGATTG AAATTTGGTCAAATTAGTCCCAAAAAGAGTCGTAGAATTCACAAAACTTT CTTTTTTCTATCTTTTTTAGTCCTGCTAAGGGGTCGAGGGTCGAAAGTAG AAGGAACCCCAACCCCGGGTCTTATAATTCATTTTCTTTCCCTTTTTTTC TTTTTTCCTTTGTCATGTATCTTCATGATTTTCGGTAGGTTAGGGGGTAC TTGAATTTTCATTTGTTGATTTCTTCATTGTACTCACCCGAAAGTTCCTC CTTCATTTGTATTTCAGAATTTTTTCTCAGTTGGGAAAACTTTGTTTAAA TATTGGCAGATTATGCAGTGCGTGATTCAAACTGGCTTTAGACTAAACTA GCATTAACAGGCTATTTATTTACCGCAAAGTATTTATTTGAGTAGTAAAT TTGGACGTGCGGCTATTTTGGACTAGCGTCTTTTATGACGGATTTCACAT TCGATAGTGATGATAGTTTCTAGTCTATCAACTTTCCTCTCTCGCCTCTG AAGATAGGCCTAGAGCCTAGATTAGTTTGTAGATAGGATTTTTCTTGCAT TTAAGGCAGAATCTTTTATTTAGATTTAGGATATGTAAACTTTTTGAAGA TATTTTTTCATCCTCAATGGGAGTTTGGGAAGATTACGTGCAACATCAGT CTTTGATACATCATTTAAACGTCATTTTTAACAAGTTTCAATCACGTTAC AACGTCATAAACATCAAATGCTAAAAACAAACTTTATACCATCGTTATGT TTGTCTAGAAGCTTTTTTGAATTTTCTTCTCTGTCACATGCTAATTCCCT CATAACAAAAAGCCTGGCATTTGATTAGCATAAATTTGTAAAAAAAGGTG ATCATTTCGTGATCTATGAGAAAAATCAAGTGATACAGTTTTTATTGTCA AATACAAATCTCAAACAAGCATTTTGAATACAAGGAGACCTTTGGTTTCT TGGAATAATGGACGAGAATTATCCTAAATCACCGTATCCTAGATTGCGTA GTGGTTCCTTGGTAGCTGTTTTAAAGCATAAAAGAACTCGATTACTTGCG GCTCATGTTGAATATAGCTCGCTCCCAGGCTCCCACAATGTAAGTGAATT ATTTCGAATTTTATTATTTGAATTTCTGACCCTTTTGTATTTTTAGAGGA ATTTCTGACCGTAATTTCTTCACTGTCAATAATTTATGTTAATGTTCATG TACTTGTTTTTATCACTTCAAAACCTCAATACACGAAGACAGAGTAAAAA GCTGCGTATGTATGGTCTAAGGTTGAGCAATGATAAGTTATTTTACATGA CAAAAACTTTATGAATTATTTTAATAAAAAACAATGTTTAGGATTGGGAA ATTTAAAGGAAACTTGCTTAAAGATTGTGTTGACATTTTGAAACATTATG TATCCCCTTAGTGGAAATAATGATTCAACGTCTCTTTACTGCTATGATAT TGTCTTTATTATTGTGATGAATTATAGTTATTTTCGGCTGTTGAAAAGAC AACCAAGTATTAATAATCTGTAGTGTAAGAGAGCGCCCCCCTCCCCACTA TCAATTCACGCAATCGCATATTTTTTACCCAAATTCACGCATTCACGCAA TGTGTTTTCGCAATTCACGCAATGTGTTTTCGCAATTCACGCAATTTTTG TTCACGCAAAGCTTTCCAATTAACACATTCACGCAAGTGAAAAAGCCCAT TCACGCTTTCACGCAAACTGCTGGGGCCCCATAAGACATAGGAAAGATTG CGGGGGTAGGGGAGCTGATCATTCTGGTTAGCCAATCATTATCTGGAATG ATTTTTCAATCTCCAAATCTGTTGCTGATTTTTTATTATTTGATCCAAAT TTTCGATTGTCGAGTCCAGCATTTAAATCGATCATTGAACGAATCTCATT GTTTGACTATGATTTTACAAATTTCTTATTTTTCACGGTTGATTTAATAG CAATACTCGCGGAGACCCGATAAATCAATCTTAGTATGCCTTCCCCATGT TCACATTAATCATCAGTGAAAATTTCTATAGGATTAGCTAATTATATTTA AGCCAAAGGTGATCCATTCATCTAACCCATATAACTCTTTAGAAGTAAAT TTTCAGAAGAAAGTAACATAATCTATTCTTTAAGGTTGTTATAGACATGG CAAGGATATAGAACCGGATCTACTGGAATTTCTATATCTTCTCTTACCAG ATAAATATAGCAATGTCATTTCATTTTTTTTTTCTTTTCGTTAAAAAAAC TTCTTTTTGCTATCGTGATATTTCCGTCAGTCAATTTAATGACAAGATTG AGGCTGAATTACTATAAAACGGGATCGAGGCTGAAAAAATGTCATATGGT TATGGCACGCTTAAGTTCATAAACTGACTGATGATGGAGCTTACGAGTAT TCAGTATTTAGTAAATTTGTGCTTGCTTTATGTTCAAAAAGGGGTGGGGT ATAGTTAATGGTAGTATTGAAATGATCGCTAGCAAATATTCTGTATGTAA ATTGTTTCGAGATTTTCCGCTCAAATCTTACCAAATGCACACCAGCAAAA GTTTGGGAATCACCTTTTCAATTTAAAATCTTTTACAGGCCCGGAGGAAC AACCGTAACAGTGGGTAGGCTGAAGGCTCAAAATGATATAAAATTCGCTA GGAATTCAAGGAAAAAAATCTCATTTGCTCAAAAGTGGGGTTGCTGAAGT GTCCCCAGTCTCCGCGCCTCTACCGGGCCTGTTTTAGCTTTAATTTACAT CCATATGAAACCAACGCTCATACACTACTAGTTTTTGTCTATATGAGTTA ATAAGTCAAGGTTGTCTAGACAACACACTAATAAATGACGTAATGTCCTT GGCAAATCAGATTTTTACTAACAAAATCAAACTCATTGAATGCGCTGATT ACACATTTACGTCTTTCGTATTGTAATTAGCATTTTCGGTTTACCGCAAC GAATGCCGGTTATTTTCCTTTTCATCGTTTTTTTCTTTGATTATATTTCT CATTGAAAAGTCGCATATGAAGGTTTGGATAAGCGAGACGAATCATTTGA CTTTACTTTTTTGTTGGAGTACAGTAGGACCATACCGAAAATTTTTCTTG TTGAAAAGTCTCATATGAAGGTTTGGATAAGCGAGACGAATTTTTCGACT TTACTTATTTGTTGAAGACAAGGACCTCCAAACGTCCTTTTCGTTGAAAT GTCTCTTTTGCGCATTTGGATAAACGAGGCAAAATTGCTGATTGTTCTTG TTTGTTGGAGTATAGTAGGACCATCGAAGAATATTTCTAGTTGAAAAGTC TCATATGAAGGTTTGGATATACCAAGCAACATTTTTAATGATTTATGTTT GTTGGAGATGAGAACCATCGAAAAATGTTTCTCATTGAAACAAAAACGGG GATAACGAGGCAAAAGCCGCTGGTCCAATGACGCTCATTCTTGGTATTTT TCTTTTGCTTTTTTTCAATGAAATGCAGTCAAACTAATATGAATAACACT GTAGAGGTGTGTTTAATTCTTAGTTTTACCATTGTCGAAACGATAACTCT CATGTGTTACTTTACCCATAATTTGTTAGTTTTAGATATTCATTGACCAG TAATGGTATGGAAAAGTAGAATCTTATTTTAACAAGGATAGATTTAAGCG ATGATGAATTTCAATTTGAGTAATATAAGTAATGAGTAATCGATGATATC TCTATTTACACTCTGTCACAATGTATTGTACCTTCTCTCAGAACTTCTTT CTTGAGTATTATATTCGATCTTGTTCATTACCGTTTTGTTAATTTCATTA TCGCGAAGAATATTCTTCACTGCAATTGTTACTAGGTGTCTTAAGTAACA AGATTAAACGCTAAGTATTCTTATATTCTTCATAACAGGAACTTAATAGG TGATATATTGGTCAATTAACACCATGCGCTTCTATTCTTGCCACAACTTC NATAGGTGATATATTGGTCAATTACCACCATGCGCTTCTATTCTTGCCAC AACTTCCAGACATATCTTTGTGTGTACGTGAGCGCTCGTTTTTTTCAAAA TATTGATGTGCGCGGCCTACGCTTTTATAAATAAGTAGCATCAATAACAC AAACAAGATGCTAGCGGATAACGCGCGGGAAATTCGTGATCTCCTGATAA AACTTAATTGTTCTTAATGACTGGTCTATTAATCTGTCATACATAAATCT TTAAGGTGACTGTACTAAGTAGGTATTAGTGATTTGGCTCATGACTGAAG ATCTTCCTTTTGGTGACTTATTAAAGATAGTATGTCATCGGAAAATGCTG GTGGTAAACTTTTTAGGCCCCAATGTTCAAAGTATTCGCGTGATTTCCGT CTCAAATTTACGTCTGAAATTAAAGCCCTGCATTGGGTAGCCGGATGATG TCAGCTTCTGAAAAGTTTCTACCTCTAAATTCAAAGAATCTGGGTGCAAA GGCGACCGGACTTTTCCCCAATCTCCCCAAATGGCCCTCGGGGGGGGGGG GGGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGG GGGGGGGGTGATTTGACGGTTAGGGGACGCCCAACGTGGAAAGGTCCGGT ATTCCTGCATTGAGCACTCTTAGTCAAGTGAAAAATAAACAATGTCTATC TTTTCAGGATTTTTCTTGAATGTGATAGAATGACCTCGGATCATCATTAC CAAGTTGATTATATCTCAATGTTACATAACATATCTTGTCATTTACGCAA AAGAACCTCACTGCACTAACAGTGTCCAAACTGTTTGCGTATTATCCACT CTAACATCAATCCATCGACCATTATAAAATGGCAAACGGCTTACTGCACA GTATAATCTCTCCTTTTTTTTGAGATACAGACTACCATGATATAGTTTTC TATAAATATCACAGTTTGCAGTGAAACTATTAACGGATTAAACTCGCTAC TTTTTGCAAAACGGTTTTTACTTGCTCTCACCACGAAAAACTGATTTACA AGCTTTTCCATTATAACTTTCTTAGTCAGTGAGGTCATTTCATATTCAAA TTGCGATAAGCTTCGAGCCTTTACGTCACACGTTAGACTAGTATTGCATA TCTTATTTATTCAGTGGTTCAGCTATCTTTTTGGGTTTGGAGCGTTAAAG TCTTAAATGGTTTTTGATTTTGATTTTATTTCAAAGCTGAAATGGATTGC TATTGCATATAACGGAGTCGAAAACCGGTCCTGACATTATTTCTGGTTTC TTGTTGAAGCGGGAGCTTATTGATTTCCAGTTTTGCTTTGGTCATTGCTC GTAAAATTTTAAGATTATCAAGAAATTCTTTTCCATAAGGATTTTTTTTC GTAATTGATGATTTCATGCTTGTTGTTTGGTTCAATTCTTCCTTAGAATT GTCTTAAAACTGTTAACTCCGCCTTCGAATTTTGAAGCCAGGCTTTGTTA CTATAGCCGGTCAATCTGCTAAATCTGACCTGAAAAAAGGTTGCTTTTCA TCGTCTTTTTTTTTATGTGACCGTTATATGGTATAATTGGATTGTCACTG CAATAAATATATGGTATTATATAAAGGTATCATGGTATTCACTGTTGTGG TGATATATTGATTTTACCCATGCTGTGAGAAGACTCAAATTCGATGAAAA ATTGCTCGCTTTTTAATTTATTTTGAATGATCATCCATGGTTTTAGTTAA CTTTGTTTCATGAAGGTTCGCTTAATGGTTTCTGTAAAATTGGAACAACA ATGCAATACCTGGACTATTGATGCTTAAATTCACTTTCTGCCTTGTTCTT GGATCATTTTGTACAAAGGCATCCTCTTCCTGGAGTTAAATTACTTACTT ACTTCTTTAGTTCGTTTTCGCAGGTGCCAACATTGAGTGTTTAGGGCGAA GGTCAACCATATCCTTCTTTTTCTTTTTCTTCAAGACCTCTTTGTAGAGC TCGTCTGCTGACCGACCATCAAGCACGTGATCTTCGAGTGTTTTGATTGG TCGGCCTCTCTTCTTCTCGTTAAGCACTCGTACTAGCCTGGAGATCTTAG ATATCGTGGCGGTTCAAATCGTTTCTTTCTCCCACAATCGAAAATGGACT GGACGTTGATTGACACTTTTGATAATATTGGAAGGGAGACATAGATATTA AATTGAAGAGATTTGATTCGTCTGGTCGGAGCTCAAAATTAATTTCCATG CTAAAATCTGGCTACTTTTGAAGCAATTTGTTTTATAAGCCGATTTCCTG TTATTTGGCGGGTGAGACAAACGACTCTTCCTTGTAGAGATTTTGTTTTC AATTAACTTTTTATATACTGAACTGTAGCGAAATTGTTGTAATATATCTT TGTTTCGGATAGATTGTACTGTTCATAATGTTTACTACGGAGCGATACTA GTTCCTTGGCGTTGGCATCAGTATATAGTTTTTACTTTTGACCGCGGATA CCAATTCCCTGGCAGTTACGTCTACGGTTTATTAAAAGGAAAGAAAGAGG TTATGTGTTGGATTTCGTTGCACTCGCGAGTAACCTTTCTTTGTAGTTTT GATGATATTTTGCCAGGGATTTGCTTAGAAAGTTTTCAATGACGAAAGAG GCCGTCTACCATTTCTGCTTCTTCAATGGATCGTTATATTTTCTTGTTTT TTCTTTCATGAACAAATCAAACACTAATCAGGGAATAATTCTTCGGCAGT AGTAGTGGTTTCAATTAAGAATGAGTTTCTTTTCTCTGATTATTCACCTT TTCCACCGTAGCTACCAATTGCCGCGTGGGCATTTTTTGTCCGCTGTATC CCACTATATCACCCTTTTTTCGCACCTATAGACAATAGAAAAATGTGTCA AAAAAGGATTGGATCGAGTTTAGGGGGATAATTAAATAATTAAGTGGTAC GCACCTGACCGCGCGACTACGGTCGAAAAGGTGTACTGGGAAAATTCTAT CAAAATAATGTTTGTTTGTTTGTTTGTTCACAACTTCTTCCTTGTTTTTT TAATATCGTAGAAAAGGATAAAAATGCGGTCCCCTATATCTCCACCTTCA GTTCAACCTTAAAGTCTATAATTGAATTTAACTTATTTGAAAAATTCGTC TTGTCTCCGCAAAGGTCGAAGGAGGAAATGAATTTTATGCGATATTAAAT CTCTGTGGTTTTCAGGTTTTAGCGGTTAGGCCAGACTTGTGATGAATATT GAGAGTCTGTTATCGAAAGTACACTATATTCGAGTCGCTTTCCAAGGAGC AAATCACTCGAAAAATGGTGTACGAGATTTATGATTTATTTTTGATTTAT GAACCATACGCGCTATTTTTAACAAGTTGGTATTTGAGTTTTTAAAGAAA TAAATGCTTTTAAAACATCTTTGCGAGAGTAAAAGTAGGTTGGCCACGCT TATGGACTTTTCTGACTTGCTCTGGCAGCAATCTTAAGAAACACGGCGTG TGACNTACGCTTATGGACTTGTCTGACTTGCTCTGGCAGCAATCTTAAGA AACACGGCGTGTGACAATTTTTAGCAACTTTTCTTGCTTCTAACTTTTTC GTTCTTTTCGACATATGCCATGTGTTTCTAGAGAACATACGCCAGCAATG AGGTACAAGTAAACTCGTGAGCGTCTTCAATCATAAATTTATAAAGCCTG AAGGGCTAGATGTCGTGCTTTGGCTGAGGAAATGTGTCTAGGTTAGGTAG GAAATCCTACCTAGGTCACGTGACATTACAATAGAATTTCAGCGCTTGAC CAATAAGAAGCTTCACAGGTTTTCGAAAACAATAGCAGCAATATTTTTTG TGATATTCACTTTTTTTTTGCTTGGAAGAGCTTAAAGCACAAAATCTAGC CCTTTGGACTTTACAGAAATTTGCGTCTTCAATGTGATTCTATTGTTTTG GGAGAAGGCTCTACTGATACCACTACATGCAATCAATTTGAATAATTATA TTCCATTAAATTCACAGTTGAAAGTTTGAATGTTTAACAACAAAATCTTA TCAGCATTTAAAGTCACGCTGATATATCATTTCGTTGAAATAGAGAAATA ATCGTTGTTTTGAACATACCAGGCAATTGATTTACTGTTTGTTAATAATA TCATGTTCTCAAGGAAGTCTCATGGATGCTCGTGTTCTGATTTACGATTG GTCGGACCGGAATGGTATTTTAAGGTGGGGTTTCTAATCCAGGCAATATT CTGTGAATAATCTTTCCTGTAATATTTCTTGTTGGACTTAACATTTTTAA CGACGGTGTATAGAGAATTATAGTTGGTTTTGTAAAGCTAATTTGTCAAT TTCAACATTGTCAGCGATTTGCCAGAGTTTGATGAGACTTCAAAAGCTTT CTAAAATTTTCTATTTGGATTTGAAGGTTGGGCCGAAAAGGGTGGCACAC ATGCTTTGCATATCGACCGGTTTGGATGTCTGGGGGGTCCTGGGGGTCTC GCTATAAAGGGATATCCGCATGCTTGCCACGTTTTGGCCGTTGCCATATT TTAGCGGCATGATACTAGGTTGCCAGGTGTATGACACCAGGGACAGTCTT TTGCATTTCGTTTTTTATCTCTTTTTCTTTTGGTTTTGATTAATCCTAAA GGCGGCATTGTTCGTAGTAGTCAATGAAACATTTTTGGCTTAAAAAGAAA AGAAGAAAAGAAGTCTGTGAAACTTTTATAAAGTTGCTAAGGAAATTGTA TGGTATCTTGATCAAGAGTTATCCTAACTTCCCGAATCCTGCCCAATTAT CTGTTATGTTGATATTATTGTTGTTTTCAAATGTAATACAAAGTTAATTA CTAAAGAATTAAAAGGAGTTCAATTCTCTTATCTTCTATTACTATAAAAC TCCTCATTTGGCTATTGTGTTAAAAAATACCGCTTCAAAAATATTTTTGT TTGTCTCTCATACCATTTGTAATTTGCTTGGAATACTGTTTATGTTTATG TTTATGTATTTGGTTTGTTCGTTTTATCAATCTTTCTTGGTTGTGTGTGT TGAATTTGTTTCGGTAGTTGTTGTCATTCATCACCCCTCCTAGCTGGCAC ACAACTTTGTTTTAACGTTCATCTAACGTTATATTGACGTTATGAACATT AGATAAACGTTGAAACAACGTTGTGTGCCAGCCGGTTTGTTTCTATTTCT AAGTACTAGTGGTGATAATTTTCTCGACTGTCAATGTGCTGCTANCCAGC CGGGCTGTTTCTATTTCTAAGTACTAGTGGTGATAATTTTATCGACTGTC AATGTGCTTATTGAGTTGAGTTGAGTGTAAAATAAATTGTTTTTCTATAG ACTGTACATTAGTGGTTCAATATATTATTTTCAAAATGAGCTTTTCAAAT ATTCAAATTAGTGGCAATTTCACAACAGACAATTTAATGGGTTATTAGCG ATGGCTGGTTGAATATTGATAACGCTTTGTATGATATTTTTAATATATTG TTATTGATAATTTCTAACGTGCGGAGTTTTAAATTTTCAGTTAGGCTGGT TGATTTGATAAGTGTAAGTTGATATGTCTGTCACCTCAAAACGTTGGGGC AGGCTGGAGAATTCAAAAATTGTCTAATTCGGCTGAAATTGGGCACACGC AGAGTACACGTTTTGCACACGTAGAGCGACGACGGGGAGATTAAATCACC CGGCAAATCTTAAGCTGACCCGTCGAAAACTTTAATGTTTATCATGGGAG TTGATTTCCCAAGTAGAAAAGATACAAAAGTCCTTTTACTCGTTGCTATT AATCATCATATGTGACAAAATTGATTTCTCATCGTTTCGGGATCAGGAAA TCTTTATGTTTTTATATGAATTATATAATCTGACGTTACTGTCCTTCTAG AATCTTCTATCTTCCTTCAACTCTGTAAATACAATAAATCTTTAGAAAAG CCTTTTCACTTTTCAACATTCGAAATTTGTCGTAGATTGTCTACAGTTGA CGCTCTCTAATTCGATGTTCGAATTGGATTTTCACTGAACAAGGGAGCGA ATCCAAAAGTAGAGCGTCGTTTCTGAGAGTTACTTGTTAACGGTACCTTT AATACAATAATAGCGAGTTTATGTATTTGCACTTTTGAGGACGGTAGAGT TACTGAAGCGATTAGGAATAACCCGCAGTTCTGACCCGCAATATCGAGAA TGGTAAAGGTGTCGATTTACAGTCGTCCTCAGCTGGTCTGTTCTTAGTAA AATTAGATCCTTACCGTCTCCGTCGCAGAAAAACACACATACATAAACTC GGTAATGACTGGTTTTTAAGGGCTATACTGAGAAATATTACCCGAGGTCA AGTAACGACCGAGCTTACTTAGCATTATTGAATATATCGAATTAGAGAGC GTCAATTGTAAATGGTTATTTCTATTACTTTTTTCAAGCCAGCAGCTTGA TATCATAAGGGTAATCTAGATATTGTCATCTTTGTAAAAGGTTGTTAATT TCTGTTAATTTTATTATTCCTTAATCCTTTTATGATTTCAATGTTATTTA TTTTTGCAACTTTCCTATTTGATTGAATGGAGTTGAGCAGTGTTGTTGTT GGATGATGTTTTTCTCAACTCAAGCATGAACTTTACAGAAAAAAGTTGTA TGGGTTGTGTTGAAGATATCTATTTTGGGGAATTTCTATAGATTTGTACA CCCCTGTCCCGCAGCCCCGGTGATACTTTATGAGAATAGAAATTCTATTG TTTCAAGGTTAAAGAATCCAGTTTTAGAGTGCAATTTTTTTTAAACATTG AATTTCGAATGGGGATATTTGAAATTAATAAAAGTCATTATAATTTTGGT TGTTGCTATTTTTAGAGGGAAGTTACTTCATAATATCCCGCATCACGTAT AATTCACTCAACGCATTTCTTGTTCTGACTTGTCTTGATACTTTTGACTT CTTGTGCTTTCAATTCAATTCTTTTGTTTTCTTTACAATGATGACGTCAT ATTTTCAAGATATTTGTATCATTCTTTAAGCAATCATTAAGCTGCCAATA AGATTAATTACTTTATATTAATTAAAGTTCGTCTGGTTTTTCTTAATTGG CTTTTAGTTTTTGGATATAAGAGATTTCTCTTGATTTATTGCCAACTAAA AGCCCCCTAAAAGCAAGCTTTTTAATCAGAAGCTCCCAATTTTTCTTTAA AGCTTCCTTATCAAAGTTTAACATCAAAGTTAAATGTTTGGTTTTCCTTT AAATTGTGGTGTTCTTAGAAAATAAATTATTCTTCTTATGAAAATGCGGA TTGTAAAAACAATACCATTGGAAAGGACATTGCATCTGAGTTCAAAAAAT TCTTGAACAGATTAATCTGTCATCGTTCAGGAAATAACCTTTTATTTTGG AAGTCACCGATCATTTAACTACTACCTTTTCGTATGTGAAAAAAAAATTC ATTAACATTTCTTCAATGTAGAGAAGAAAAAAAACAATATAACAAAACAA TGGAATCGATTGGTTAATACTGAAAATTTCCTGTATTTTGATTGGTTGAG AGAACTACTAACTACANAACAAAACAATGGAATCGATTGGTTAATACTGA AAATTTCCTGTATTTTGATTGGTTCAGAGAACTACCAGCCACTTGAATAA TGGATTTGATTGGTCGATTGGGTTCCTCGTTTCCTATTTTCTACATCAAT CCGTTTTCAACAACACACGTTAAGCTTCAGCATCATCATCCAGAGGCGAT CACCACAACAAACCAGAGGACATCACCATCCTTTGTCGCTCATCACAAAA GATCCTATTCGACATCACCGCGCGGGCATGGGCGATCGCGATCTCTGTCA TCAGGTTATCATCGAAATTACAACACTTTACCAACCAAATCCTCTTCAAG AGCAAAGAGCTTGACAGCTTTGGATCAAGTCGGGACATCGAGTTTAAATC GATTACAATCGATTCAACATTCAAACTCTGTTGAATATCTCAGTCAATCT TTCGACGATACAAAATCAAGAACAGCATTTGTTGATGATTTAGATACGTT GAATTTGTATGGATTTGATAAAATATTGAATGATTTTTCAACAAGTATTT CATCCTCATCACATTCACCAGTTAGTTCACTACCTAAAAATCGTACTTTA ACGTTAATTAAAGAAGAAAATTCGTTCGAAGAAGAACAAGAGGAGGAGGA AGAAGAGAGCATTGATAAAAATGAAATGAAGAGTTTGTTATGTAACGAAG AAGTGAATGAAGAAACAATCGAGACAACGAATCACATTGAAACAAAACCA CACGATGATTTAGAATCACCAGAGAAAATGTATTTCCAATTGACCAGTAC AGCCTCTACTAAATTACTATCGACACCTGATAGATTGGAAACATCAAATA CTTGTTTTAGAGTATACGAAGAAAACACAGATTCTCGTTGTGAGGACAGA ATCTCGACTAAAGAATCAAGTAATTATTTACCTTCTTCAACTGGAAGACT GAGCAAATCCATTGTTGAAAATGGAAAGAGCTTACAAAACGATGATCCAC AGAATTTTTCTTCTTTTAAACCATTAGACGCTTCATCAGGAGAAAAAATG AGAACTTTTGCAGTTTTTTCGGAAGAAAAAGAAGATACAGACAGCTGTTG TGATGCTGATGATGAACTAAGTTTTCATAAAACCGCTAACATTCGCCCGG TTCGTATCCCGAAACACCTAGACGAATCCGATAACTGCCCCGTTCGGAAT ACTGAATCCATGTTACGACCCGTTCGGGTTAGTCGAATACAGGATGAATT CAAACATCAACGACATCGAAAAATCTCACGCGTTCCTTCCTTAGATTGTC CTATATTACTTGAAGATAAAGTTTTGCCTCATATTGAGAGCAATAAGTTT GAATCTGAGAACCAATTTCTTGGATCAGATCATATTGATCATTTACCGAG AAGTTGCAGTTGTCCACAAGATGTAAATACCATTTATAAGCGTTTAAGTG ACGTCGGCTTACACGATTTACCACGAGTAAAACATAGCGTTGAAAGCGGC TCCATGTTTCGGCGCCAGGGTAGTGATCGACGTTCACGGCGACGCGTTGT TGCCAACGGAGATTTACGGCAACGAAAGAAAGGCATTAGTACTATGGAGT TATCGACGCTCGATTTATTGACGGTCTTCGATATGGCAAGTCGTAATACG CCGTCCAGATTATCACTACGCATGCGTAAAGAATCAGAGGTAGGTTTTAA CATGTTGATTTATCTGATCATGACTTTTCATAAGAGAGAACAACAATCCG CAATTCACCAGTGATTTTCTTGCTAGCTTGATTTTTAGGAGTGGGACGAT ACACTGTCTCAATCAAAAACTTGATTGTTGACTCGAAAATTCTCTTTTGT TTATTCGAAAACCTTTCCATTTCTATCGTTTATTCAAAAGCTTGATAATA TGTACCGAGAATGACTCTGTAGTAAATTTTTGGGGCTATTTTCAACGATA AACACCATGATTTTGAAATCTTTAGCGTTTTTGGAAGTTTAGTTTGAGTT TCTCTGTCTATTTGACAAAGCTAACAAAGCCGCCCTCTTTTCCATGATTC ATTCGATCTCTATAAAGGACGTTTCTGAGGAATACCTGGTATGTCCTATT AGAAGCTAATTATATAAAGCACCGATAGCTGACAAAACCGTACTTTATTA ATTAGTATTACTGATTACGGTTAATCACTTTTTTCCGAATTTTTCTTTTC TCTTTTGCTTTTTAGAGACATGATTAATGTTTCGAAATTCTGTCAAACTT TCAAAATAACAGTACTAAAATTGATCCAATTCCAATCCTCTAGCAAGTAA GCTATTGAATTGCTTATTTGTTTGGCTGTCTTTTCTATAATACTTTGGAT CTGGCATTTCAATAATGTCAGCCAATAAAACCACAGCTAAAGTTACAGTT AAAGTTCTTGTATATACAGGCTCAAGTTATGTCCCAAATTTCCTCTGTAA TGCTCGTTGTGGTTATTATGTCCCTATGCACGCTTGTTTGAAATAAATAT TCAAAAAACACGTTCCTAAAATTCTAAAGTAGTTAACCAAACAAACGTAT GGAGGCTGAGATTAACCAGGCGATAAACGATAAAATATTGCTATTAGAAA AACATTAAAAACCGTAATGTTTGTCTATAAAGCATTTTCATGGTTAAACC ATTTGACCATAATTTAATTCCAAAGAAAAATATTCGAAAATCCTTTCTCA CGATATTTTTCAAATTCGCGGCCGGTGCATTGATGTAAAAAGTGCGGAAT CTAAACTTGATTATTTTTATTTGATCTTGTCATCTTGGTTTTGATTTTAT TTCCGTAGAGAAATAGTGTTTCTGATTCTATTTTAACAACTTTTAATTAT AAAATCCTGATATTGTCAGACCTTAGGATGAGAATTGAACTTTAGCTTTC ATAAACTTTCGAATGGTTCTGAGCTGTCAGATGGATTATGTCGAGTTTGT TTTGCTAGAATATCAGGTAAAATAAAGATATTTTCAAAGTAGTTTACGAA ATAAGGGAATTATTTCGAGATTTTACGTTGCATTTCTAGATATTCATTGC TGTAAACTTATCTCAAATTATTAGTCCAAATGAAGACAGACTTTACTTGA ATTTTGTTGACGCAGTTTACCATATGTCCTATATTGAAAGTATAACTTTT CTCTTTCTCAATTTTTCATGGATATTTAGATCTGATGTGGTCAACTCGAA ATTTCAGGATGTTTTTTTACGTCTGTAGATAAATTCGTTTCTTTCTTGGT GAATAAAACCCGATAACGAAATAAACTTTCACAAAAAAAGGCCAAAAAAA CTGTCATATCTTCGTACTCAAAATCATTAGAGAAGCAAGCTTTGGATTTT GCTGGTTATTTTCAAAAATATTCAAAGTACTATTTCTTTGGAAAATGTCA TTGACCTCCAGATGGTCTACAAGTCTCTGATAGAGGAAGAAAATTTAGTA AAATTAAAATCAAAGACGTGACCTCATTTACGCTTTTTGATACTATCTTT ATGGATGGATAATAAGATAGTATATAATGATGTAATATTATCACCATGCA TAGTCTAAAAAGATTATTTAAAGGATCCAATGTTGTGTTTCCTCTTCTTT ATTTTGGTTCGCTGTTGGAAAGATATGAATTTATTCCTGAAAAAGGAAGA CGAAAAATGAAAATGAAGAATAAAAAAGTTTATCATTTATCACTATGAAT TCTCATTAGTCAAAAGAAAATTATTCTGTTAGTTAAAAACAAAACCATAT GTAATNAAAATGAAAATGAAGAATAAAAAAAGTTTATCATTTATCCCTAT GAATTCTCATTAGTTCAAAGAAAATTATTCTGTCAGTTAAAAACAAACCA TATGTAATGGAATTTTAGAGTAATTTAAAGCCTTTGATTATAATCGGTGA AATTGTAAGAGGGGGTACTAAGATTTTTAAAAACCCTAAGTAGATTTTAA AAAGTAAAAGTTTTATTTTCTCGGCTCGGGGAAGGAAAAATTTGCCGGTG TGATCAAAGATGGTTCATTTTGTTTGACAAGCGCTGTTAGTTTTTCGTTG AATTTCAAAACATTGGATATATGGCTTCCTTTAAACATACTATGGTCTCC AAAAATTGTCATATTATTTCATCTTTGTAAAATGTCAATCAAAAGTGATC CAATAGGCTAAAATGGAATTCAAAAGTTTTTATTCAAATGGAAATCTAGT TTTGAAATCGATTAATACTATTGATTATTGATTATTGATTATTGATTATT GATTATTGATTATTATTTATGATTGGGTTTTACTGGACTGGATTTCAAAG ATATTAACGATGATTGTTTATTCCGTGTTATCATCTTTACTTTATCACTT ATTTGGTCATCTGTCGTTGACTTTTATTGTCGCATTATTGATTTTCACCT ACTTCGTGTATTTCCCAAAAGTTAGCGACGAGGAAAAAATATTGGTACGT TTTTGTTTTTATTCATGTTCACAAACTTAGGTTCTATTTAAAAGGGTTTC TAAAAAGGTCTTGCTTCAATTGGGGATTTCCCATCTTTCAATTTGACTTT TTAAAGCAATTAATTGACCAATAGCCCTAAACTAGCAGCTTTTTGGCACA AAATATTTTAGAGCGTTCGTATTAGATGACGTGACTATAAGATGGACATT TTTAACGTTTTTTTTTTGCCCAACGGTTGATCAATTGCGGAATATTTTGA ACGCATGGCGTTCTAATGGATTTAGAACGCAATGTTTGAACGTCATTCCT ATCGTCCTCAAAACACGGAAGATTGAATTTTGATGTGATTCTAACATGAA CGCTCACTAATTCGATTTTCCAGGAGGATTAGATTTTCCTCGAACAAGGG AGAGTATCGAATAGAAGAATGTTTCTAACCAGTAATCCATTGATTTGACA TCTTCACCATTTCAAACACAAATCAATAACCACTCATCACCAGACCTCTA AACAAACATTACAACCCTATCATAACATTTGGAACAATAATTATTCGTTC TCAAGGCGTCAAACGATTGAAACATTAAATTTTAGGTTTCATCTCATAAC AATAACATCAACAACGTTCTTTGACCAGAGAGAGAGACTCTTCAAGATAT CTTAAAAGGTCATGAGAAAAGAAAACAAATCCATAATCATAGCTGAGAGT GATTGATAACTTCGATCTGTTTTGACTTGCAAAGAACTGAAAACTTCCAA TGTCTTTCGTTCCCTTCCTTCAAAAGTCCTCAGAAAAATCAACCCTAACC ACGAAAACTTTATGAAATTTCTTCTTTTTAATGTTATACTATAACAGTAT ACGGCCAAACATTGTATAAAATATTAACGTAATATTGGGTTGCTGAGAGC TGTTCTTTTATGCAAGTCTAAAAGAATTATTTCGGTAGATTTTGAGTTTG TCTTACTTTCTTAACTGTGGCTTGATGTTGTTATGGGGTTGCTGCAAGTT CCCTGTCAACATCATTCTTATCCTGAATCACTGAAGGTTTAACTATAATA TACTTTTGTTATCTGTATCTTTTTTCCCTTGAAGAATACAAACGAACTCT GTACCGGTTCGGAGACTAAGACCATGTTCGCACGTGACGTTTCCGTTTTG CTCTGAAGTGAAATGAAGCCATTCTATTGGTTAGAAGTGACGTAAAACTT GAATGTAACCAATAGAATGGCTTCTTTTTGTTTCGAAGCGAAACGGAACC GTAGCGTGCGAGCGTGATCTAACTAGGTGCCCATCATTGGTTTCGATTCG TTTGACATTGTCCTAACCAAACCATGATTTTCCGCTACTTAAAAGGATGA TCAGATGGTTTGAGATATTCAGATTACAGAAACCTTATGTGGTCCTCAGT AAAACCTCAAAGTATTTTTGTGTAACAATTTTCCCAAATCGAGATATTGA TATTTGAAAAATTTTTGAAAATAGGCTCTTACACGGTTCTTACGTTGAAA TTCTATTGTTTTCATCCTAAAAGCCAAAAACTTATAACTCGTAACTTAAA ATATCTCGACACAAATAATTTTGAGATTTTGCTCAGGACAATAGAAGGAT CCCACATGTCAAATATTACAAACAATCCGATTATCCCTTTAAATTTCCCG TTTATCTTGATTTCTAAGAATTGGTCAAATATCATACTTACCATGCTTAC CTTTTTTCCTTCAAAGTCACCAAGGAAATCAAACAGGATTTTCCCAGGAA GGGGTTTTTTTTAATGACTGAAAGCTTTTATATCTTGTCGATTATATATG GGCACTTGAAATAGGTAATTATCTGGCGCAATCTTCAATCAGATCAAATG GCGAGAATCTTTAGACATACATTTTTTGAAGATTAAGTCACAAATCCTTG TAGTCAATACTAAATTCTTTGTTTCCTGCTTTTAAAACATGAAAAATGCT TTACACAGATTACGTTTGTATTTAATTATCAAATCGGTATCAAAATACTT CATTAAAACAGATAATTATATCGCGATAGCCTTAAAATGATGTTTTTGCT ATCATGCATTAAAAACTCATTAGCGTTTCTTAAAAGATTTTATTTTGATT GTAGAGGTATTTCATCTTTACATCACGCTCGAGTGTTTTTACGTCTTAGA ACCTAGTTAGCACNTTTCGTCTTTACATCACGCGCGAGTGTTTTTGCATC TTAGAACGTAGTTAGCATAAATTTATGGTTTTTGATTTTCTTCACAGGAA TTTTAATGGGACTTTTAATGCCAAAATTTTCATAGTGGGGCGTGGAGAAA ATTTTAATGATTATTGATTTTTTGTTAAAATTTGAGAGAGAATTTTTATT GAATGGTTGTAAGATGGATCAAAATGCAAAATTTCTTAGAGCACAACGCT ATCGTAAAGGTTCCAAGGTACTCCCTTTTTTTACACTTTACTGACCTTTA CTAAGCTGGCACACGAGGTCAAGACAATGTTCATAATTGTAGAGCCAGAG TTTGGTATTCCATTAGCACAGTATTTGCAATAATAACATTATTGCACTAA TTAGGTTCTTTCTCAACTTTATGGAAATCTGCTGGTAAAAATTGTCAAAA TATTTCCATATTTTGGACTAATATCAGAGGCACTTTCATTTAATAATCAA GGCACTTTCATTTAATAATCAAGGCCCTCAAATTATTGCTATAATTAACA ACGTAATATATTTATACTTCTTGCCAACATCATTTATTTCTGTTACTATA ATTAATCTCTTAATTACTTTCCGGTACCCTTAAAAATAGCTCTGATTAAG GGGTCGTTAAAAATTAAAAATATTTTATTCAGAATGTCAAAAATTTGGGT ATTCACAATGCCCCATGCCCTTATATAAGGTGAAATGGTACTTCAAAATG CCTTAATTGGTATATTTCTTTAATGACCTATTGAGAATTTGCGTAATTAT GTTACCATTTTGATTATTATCTAATTTGTGGGATAAATGCGTATATTTTA CGACGCACAACTTGAAAGAAGAAAATCAAAAAAAAGTTTTTTCTTCTTTA ATATTGTTTTTCGAGAGAGTGTGTGTTATACGCATGTTGTTTTTCGCAAG AGTATTTTGAGTTCAGACTACTCTTTCTTTCTTTTGATGAGTTTTTGATG AGTTGAAAGAGCTAAAATAGAATTTGAAACGTTTCGAACCTTTTATGGTA GAACTGCTTGTGGAGTTTTGGCTTATTCTATGTATTTTTCAAGTCAACCT TCGCTTTTCCAAGTGGTTAACTATAAAATCATGGAAAGGGTGAAAAGATC AGCAGTATCAAATTATGTAGGTTCTTAACTTCTGTAAATATCGTCACGTA GGGTTAACCCTTGGGATTCATAGCATCTTTCATGGGACGCAACCATGTGG TTAATTCGAAAGTAGATATTTGAAAGGGGGCATCATTTGGTGTCTGTTTT GCTTTAAAGTTTGTTTTCTCAAGATTTACTTGTATTGATTTGAGCTATGA AAGCAACTTTTTGCTGCTCTCTCAATTTAAAATTCGCAAGGTATTAAAGT TTGAGATTTTCTCCTTGTTTGCTGGTGTGTACCTGGACCTAGACCTCTCA CCATTATTTCAATACCCTAGAGTTGGTACTGGTCATGGCCAATGCATTCA CATGTTAAATTTCCTATTGCCAGACTTCGAGAGGTATCGTGGAAAAGCGA CAAAACTTTAAACTTTATCCCAATGAGCCAAATGTTCAAGTGTCAGAAGC GTGATTGAGATCTTCTTCAATTTATAACAGTTTTTATCAACCTACTTTAA TTCATATTCATTCAGAACTCACCAGTCGCACGTCGACGTCGAATCTCAGT CAAAAGCACAGCCGTCCGAAAACATTCAAGTCGCTCCACAACACCACGAC AGCGTCGCAAGACTGTCTCTACATACACGCCAGCATTTAACCAATACAAT GGCTCTGATGGTCACCTTTCATCGGCTGTTACACCGTCACGCCGATTATC TGTAAGTCAGCTTTATATTTTCTTTTGATTTTGAATTAAAGTACACTCCT TTCTCACAGACCTGGTAGGGTTTTTTCAGCCAGTGGGGTAAAAATGATGG ACTGAAACTCGCAGGGATTTTCAAGTCAAAAAATTCAGTGGGGATGAAAA GATGATGATTTGCAGTGAGGCTTTTTGCTTTATTATTTTAACTGGGGCTA AAATTGGAGAAAGATTTTCCAATGGGTGCGATATTTTGGCCAATTTTTTC AGTTGGAGGGGTCCCACCGGGTCTCTGAGAAGGGCGTTTCCAGTAACATT AACAATAATTGTGATATTGGCTGNTGGCCAATTTTTCCAGTTGGAGGGCT TCCACCGGGTCTCTGAGAAGGGCGTTTCCAACAATAATTGTGATATTGGC TGGTAGCTGCGCAGTCTTTGTGACCAAAAAAGTGAACCATACAAGTTGCA AAATAGTCTATTATGCTAGATTACCAATTTAGACATTAGTAGAAAATAAG CAAAGATAATGGAAGTGACAAACTGATATTATCCCGTTACAACTATTGTA TTATGATTTAACACTCCGTATTATTGTATTATGGTATACGGATTATGAAC GACTCTAGTCTTGTTACATCCATACTCCGTATTATACTGTATTATACGGA TTATGAACGACTTGTTACATCTTTGTAGCCCGGTTTTGTATCATTTGAGT GCTTTGAAATCACTGAACTACAATCAGTGCCGTAATATATTGGCACTTTT GGCTAATTTACCATTTTTCGAAAATTAAAGTTCGAGTGAGAATGTCAATT TTTAGGCCTTCAACTTGATTTCATCGATTATTTCGATCTGGGAGGGATTT ATTGGTTTCTAGGCTATATTTTAAGCCTTACTGAAGCATTTTTGAACTTT TGCATCCTCAGATCCCAAGTCATAAGTCAAGCGTTAAAACTCAGAGTTAA AACTCTACCCTTCGAACCTACTTTAGAGCACTTTACAAATCGATTGTGGT TTCAAAACACCCCGGTGAATTTCCCTTTTGTGTCAAGTATTTTGTCACTG ATTGTAGATAGCCCAATTGTATGTTTTAACCCTCGTGACTTCAGTCCACT GTCAATGGTAGTGATAGGATACATAGTCTGGCCGAAATACAATAAAATAG GGGTGAACGTAGAAAAAAATTCCGCGTAGACTTTCTTGGTACCGTTGGAA GCGAAATTTTATGTACATTATCATACTCAGAGCCTCATGATGAGGCCCTT GGGGAAAACTTTTGGTAAAATCAAGACTGAAATGTACTTCTTCGCGCCAA AATAGATACGTTTTTTAGCAGTGTACTGGTCAACAGCTACACTAAAAACC TATCAAAGCTATTCAAAGTCTTTGAAAGTCAGCGCTATCCCCATGTGCTT TCGCCTTGCACTTGACCCATTTCATATCATGGATAACACTGTTTAATTGC TTGTGGTTTTCAGTAATGTGTTTGTTGGAAAATCCCCCCCCCAGATTTTT GAGACATGGGTATACATATTTGAATGTTTTGAAAGACACCTACCATTGCA AGGATAGCACTTTTCAAGGCATTTTATATCGAAAATTGGTCCTAAGTGTT TTATTTCACCAATTTTTTTCCCCAAGGGCCTCAACGTGAGGCTCTGAGTA TGTTAAACCTCGTAAAATTCCGCTTCCAACGATACCAAGAAAGTTTACGC GGAATTTTTTTCCAGGTCAACTTTTATTTCTGCCAGACTAACAGTAGAGA AATACGTTCAAGCAAACTTGATAAAATGCTTACTTGCAATGAGTACTTTA TCGCAGTCTCAGATCATAGTTTTATTTTAAGTGAATTTTTAGTTTATATC AATCAATTCTAAATTGCCCTCGACGAGATAAGAATTTTTATATCGAAATG TCTGAATTGAATGTGTAAGCTTGCACAACTTTTGTTATCTTATCTTGAGA AATGATTCAGGCTCAAGATTATTACTAAAACTAAAATTTTCAAAATATTG ATTTAAGATTTAAGCTTGAGATATACCGTTTTAAACCACTCTATGACAGT CACGTTTTCAACCAATTTTTTCACACAAGATTATTGTAAGGGTTGTACAA TTAAGTGTCATTTATGACTATTTTATAACTCATTTGCTTAAAAACAACGC AATTTTATTACTAAACTGGATAAATATAATGATGTAATTTATCGTTAAAA TCCGTTATATAAATAACGGTTTAATACCACTGCATACGTGACTCAAGTTT GTTCTTTTGAAATTTTTGTTACAGTTTCTTCTGAAAATAACTTTGAAGCT GCCTTGGTGGAACTAGAAGAAATGATTTCTTATTCTAAATTTATACTATG TGATAAATTTATTTTTAGTTTCACACATTAAAACCCCCCCCCCCCCCCCC AAAAAAAAAAAAAAAACTAAGAAAATCCTATGAATTCCTTACTAGGACTA ATTTAACCACATCTTGATCTTTCCAGAAGCTGAGCTTTTTATCCGACCCT TAGTGGAACTGCAACTTAATTTTCTGAGTTTCCAACCCTTATAAGGCCTT TCATGTTACAAAAACGGCATATACCCAACCCTTCACTCGCCTAACCTCTG ACAATGACCTTGATTGATATCCTCAAGTCAAAGCTAACATTATAGCTTTA TTTTTTAAGTAACTTTAAAAAATGTACAGTTTCCCTTTAAAAACTCAATA TTATCGAATCTTCAGATGACCTTGGTTAGTTTAATGGCTTGTTAATGCTA TAATTAGTTGTTGTGGGAGTGGGACCGAGCAATCCAAGTGTTCTTTTAAT GGCTCATTAAAACTCAATCATTATTATTATAAGGTTTTGTTGTTTATTTT GAAATGGTCATCATTTATCCCTATGTAAAGCTGGTCAATCAAATATTGCA AAGAATAAATTGTTTAGAACTAAATTGGTTTATTTTGAACCTTCCTTAAC AATTTAGACAAAGTCAAACTTTTGAATGTACAATTTTGAAAAGCATTTAA TCCAAAAAAGACAGATGTTTTATAATCAATTGTCAAAGTAAAGTAAATTG GCAAACAATTATCGAAATCACTTAAATGTACACCTCTGCTAGCATTCCAC GGATATTTCTCATGAGTTGTGTGAGTTGGTACATTTGATTTTAGCCTGGG TGCAACAATGTCTCCCGTCTAATGTCCAATCATCACAGTAATAGACCTTA TCGGAGTTTTTCTAAAAAAGCGATATATTGTGGGATTGTTTCGGGGGTAT TATACAATAGAATTCCCTCGAGGAATTCCTAAGAGATTTCTATTGTAATA CCCCCGAAACAATCCCACGATGCATCGCTTTTTTAGAAAAATCAAAACCT CCGATACGATCTATTGTTTGGTTGTCCTCGTCTTTCTTATTAGACGTTTT TTTGATAAGAACATCCAAACCTAGATGTTCTTAACTTTTTTAGTTTTAAG CCTAAAAATGTTCTTAGCATGTTCTTATTTTTACCATTTGCGAGTGTTTA ATTTGAGCTTATCATGTCAATTAATTAACTTAGTTTGAGCTAGAAGAATA AACAATTGCAAAAAATTTCACTTCATTATAATGTTGTCAACATATGCTTA CACAAGACCGCCCTAAGAAGGGAGGAGGCGGAGAAATGAGAATTTAATAA CTTAGAATTGCTCACGCGAGGTTAAATATGGAAGGTTAAAGACAGGTCTA TCCAAGAGATTTTCATTTTGTTTATATTCTAATATCAGTATCATGTTATT GCTGATTTTCATTATGACATTAATCATTTTTGAAAGTTTTCATGGAAAGT CAAATCAAAGCCAAATCAAAGATTATTGCTTTGTTTGTTCCTGGTACAAC GGTATTTGCTCTGCAAGCTAAGCAACCAAGATAATACAAGGTCTTTACAT ATTCTTGCTGTAAGGATTATTTCAAAGTTTGTATATTGGTTACTCACTAA TCGGAAATTGACAATCATGCCCTGGGTTTCGAGTTCCCCTTTTTAATAGC TTCTTAAAGATTACATCATACATTACATCTATGTACCACGTCAGCAAAAT TTACATCACTAAAGGATAAAAAGGGGTAAAAAGGGGTGAATAATTAATGC ACCAGAACAATAGATTTAATTGATGGGATAAGACTCTTGGGTAGAATTTG ATTCAAACCAGTCCATCCATTTTTATAAGAGCAAACTATATAACAACATA AGGCTTCGATGGCCAAAATGTTAAGAACAAGTTAAGAACATTTTAAGGCT TTGTGGACTTTAAAAGGCCATATTTCTCAGTAAAAGGGACGAAAATACTC ACAAAATAGCGAAAATAGGAACATGTTAAGAACATTTTTAGGTACCTCAA AAAAGTTAAGAACATCCGAAGGATGGATGTTTGGATGTTCTTATAAAAAA ACGTGAAGCGGCTTATATTTGTCTCAAAAGATAAATCGAGAACTAGGTCT GTTTGGTTTTTAGTTTTGAAATTCAAACATAACAACTTTTTTTGCGAAAT AAGAATATTTATCAAATATTGAAAATGCTAATATTTGATAAGTCTCTCTC TCCCTTAGTGTCAAAATATTATTTCAGGTATTTTCCAGGCTATTTTTCCA GGCTAGATCATGTTTACGGGTAGCAAAAGGTCGCTCATATAAAAACGGAT GTTAGCTGTTGTAGCCTCACTTTCGTGCAATGATGCTTTGGACCAAATCC GATAATCACGTCATTTGTTTGATTAATCAAAAAGTCATTAATGATGAAAT ATGCTTACTCAGGCTATAATCCTTTTGTCAATAAAATGTAATTAAAGCCT AGCCTGATAGCTTGTTAAATTGAAAGTCGAACACAACCTATTATTTGTTA AATGATGGAATTACTCCACTCTCCCACACTGTTATTGACTTAGTTATTGT CAGTTAGATTATAATTTGTATGACTAATCGCGCTTTGAAACAAGGGTGGA GGGTGATATCATGATATTAATTTTCATGCGATTTGGAAAAAAAGGAGAAA TTATATACACAGACACAAGCTAGATCTTCAATTTAGAGTATTCATATATC TGAGAAAAAATAGAAGGAAAAAGTTATAATATGTATTTGAAAAGAAGACT TTGAGAGAAGAAATAATGTGTGAAGGTATAAATCATTGATTGGAAGGCTT ACTTTTTATAACTGTTGGAAAAGCTATACATAGAGCTACTCAATTGGTTG GGAAAATCCGTGAATAGAAAAGCTGCTATCCAACGAGAAATCTTAACTGT GATCGGAAACAATAGAGAGACTTAGTTCAAAGAAAAAAAATCACAATTTT TTTACGAAAGATTTTATACTGGTTGCGTCTCAGTTGAGAAGAGAGAATTT TTTAAAGAAATATTTTGGTTATGAAATGTCATGTAAGCTGATGACAAATT TATAACAATTTTTTAAGAAGGAGCTTAACACTTTATGATTGTCGCTTGGT TTTAAAACATTTTGGTACACTATAAACTCGTGGTTTGAAGAATATACCCT CTTGATTGTTAGAAAGAAACTACATTTGATTTTCTTGTTGTGAGAGAGAG TCGACAGTGGTTATAATTTTGACTGAGAAAATTATTATATCGTGTTAGTT AGAGGTCAACCGCTAGCTATTTCAAAAACGAAATCTGTAAAAGCGAAAGA CTTGTGTTTAATGCCATTTGTGAGTTTATAAGAAAACACGTAGTCACGCT ACCATACTATATATGCATGTGAAATCGCATTTCGTATAAGCGACGAGAAA AAAGGAAATATCAAACAATACAATGAATAGTAAAAGAACCAATCAGGAGG CGTTGCCTATGGAAACGGATGCAATAAATTGTAGCATCGAAAATAATGAG GATGATGATGATGTTTTTAAACGGTATTACAGTACGAATGATGTTTTGCT GAGAGTACCGAGTTATAAAAGAACTGCTAATTTTTCACCTGAACGTTCAC GAAAAAGACTGAGTACAAGTTCAAATGATATTACAAAAGCAGAGATTGTG GAGAATAAATTAATATCAAGTATGAAACCACCGAATTCATTGAATTTGTC TTTATCAGAATCAAGAGAACGATTGGATTTGTTTTCACCAGATCCTCGAG ATACATCAGTGTTATCTTTCATAGAATCAAGACCACAAGTATTGAACCAA TATTCATCAGAGCCGAGAGGTGCATTTAATGTAGATTCAAAAACAAGATT GAATTCATCTTTACCAGATCCTCGAGAACCACCATCGATACAGAGACCTA ACCAATTGAATCTATCATTACCAGTTAGTACTGAACCACAACCTAAAAAA CTTTTACATCGTTCAATGTCTTCAAAAGTCGAACGTAAATGTTATCAACA ACGAATGGCCACGGCTCCTACGACACCTTTATTTAGTCCAACGACGCCAC AGCGCCAAAAGCGTTTCAGAACACCGACAGTATCGAGAACGCCGACTCTG TCGTTACGTCATGCTGCTTTAAATCGGACATTTTCGGTTCGCACACCGAC TAAACCCGTCATGTTAAGACGTTTGAATTCAGAGACAGGTGGAAGTATTT CACAACTCCACTCTTCACAATTAAATCGTACTTATTCTGGGTTTTTCAAA CGTAACAGAGCTGTATCAACTTGTACTATAGCTCAGACACCAACTCTTAA ACGCAATGGAAGTGTTAGGATTGTCTCCTCTAAAGTCAAGAGATGTCACT CGACGGCTAGTCTACAAAGACGAAAGGTATTTCACTTTCTTTTGATTACG TAGTACCTCTTCCAGTCAACTCTCTCTCTAATTCGAACCTCTATTACTCG AATCTTTCTGTAATTCGACCTAAAAAGATTAGGTCCGCTCGACCTAGAAA GTCGTATAAAATACTCTCCGTAATTCGAATCTTTCTATAATTCGAAAAGA ATTCTTGGTCCCTTGAAGATCGAATTAGAGAGAATCAGATGTAGTACTAT AGTTTGACACATATCGATTACGAATTTTATCGGATTATAATAATCTAATT AGTTGCTAGTTAGTTAGTTTCCCGAAAGAAGCTTTTTTAAGTTAATTGGA GCTGTAGTATTTTTGACAGGTTTTTATGAACACAAGCTGGGAATTCGGTA AAATATAATCCAGTTTGAGTCTAATATAATCTAGTGAATGCAGTTCGCGA AAATGATTTTCCTTCACTACTGTATAATGAAGTACTATAAAATCCGTTGA TATGATGATTTCTGTAAAGTAAACAAAATTTAACCAATGAATTTTCGCTC ACAGTGAAAAAGTTACAACAACCTAAATATTACATTAAATAAATGGTATT AAATTATGCGGTATGTTGCGTGTCAGATGAATTATAAAGAGTGATTTAAG ATGACATATTGATTATGATCTGATTGACGAAATACTGTTTCATGCATAAA GATCTTTATCATCAACGTCTTTCAACAACAGAGATGTCTCGTGTGAACTT TTCTACTCTTACGTCTAGCCTCACGTAGTCAAATACCATCATCTTTGAAC TAAACACCAACGCCAACACCCTAGCTCTTTCTCTCTTTTAACATATAAAA TGCATAATGCTTTTCAGATTCGTTGGTTCAATAGCACCCACTGGTTTTAG ACTAACCTAGACTCGATTTCTATGATCTTAGCAATAATTCCCATAACGCT AGACTCGATTTTTCATGATCTTAGCACCAATCCTATCATAACAATATAAT TTCCACGACCCTAAAATTACAACTCAAACAATAAGAGTTGTTTTTAATAG TTTAAAGAAGATTTGTGATCTTCGAAAGTCTCCTGGAGATCAATTAGTCG CCTACTGTCCACGATTTGATTGGTTCAAAAGCAATTAGGATCGACTACTG ATTCTAGATTTGCTCCATTGGAAGTCCATTTGTCTCAACGTCAGACTCAA GTTTCAATTACTTTAAGCCACGTTTGATAACCTTTAAAATCTCTAAATAT GTTTTAAGACCTCTTATTCTAATCTATTGGATATTAACAAGTTAGGAAAC AAATTGATAGACAAATCTATTTGATATTATGACCCTTGACCTCAATGATT AAACTTAGAGTGAATTTTAGGAATTCAAGTAATGTTTTAAATTCAAGCAA ATTCGTTAAACTTCTTACAAAATCATAATGTAAGCATTCAACCGCGTTCC CTGCGTATTATCAGCTTTTTTATGCTTACTAATAGCGCTAGATGATATTC TCTGGCGTCAATCAGTAACGTTAATATAAAGCCTGGGATACACGGGGACG AGGTTGGTTAGCATCGTGTTTTAAATCTACCAAGTATTATAACAGCAGTC AGGAAGTATACAACACACTTCATCAGACACACCAGAAATTGGATATTTGA ACACAATCACCTGTCACCTGTCACCTGTCAGCAGCAGAAATCAATCATTA TATAATACACGTTAATTTATCAGAACAACTATATAAGAACATAAGGCTTC GACAGTCGAAAATTAAGAACAAGTTGAGAACATTTTAAGGACTTTGTTGA CTCTAAAACACCCAATGTTTTAGAGAAATAAACAAAAACACTTAAAAAAC CTTGAAAATAAGAACAATTTCAGACAGTATCTTTAGGCTTAAAACTAAAA AAGTTAAACATATATTCGAAGGCTTCGAAAACTTCCAAGTTCTTATGAAA AAAAACGTGTATTCCTCTGAAAGAAATTACAATCACCAAATCACTTTTTC AAATTGATAGAATGATACCGGAAAACACGTAACAGCAGTTGACCGGACTT GCAAAATACTTTCGGAAGACGTCGTTGTTACAAATTGTGTACAATCAATT TGTTTCACTCAACCTTTCCTTTGTTGTAAAACATAAATGCATGATGCATT TCTAATTTTAGGGAAAATACATAATTCTTAGTGGTTACCATTTTGGATTC TCGATGATTTGACCTTTGAAGAAGTCTTTTAACCTTAACGTAATGTCAAA ACCAGACCTTCACAGTTAAACATGGTAATTGACTCATTTACAAAATATTT CTAGATTGATAGGCATATACAAGTTTTTTATAAGAACATCAAAAATTTTC GTAACTTTTTGAGTTTTAAACCTCTAAAATGTTCTTAAAATGTTCTTATT TTTGCCATTTTTTGACCAATTTTACCGTTTTCCTAAGAAATCGGGTGTTT TTGAGTCAATGAAGCCTTAAAATGTTCTTAACTTGTTCTTAACATTTTGC CCATCGAAGCCTTTTGTTATTATATAGTTGTGTTCTTATAAAAAACGTGT AGCAGACATCCCACAAACATCATGTATTCTCATTATCATAATTTAAAAAC ACCACTTATTCATTTTCGTTTTAATTGTAGTCAAAAATAGTAATTCTNCT CATTATCATAATTTAAAAACACCACTTATTCATTTTCGTTTTAATTGTAA TCAAAAATAGTAATTCTATATTATCAAATGCTTCATTGTTGTCATTTGTT TGCGAAAATGTAAGCAAGCAAACGCATAAAGAAACTCCACTCCTAAATTC CTTTCCAACAAGTAACTTAAACCTAGGTTTATGTGAACAAATCCAAATAT CAAAGCAGTAAATTCAGACCCACAAAATTGCACTCGACTATGCAAATCAA GTTTTCAAAAAATTGATTGATTGATTTTTCTTAAAAGTGTGATGACCACT TCAATATACCACTTGAAATATGTCAAATTATTTCAAAAATTTACCAAATA CTTGAAGTACCTCTTTATTAACCTTATTTTGACCTCTCCTCGAATCTTAT TGTTTACTTTGGAATGAACCGATAGCAAAGCTTTCTCAGGCCTGTCTTGT TGGCTCTTACCGTCACGTCAATCCTTTAAAAAGTGCTTTGGATATTCGGC GGAGAAACTTTTTTTCCTGCAGTATGGAAACCACTCCTAGGGAGTCTAAT TGCAAACACGTTTTTCATACAAGGAACACGTTTGGCTGAAAAATGGTCCG AAAAATAAGAAATTGTTAAGGAACTGCTCAGGCTGTGAATAAGAAAACAA GTTAAGGAATAGTAAGATTTAAACTTGAACTTGTCACATTTACAAAAGCC TAAACAAAAAGCTGACAAATATTGACGAAACAACTTTCAGTAAACGTCTT TTTATGTACTGTGGTTCATTTTTAAAGTTACATACTTAGAAAAGCCAATC TTAGCAGCTAAGTAAATAAGGAACTTGATAAGGAATTTTGAAGCTGAAAT TCTCTGGAAAAATAACGAACTCCAGGCTCGGAGCCAAGTTAAGGTTCTTT ATAAAAAGAAAACGTGTACGCTTAAATAGTTTCTGCATGGTACAGTAGTA GTGATGAGTGCACACTTGCTTAAAATAAAATGGAATTTTAATACTTTGGT GTTTCAATAAAATTTCAGGCTATCCGACCCCAGTTATTTAAACAAGAAAA CTACCTTATTACACGAATATTACAAGTCATTTTACTAACACGAATTGAAA AATTTCGTGTTAGTAAAAACCCCCTTAATTAAAACCAGCTGTGGTGTCCT TGAAAAAGCTAATAAAATTCGTGTTAATTTTTTGGGTGTTAGTTTCAAGG CCGTTTAATACTTGTCTAGTAATATTCGTGTAATAAGGTGAAAATTCTTC CTAGAAACAGAAAAGTAAATTTTAAGTATGTTTAGATTCAATATTTAGAC TGTGTGAAGAAAATTGTAACAAAATCCTTACTTGCTGTGTGGTGCGAGAA TTTACTAAAATATTATCGATAACTGTTTGACAAGTCTTAAACTTGCAATA TTGTTTTTGTTACAATTTGAAAGTTCAAAAATATTTTTGTTTGTTTTGAC AGCCTCTCTTTCAAACCTCAAACCGTTAAATAAATATACAAACAATTTTA AGCCCTTTGTTTTTTAGTTGTTGGGAAAATAGGTATGCAAATATAGAACT AGTTACAAAGTTTTTCTTGTATTTGATTTAAGTATCAAGTTGATTTTGTC AATTTAGATTTTATACAGGTGACTCGGTAGTTTTTTTGTCAGAGCTTGGA GTAGCTTTTTGTGGTTTCTTTGTATGTGTACCAATTTTGAGTTTTAGTAA AAGAACTACAATCGAAAGCAGCCGGCGAGGCGACCTTTTTTCTGATGTGT TCTGAGAGTATCTTTCAGCTAGAAATCTTGATCTGTTCTGATAGGATCTT CTTAAAATCAAACAGCTAGAAATGGTGATGTGTTCGGACGAGATAAGGTT ATAATCAAAGTTGTCGAACATGTTTTTGTTGTCTAGGTAACCCTAGGAAC ACATATTTCTAAAAAATTGCTTCGCCGGCTACTTCTGTAAAACCAAGTGG TAAATTTAAAATCTAGTCTGAGATCTAAGTTTTTCATCACGAAATTCAAC TACTTGATTGTCCATATTGTGATATTATATGACCGTTTTTCGTCGTCTCT CAAGAGGTGAAAAATTTCAGGATCAACTGGATCTCAATTAAAAAATGTAT CGCTATCTTTTCAAGTGGATGAAACTTTAAGTGTCATTTGGAATTTCAAG CACTTGATTTGTGAAGGATTTCGCTTATAGATTCACCTACAAGTCATTAA TTTGTGTATGTTAAGAATTAAGAATTATTTTTAATTTCAAAAACCATAAC AAGTAGTGGATCGAGAAAGAAAACATACTTTAAGGTTTTCCTTTTTCCTT CAAAATGTCATATCTTTGGATAAACATCCGTGGAGAGGGGAGAGCATCAT TAGTTTTGGACATTCGAGAATACTGAAAACCCTCCACCGGCTGGCGCTCA ATAAGTCAAACAGAGTAACTATATTTCAGAGACCAAACGTAGAAGAGCAT CTTTATCTCCTTGAGGCTCCTTTTTCAAGTATTTCCCCTCCATCTGAACG ATCTTTTTGAAGACTTGAAGAAATATCTAATAATCGATGAAACGATTTAT AGAAATTTCGGATAGTTTGATGAGATGAATTTTTTATTGCTTGACAAACT GTGTCATTAACTGCTTGAGCACGCGACAGAGCATGTAGACATTGCTTATC GATCTCTGATAGTTGATATATATCACGAACTAAGACTTTTGATCATTTCT AACATGGAATGCAATTTTTTGAGAGCTTAAAATTCTACCTTGTCTCGTAT TTTTTAATTTGTCGAATTTTCTGAATGGAGTAATAGCCAAATTAATTAAC CAAGCTGGTACATAACATTGTTTCAACGTCCATCCAACGTCATTTGAACG ATAAAAACGTCAAATGGACATTCAAAAAACGTTCTGTACCAGCTTTATTT ATTAATTTATTTGCCCACATCTAGTCGTTCTCACCATCTTAAGTAGTTTT GAGGTATGACTTTAAGTTTTTGGAAAACAAGCAAGAGACATTTGAAAAAT CTCACGTCGTTGGTTTAGTTTGCACCTAGTTTATAACATGATTTATTAGT CTGTTGAAAAAAGGGTCTGTTGATTTTTTTCACTTGACAACATTTCTATT ACCTCAACGATATAATTCTAGATGTCTCGTAAAAAATTGTGTATCTTTCG ATAAAATGGAAACTACTTGTGGAGCTTGGGTGAATTATCAGGACGAAACT TTCAATTTCTTTTACACGTTCCATTAAGAGGACTTGCTTGGCTTGTTTGA TATCTATACGTTTTTTATAAGAACAAACTATATAAGAACATAAAGCCTCG ATGGTCAAAATGTTAAGAACATTTTAAAAACATTTGACTTTGTAGACTCG AAAACACCCAATTTTTTGGAAAAGGAAGTCACAGAATGGTCACAGAATGG AGAAAGAAGAACATCTTAAGAAAATTTTTAAGCTTCAAACCCAAAAGGTT AGGAACATTTGAAGGCTTCAAAAATTTTGTTGTTCTTATAAAAAACATGT ATTGATGTAGATTCATCTTTGTATAAGTACGAATCTTCAAGGGGTCATTT TTCCTTCAAAATGACATTCGTTTTGAGGTCACATGATCAAAGGGTCTTAG TAACGTTTTTGGGGTTTGTCCCATACGTTGTTTGTTTATAGCTGTTACAC AACACTAAAGTTCTTCATTATTTTTTGCCGTTTTCGCATCCCATTCATTT ATTGTGTCCCTTTTTGAAATGAAAGGACCATTTTTCACACTCGTGTACCA AGTTGATTCAAATCCCTATAAAATAGAAATAAAATTGATGTAGTTTGTTT GTCCAGTTTGTCCACTGCAAAATGTATTCACTATTGTTCCTATATTGCCT TGTTCTAAATGAGATGGTCTTCTTTTGAATGTCATTTGTACGTCTAAAAG ACGTTAACAGCATTTTGAAGACATCTTTTTCGCGTTCGAAGGAAAGTGCT CTTCTTTGCCAGTCTTTCNACAGCATTTTGAAGACATCTTTTTCGCGTTC GAAGGAAATTGCTTTTCTTGCCAGTCTTTTACTGTTGGGTTTACGCGACT TTTTTCCGCAACTTTTTTTTTGACTCCTTTTTATTTTGTCACACTGGTAT TAGATGAACGTCAATGAAGACTCCATCATCTATGCTTTCAATGTGGAGAT TCAACGTCATTAATATTGACATAATCATGACATGAAAATTATTCTCGTGG CCTGCGAATTGCTTAATTTTTCTTAAAGTTTTGATAAATTTGGAGTGGAT TTGAGATTTGGAATCAATCATAAAATGATTGTCTTCTCTAAGTGTTTGAT TATTTTTTTGATCAGCGTTATGTCATCACCTTAGGGTTGTTGAAGTGTCT GATTTGACACGGCTTCAAAAATAGATTGAGATTTTAAGAGATCTGAGAGA TTAATGTATTTCTTGGACTTATATAACAGAGGCTTTAGCAAAGAAAAATC GAGGATAAATGGTACTGTAATAGCATTGTGAAAATTTGAAGTAAAAAGAA AATTAAATCAAATCTTTATGCATGGCTACTGCAATGGTTGAACCAAGCTC CTTGGTTGAGCATGGTCCTCCCATGGACCTGCCCGCTCACTTCTTGAAAA ATCGGGTCCAACTGGACACTCGAAGGGCCACAATAATGCCCGGCGCGTCG CCGAGGACTGGATTGAGAGGATTACGAGTTGAGCGGAGCCGTCGGTTGGA GACACGCCGAGGAACTTTGTTGGGTGCCGTCATCAAGTTTGAAGCAGAAC AGGTTTGACTGAATATCCGTATTAGTTACAGTTAGCTCTCTCTATTTCGA ACCACTGGTATTCGAATCTCTCTGTAATTCGAACTATTTGTTCCCTCTGC TGTAAAAAAACGTATAAAATACTGTTCGTAATCTGAATCTTTCTATGTAA TTGGAAGAAAACTTTTGAACATCGAATTAGAGAGAGTCAACTTTACAGGC TCGATCCTAGCTGACACAAACGTCCTTCGAATGTCCATATACCGTGTACC GGTTTGAATGACCTTATGAGCATATCGAGGCTTGGAAACAACGCCTTAAG CCTCGAAACCGAAAACAGCAGTTTTTCCAGGGCTATTATTTCCACCGCGC TTTTACTTTCGACGGACTATTAGCGCTAAAGTCATAAAAGGGAACTAGGT CTACAAAAATGAAGATGACCTTAGTGCTCTTAAATGTTATGATCAATAAG AGATCTAGATCCAGTAAATTTATGAGACTCGGCTGTTCTTATCTCTGTGG CACTTAGCCTAAAATTATCCTGTAATCTCTAGGCAAAAATCGGGGTATTT TAGATTTGATAATCTATTATCTTATACCATTTTGACCCTGAATAGCTTAA AAATCAGCCATTATCCAAATTCTGGAGCCGCTCGCTGCGCTGCAGTTGAT GTGCGTGTCGGGACAAAAATCGAGGCGGAAGCTATTTTGTTTACCTTTTG GCTGGGGAAGCACTGCAAAACAGTGCTTTTTGAGTAGATTTGGTGATTCT TGGGAAGAAAGAAGAAGAATACTACTTGGAACCAACATCAAATGTATTGG AATAGACTTCTATCATACATTGGAATAAAAGACAATACTTTTTGAACATA ATGAATGTGTGACCAAAATAAAAATGGTGAAAATAAGAACATGTTACTAG AACATTTTTAGGCTTGAAACTCAAAAAGTTAAGAACATCCGAATGCCCCA AAAAATTTGGATGTTCTTATGAAAAAACGTGTTTAAGGATAAGGAGAGTA ACATTTCAAATCATCGATCTTTAACGATAATTTAGTTTTTCGAGACATCT CGCCTGCTATCTTTCAACCTCTATGAAAAGGTTTTATCAAAATGAGATAT CATTTTAAATTCTCCAGTTTGTAGCATTAGTCCGAAGTTTAAAATTTATA GGTCTCTTTTAAACGTCATATACCATATACAGTTAGATAGAAAAATTCAT CTCTTGCTCAAATCTAAAACAAGAGAAAGCAAGGAAACAAAGAGTTATTA TTTAGCGAATCGACGAAACTCATAGACTAGTATACAACAGTAGCGCGGTT TAGAATTTCGCTTAGCTGAAGAGAACTTCGTTTCAAAACTTTGTTTCAAC ATTGTAGTGCTATATTGATATAGTAGCTTTTGTTTTAAAAAATTTCCATC GTACAAACTGTATAGAAGAAAGATTTTTTTTTATTTGTTCGTCCTTCTGT GTTTGTTGATGGGTCACAGAGACCTAAATTAGTGCGGGCAAAATTCGATA GATGTTATGTTCAATAATAAGTGGTTTGTTGTTGTGGCTGATATATAAAC TTGCGGTCACGGACATTTTTAAAATCCTCAATCTCCCGCATGTTGTCGCC TCTCCGGATCAGAAAAGAACAGGAAAACTAATCTATTTGGATGGAAAAAA AACTGGTAACGAACAGGAATCTTAGAGGCATGGTAACGAATTTGATAATA ATCGATCGGTTGGAGTAAACAGACGTTGGTTGCTTGCAAACAAACAAAGT GAAAAACTAAACGGTGTGTTTTAGAGAATAAAAGAAAAAGAGAGAAAAAT TTGTGTTGTGTTAGTTTAGTATATGATGTCTACTTCTTCAGAGACGAAAG CATCAACAAGCACAGTACGTCCAAAGACGAAACTCAAAGCTACCAAGAGT CTACCAGCTTTTCAATCAAGGCGTGCATCGAATGAAAATGAAGAGGAGGC TACATTACGTAATCAAAACAAACCAACTTCACGTCCTCGTTTACAATCAA AAACAAGTTTGAAATTCAACGAAGGGTTAAGGAAACAAGCTTCAGTCGAC TTCACACGTGCAAGACCTCGGGTTTACAGTAAATCAAAAGACGTTCCTTT AATTCTGGTGGAGCAGCCAAGACAAGAGGAGAAACGCACCATCAGGCCAG AAATGGTACATAGACTCAGTCGACCTCTCAAACGACAGTCAACACTGGAT ACTATAAAAGACGACGATGTTTTCAAAGAAACTGAAAAAGAATGGCGAAT ACACGGTTCGGAAAGCACGCAATCATTCCCAAACGTACCAACGGTAAAAC GTAAAACTTCAACGTCACAACGCCAACGTAGTTCTTCTTCGTCTTCGTCA CAACGTAAAATATCACGTCAAAATAATTTCTCAATGGTCGGCGGCAAAAG AAATTCAATACGTATACGAAAGAGTTCCAAAGTTTTAGTGAAACAACCAA CGTTAGATTCAATCCCTGATAATGGGATACCGACTAGTTACCAATCGCGA TACGGTGTTCGGAGAAGCACCTTGGCTACTTCTTTACCAAAGGTATTTCA TCTCATAAATTCCTATCCAGGGTGATCCAGGGTCGGTCAAAGAGTACAGA AGTTTTTTAACTGCTTGTATTGAGTGAAATATTATCTTTTAATGAGCTAG GTCATTGTTCTTAGCAGCATTAGTCTTTAACTTAGTCTCATAGCTCTTAT TTAGCCCAGTCCAATGGTAAGGGAGAATAAGTTTGGTTAAAATGTTTATT TATGACTTTCGTTTGAAATTTAATTTAATGTCAGGATTACAGGAAAATCT GAAAAACCTGATGACGTTTATTGAGGTCAAATATCCAAAAATAGGAGGCA CTGTATCTCAAACTAATTTGTTTAATTTCTGCATGATGTGGTAGGGCTTC ATTAAGTCTTCAGTTGTATAATTATAATGACTTAGTAATTAATCTTCGAT ATCAGTTTTTAGATGTAAGCCTTATTAGGGTATTTTGTGAAAGAGGAAGT TTTAAATTATTGCGAAAAGATATCTTTCTGTAAGTTAAACTCTATGGAGA TAGATCATGCGTCAGGACGAAATCCAAGCTATACATTTACTTTTATAATG ACGTTTTTCTGTAGCGGAGTATTTTCTTTTGATATTGAGCACGTTTTAAA AATGCCATGTTTGCATTTAGATTATTTGAGATTTTGAAATCTTCAGATTT TAGCTCATTCATATTTTCTGGAAAGTGTTTTTTTTCGAATTTCAGAAATT ATTTTCGTTTTAATAATCATTTGTAGTCCAAACTTCATTTAGGAGTCAGA AAATCATTCTATGACATAACAAAAAGCACAACGAGTTGACTTATTATCTC ATGACTATGATGTTTATTTTTGGTCTATATGTCTGTTGTCAATACGTAAC AAAAGATTGTAAAGATTCTAATGTCAACAATATTAGTCCACTTTCCTTTT AACAAAATTCATCAATATTTGTGTCCGGTCATACGATCTCTGTCAAGAAA CTGTCTCCTTGAAATTAGTAATATGCCCAATATCCTTTCTTCAAAATGCT GGTTTTACCGCAATGCATCTTTCAAATAACTTCACTTTTTGCCAATGTCG AGTATATTCGACAAAGGACTGTTTTCCTATGAATGTTAAAGATAAAGGCT TGTTTGACTATTAAACTAGATTCATAAATCAGGGACCTCAGGCTACACCG TAAGTTGGTTTAGTGTCGACAACCTCATTTTAATCCCGACACCCTTCTGA AGGGATGAGAAACAAAAAAGGAAAAAAAAAATGGCGGAATCGCCAATTGT TGTTATCTCTTAAAAAATGTTGACGAAAAAAGAGTAGGTTTACGGTTCCT TCTACCTATTCTCGAATTATCTCTCAGATGATTTGAATCATAGATAAATG ATGGTCAAATTTATGTAGCCACTCGTAATGACTTAATTTCGTTAAACTTT TAAAATCCTTATCTATAAGTTCAAATCAAATAGGGCATGACTTTGTGGGT TAATTGAGGTCAAAAACCCATTAATCTAATACATCAAACTGTGGTCTACC AGTTGACAAACTTTTCACTATTTTTGTTATAAAATCATAAACAAAACTTG ACTATGTAAAACTAAGTTATGTCGCCAAACTCTCACAATCACCCCTTGTA GACCTGCATAATGGGTATAATGTAAAGCCCTATATATAACACTATGTAAT ACGTGATATAAAACAAGATATTTTAAGATGAGATTATTACTTCGTTTTAG GTCAGCAGGTTTGAATTTTGAAGTTATGGGGGTGTCGAGACTAGAACTAT TTAACACAATTGTGTTTATCTTATTCATTACCATGTCTAACTGATTCGCG TCAAAGCAAGCTTTAATACCATATGACCTTATCATGGGAAATTGATAGAC CTTATTACTAGAAGAAGAAAAAACAGTGTAGGGGACTAGCAGACAAACAT GCAAACAATCCATAGGGTTTTAAAGTAGCTCTTTGCAGTAGGTACCCATG CTATAATCCGTAATAATAACAAAGAGTCTAAGATTTTTTTTTCTACAGAA TGAAAAAATTTAATTGGATAATGATTAATACCTTTAAAAAGATGGCCCTT AAAACCCGTATATAAGACAATAGGGTTTTTCTCTTTTTAAGAGATAGTAA TTATTGCCTTTTAATAAAAATTCTTGTAAAAAAAGATCTCTCCTCTCTAT TGCTTTAGTGGCCTACCATCGATTATTTAATGCCCAGTTGGAGGGTAGAT CACTCTCAACAATCCTTAATAAAAATTATAATCATTAAAAAAATCAAAAA AGGATAAATAAATAGTAGAGAAGAGCATTTTTTAAAGAATTATAAAAATT TATAAAGCGAAATAGAGAAGGTTTAGCATAATTGCTGTATGCGTTCAAAG GTTACGTTGGTTTATGGTATTTTAAGAAACATAACGCTTGTTATGGTGTT GAGATACTACAACGATTAATTTTATGAAAAATTATGAGAGATCGAACTTT AAAACGACAAAGGAAGTTTAGTGTAGTTGAAAACACTAGACATTTAACAG TACCTACGTTAGAGCATTATGGAGAAAATTTCGAACGTCCATTATATGAT TCAAGAAGTAAAGAGTCACCGAAAAGGTTACGAGCGTCAGCTACCAGTAC GCCTTCACCCGCTACTAGATCGCGTAGCATTAGTGTTGGGATAAGACCTT TTGGTCTCAGTCAAGCGCTTGAGTTACCGACAGATTTCGATGAAGAGTTT CATAAGGATTTTTCTTCACTTAAGGTTGCTGTTGGACGTAAAACATCAAC GACTTTCCAAAGAAAACAGAGACGATGCAGTGAGGTGAGTGATTTATTTT TTCTTCTCTCAAATTCGAGTTATACCGAGTATACTAACTCGGCTCAACGA TATTTCTTTACTGGTCCAAATGTACAGAAGGCTTAAGATCTCCGAAAATC TCACAATGTAACCTTAGAATTCTATCACTTAATCCATAATCGACTCTTTT GGCATTCTGTAATATGGTGTTAGATTGACCTAACAGGAAATCGGTATCTG ATTCTTTGTTACATAACTCAGATGTAAGAGTTAAGACCCCCTCTTCTTGT TTCAGCTGTACATATGGAGTAGAATTTCAGATACCCTAAGTAGAAATTCG CTCAAACCAACTCTCCGGAAGTTCACTGTGGAATAAAAAGAAGTTGAAAA CCCACTCAAGATTTCAGTAAACAAGAAAAAGATTTACTAATTTTATTGAT TGAATTTTTCATATGTTTCTTGTACAGCCTTTCCTGTTAGATTCATTATC CTTGCAAGGTCTTGGAGGTGCTGGTAACAACAAATGGAATCGAAAACAAT CGACATCAAATGGTCGAGTAAAACGACGTTTATCCACAGCTGGAGGTTCG TTCGTTTCAATGTTTTTGTTTTTTTTTGTTTTCAGGATGAAATTTTAGTT CAATTTGTACAGAACTACCGATTACAATGGTCTCAAAAGGCGACCCTTTT CTTCGTGTCTTCGTAGAAGGGGGCGGACAAGGGTGGGAGATACAGTACAA CTTTGAAACTGTTGAATATTCCAGAGATTTCAAGAATGTAATCAAAGATA TTGCTGACGTTATATAATATAGCTCTGTTCGGCTCTAATTAATTTTTAAT CAGTTTGACATCAAATTAGGAATTAAGGGATCCGGTCCTTACAATGAAAA TAAAACAAGCAAACGGGATAATCTATCATGATACCTTATAAGAGGGTTGA TATTTAATTTCTATGTTTGTGTTAGGGAAAGGGAAAGTTTATGTAGTGTT CCTTAAAACTAATGAGTAATTAACGTCCGTCGTCCCGTGGTGCTATTCAA TGTTTTTTTTAACTGACTGTTATTACCTGACCAACGAAAACACCTTCATT TAGACATAACCGCCTTAGATTAGGTTTTCTCACGAATCAAGCGTACAGTT ATTTCAGGCTGTTGAATGAAAAAAACCACTAACAATATTTTAGGCGTGGT TTCCACCAACTATCACTCTCTACAATAGGGGTGCTATTAGCTCTATCGCG CTGATAGAAACCACGCTTTTGTCATACAAGATAATATACACTTTCAAGTT TTTTTGTACTGAAGGCAAGGGCAAATTAATCAAAAGTTATATTTTTGTCA TATTTTCAGTCTTACCAGCATCAAGCAAACAAAAACTACAAGCACTAGCT AAAGATGAATTATTGGCTAGTTTGAATGTACCGCTATCGAATGCACCTGA AATCACGGTCGACGATGAAGAGGTCTTGGACGAGTTGGTTGATTCTGAAA ACGAGGCTATCGAAGAAAGCGATGAGAAGAAAGCACAAATTGAAAAAGAA AGGAGGGAAACGAAACGATTATTGATCATCGAGGAAATCTTGGAGACGGA AAAGAATTATATTTCTTGTTTGGGAACTCTCGATTTGGTAAGCATTTAGG TCATTGCTTTCTCTTTTCTTTAGCACACATAAAAATTTCATCTATCTAAT ACATTTTACTAATTCCCTTAAAAATCTAACCTGAAAATTGTAAAGGCCTA CGTAATTAAATTCAACATTCCATCCAAGGAAAGCATTTTCGCCGACCTTA ACTACGCTGAAGTTTACGCAAAGTTTACGCAAATATTGATGTATATTCAT TCTCTTCTTCAATATATCAGGTCTTCAGATCACACTTAAAAGATGCCAAC ATCATCACCGAGAAAGACTTGAACTCATTATTCCCATCACACTTGCAAGA CATCAAACAAGCACATGCTCTCTTCATGGAAGATCTCGAAGAACGAATGA ATAACGATGATTGGCGAGGAATTATCGGTGATATTTTCGCTAAAATGACG TCAGCGTCGGTCAATCTTCTCGAGATGTATACAATGTATGTGAATTCGTT CCCCAAAGCCATCAGCACATTGAGTAAATGTACAAGATCGTCTGGCAAAT TCCGCAAATTTCTAGAGGTAAGTACTATTGATGGTTCTCTCGATTAAGAA TTTGTCTTTGGTGATTCTTCATCAATCTGATCAATCTCCTTGATAGACTT TTATATGAGTCAGAATTCAAATTTTGTGACATATAGTAATAACCTAGATC TCAAGGCACCACTCTACTACAGAAATGTCGAGGTGTCTGTATGTCTATAT TTGAAAATAAAAGGACATGAAAAATTTGATCGAAATTATCATTGCATTAA CAGGGAGGGGGGGTTTGTAGGGGTTCGAAATACCGTTTTCCCGTCAAAAT TTTTGCTGAATCCCGGAATCCCGAAAATTGAAAAAATAATAACACCGTCA CACCGGCTTGTGCAGGGCAAAAATGTACCTAAATCCCGTTTTCATCATAT TCTGTTTTCATTCCAGGATTGTTATGAGAATCCGGTGGTGGAAAGATTAG ATCTGCCATCTTTCTTACTCTCTCCTGTACAACGGTTACCAAGATACATC TTATTACTTCGAGTAAGTATCTATTTATTAACGTATTGTGAAGAATGATT AAATTAAGGTCTGTTTTAGATGTTTAGATTTACGACTTTTGTGGGCGATT CTGTTGAAAATGCAATGGAAAATTGTGTCCCGAATATAGCAAAGCCTATC AAAAACTCTTTTATCAACTAGCTAAGATCAAAGAACTTCTTTTTTGCTGC AAATACAAATTCCTATCATCCTACCGTCCTTTAGTCGGATTTAGATATCT GATACTTGGAGAATATTAAAATTTTTTCTTTATTACTTTCACAGGAATTA TTAAAATACACAGACGAAGATCATCCAGATTGTTACTTCATTAGTCAAGC CATGAAAGAAATGGAATCTCTCATATCCTCACTTAACAGTTCAATCCACC AATCAATGGAATTCTACTCGGCAAGTGAAACCAGGCGTAAAAAGATGTCA AGGCAGTTCACTTCTAAGAAAAGAAAACAAAGAGCGTCTTCCACCATTTT AAGGTATATTACATAACAAATAATTTACAATAATTTTAGAAGACCAAATG TGGGAATGACCTATCAAAGCCAATCTTTATGAATATATGAAGCGGTTTGT GATCTAAAGTTTTTTTACCAACTGGAAATTAAGACCATTCGTTTCTATCC ATCTTTAATTCCCAAATAAGAATAAGGTCGAGTTTTCTTACCACACGGTC AAGTGTGAGTTGTAGCCAATTCGAGTGTAAAGCTTTTAAGTGAAACGGGG GAATCAAATTGATCCTTAATAGAAAAAGAACATGGACCTAGAATTATCAT TTTAAGCATTTTAAGCAAATAACACAAATATTCATTCTTCACTTTCGATT TTTTCCATGCAGGAACAACAAAAACATGAAACCAGTTTCCGAAAATAAAT CCGATAACGACCAAGGTTATTGTAGTTTTGGTGAACGGAAAGATGAATCA CCCGAAGATGAATCCGGACGGAAGCCCCGATCATCATCAACACTTAAAAA CCATCCCGGTAAACGCTCAATGTCGGTCATTTCGAACGCCAGTGATGACT CAACAAAACAAGTCATTCGACGTAAAAATGATTTACAACTAACAGGGCGA AATACAGACACCAGAAAATCGTAAGTAATTTACTTTATTATTTCTTCTTT CGGTGTGATTCCACTTGTAAAAAAATTCTAACAATTCACAATATTTACCT CGAGATTTTCTAATCTGAAGCTCACTAAAATCCATCTTGGTGATACCTTT CTAAAAAAGCGGCGTTATCATTTGACGGAAAAATTTCTATTAGAAACAGT CTCCATACTGTACGGAGAGAAATATATTTAGAGTATAGTGTATGTAAAAT ATTTCCATATTTTTTCTTTTGGTAGATGGCGACGTTCGATCGGTGCAGTC TTTTCACATCTCTGGTCAAATAAAGATGGCGAAGAAACTTCCTCACAAAT GGATACTTCAGACAATTTAGACNCTCTGGTCAAACAAAGATGGCGAAGAA ACTTCCTCACAAATGGATACTTCAGACAATTTAGACATTACGTCATTAAA TGAAAATAGAGGTTCACAGGACCATATAGACGGAATCCCGTCAAATTCTA CGCCGTATAACCGTAAGAACAGTTCGGTAAAACGTAAACACGCAATCGCG TTACCGTCGCCGATGATCGAGGAAGTCGATTCTTCTTCCGATTCGCCGAG ACTTGCGATGGAAAATTCTGTATTAGACGGAAATGAGAATATACAACAGA TAAATACTTTAGTTGAAAACACGACATTAAACGATACGGAAATATCGACG TCTCCGGTCGGTGAAATGGATATTCCGCTTTGCGTCGTATCCGATGACGA CTGTGACCGTAAAAATTCGACGGAATCGGAACGTTCTAATACTGCATCGC CTTCTTCACTAAAGACCCCTCCCTCTCCGCAAAACTTTCGTCGAAACGGC CGTCTACGTGGTAGCGCTGGTCCCGTGTTTAAATCTATATTTCAAAAGAA CAGTACTAAAATGCAGAAAACAGTTTCCATGGATGCGTTAAATACAAACA AATACAGTGAACAGGACGATAAAAAGAAACAGCGGGCGCTTAAAAAGCGG AACAAAGAACTACATAAGAGTGCAACAGTTATCGCACAAAGGACTACAGT TGAGAGTGGTTATCCAATAGTAAAATCTTTGTCTTCATGTAACATCTCAC ACGAAGATAGCCAATCGGTGTCCTCCTCAGAGACTATTTCAAGTAAAACA TCAGGCAGTGTTAAAGAAGAGCAAGACGGTGGAGAGAATTACGTCATCAC TGAAAATAATAACAAATTTGTGAAATCAAAGACTGAACGTAAAAGTAAAA TTTTCAAAACACTAAAATCGTTTGTTGGGAAGAAATGAATGGTATTTTTT ATGAATGAATAGTTGATAGTTTATTATATTACACGCGAGAAAGCAATTTT GATAGTACGAACAGATTATGCATCAATCCCTGTTCTAGGCAATTAATAAC GCAATATCTGATCAAATGACATATCATAGAATACTTGGTTTACCATAGAA ACACAAGGCTGACTAAGTAATGGGTTTACCAAACCATATTTGTATAAATT TTAGAGTGAATTTTACGGTCTTCCTTTCTCTTTTCTTGGATGAATGAAAG GTTCGAAAACAAAGAAATGACTTAGAAAAGCTTAGTTTTAGTTTTCGTTA CATCATGTTGAACTATCAATTACGGCTTTCAATATCAAAATCTTGTTAAT ACAAATACATTTTTCAGAATATTTTTTTTTGATAATTTATAGTTTAAAGA ATTATATACGATAAAGCTGGCCCTGTCGTAAAGTTTTTTCTTCACAAAAG GGTTTTTATTCAAGTCGTTTTTAGTATATAGGAATGCTACGTGTTCTTCA TTTCCNATCGGAACGTTCTAATACTGCATCGCCTTCTTCACTAAAGACCC CTCCCTCTCCGCAAAACTTTCGTCGAAACGGCCGTCTACGTGGTAGCGCT GGTCCCGTGTTTAAATCTATATTTCAAAAGAACAGTACTAAAATGCAGAA AACAGTTTCCATGGATGCGTTAAATACAAACAAATACAGTGAACAGGACG ATAAAAAGAAACAGCGGGCGCTTAAAAAGCGGAACAAAGAACTACATAAG AGTGCAACAGTTATCGCACAAAGGACTACAGTTGAGAGTGGTTATCCAAT AGTAAAATCTTTGTCTTCGTGTAACATCTCACACGAAGATAGCCAATCGG TGTCCTCCTCAGAGACTATTTCAAGTAAAACATCAGGCAGTGTTAAAGAA GAGCAAGACGGTGGAGAGAATTACGTCATCACTGAAAATAATAACAAATT TGTGAAATCAAAGACTGAACGTAAAAGTAAAATTTTCAAAACACTAAAAT CGTTTGTTGGGAAGAAATGAATGGTATTTTTTATGAATGAATAGTTGATA GTTTATTATATTACACGCGAGAAAGCAATTTTGATAGTACGAACAGATTA TGCATCAATCCCTGTTCTAGGCAATTAATAACGCAATATCTGATCAAATG ACATATCATAGAATACTTGGTTTACCATAGAAACACAAGGCTGACTAAGT AATGGGTTTACCAAACCATATTTGTATAAATTTTAGAGTGAATTTTACGG TCTTCCTTTCTCTTTTCTTGGATGAATGAAAGGTTCGAAAACAAAGAAAT GACTTAGAAAAGCTTAGTTTTAGTTTTCGTTACATCATGTTGAACTATCA ATTACGGCTTTCAATATCAAAATCTTGTTAATACAAATACATTTTTCAGA ATATTTTTTTTTTTTGATAATTTGTAGTTTAAAAAATTATATTGTACGAT AAAGCTGGCCCTGTCGTAAAGTTTTTTCTTCACAAAAAGGGTTTTTATTC AAGTCGTTTTTAGTATATAGGAATGCTACGTGTTCTTCATTTCTGAGGAA AAATTATTACCCTAGTAAAATTAGAAAGTTATTAGTTTTTCGACGATTTT TTCCACCTTTTTGAGAATAGAAAATATTTTTTATTACTAAAAACCAAGTG TACAGTATATATTATATGTTATAAATATTGCAAAACAGTCAAA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001674TCONS_00001674Clytia hemisphaericatranscript
TCONS_00001673TCONS_00001673Clytia hemisphaericatranscript
TCONS_00001672TCONS_00001672Clytia hemisphaericatranscript
TCONS_00001671TCONS_00001671Clytia hemisphaericatranscript
TCONS_00001670TCONS_00001670Clytia hemisphaericatranscript
TCONS_00001669TCONS_00001669Clytia hemisphaericatranscript
TCONS_00001668TCONS_00001668Clytia hemisphaericatranscript
TCONS_00001667TCONS_00001667Clytia hemisphaericatranscript
TCONS_00001666TCONS_00001666Clytia hemisphaericatranscript
TCONS_00001665TCONS_00001665Clytia hemisphaericatranscript
TCONS_00001664TCONS_00001664Clytia hemisphaericatranscript
TCONS_00001663TCONS_00001663Clytia hemisphaericatranscript
TCONS_00001662TCONS_00001662Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001672-proteinTCONS_00001672-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:416724..497466 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
5.48 5.01 1.15 0.61 19.15 13.86 13.42 14.96 8.04 10.96 7.64 7.76 21.13 19.85 11.04 10.79 26.65 28.25 26.86 29.07 15.78 14.78 16.08 17.47 18.12 18.18 16.23 9.85 18.5 19.35