XLOC_000011 (gene) - C. hemisphaerica

Overview
NameXLOC_000011
Unique NameXLOC_000011
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:494495..520408+

Legend: transcript
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000011 ID=XLOC_000011|Name=XLOC_000011|organism=Clytia hemisphaerica|type=gene|length=25914bp|location=Sequence derived from alignment at sc0000001:494495..520408+ (Clytia hemisphaerica)
taaagatggcggacaaGAAAGTGTGTTGATTCCTGTTTTTGCAGGTTTGT TATTTCACTTTGAAACACACTGCATGAAAAATGATCTTTCCGACTGTCCG ATAGACGGTGAAAAGGATTTCTTTCTTCGTATTTACGTGCACCGTAAAGG ATTTCTTTTCGAGTGCACGATAAGGACGAAAAGTATCCTTTAGAAGCTTT CcgaaaagaatatatttccatTCTTTTCCGTAACCGAAAAGTTATCATTT TCTGTCTCGAAAAGTACTGGAAAGAATAcctgtttcttttcaatttacGA AAAGGATATCTTTTCGGTCTCGAAATTGCANNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNATTTTATGATTTTCCGAAAAGAACTACTATCAGACGTTGGAAA TTCACGGAAAGAAAAGATATTCTGCtggtaaatttatataaaaagaaaaa tttcttcaaaccTTCCGAAAAGAAGAACTATCAGAACAAGAAAGTGTAcg aaaagaactaattttctgataaaatattttttaaaggaaTAGGTTTTCAT CGAAGCTCTTGCATAGGAAAGCTTTCTAAATTCGATATTGTACAGGAAGA ATTGATTTTTCGATCTTTTTTGATGGAATGACTGAACTATTTATTTGGTG TACGAAAAATACTTCTTCTAGACGACGGAAATTCACggaaagaaaaaatg ttttgctggtaaatttatataaaaagaaaactttcatcaAACCTTCCGAA AAGAAATAATATCAGAAcaggaaagtgtaaaaaaagaactaattttctgA CGTATTTTAAATACGAAGTTTTCATCAACCGACATTACTGCCGTTTCAAT GAAATTAGACGATAGATTAAATTCGATACttggatgattttcttctttaa aattaaagtcaatattaaataaattcatattaatatatatggtgaagttA AATTATATGTACTCATAATTCTTGtgctaaaaatatatataagtaTACCT TATTTACACAAAATGACttatattaataaaataataaattataatatcta atttttcttgtaaaaaatgacaaaaattgatgTGGTATAGTAGGAACTTC GGTATAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNAAAAATTGTTTTCGTATAAAAAAGGTT GAACCAACTAACAAAAGAAGTCGGACAATTACTTCTTCAATTACTTTCTC CGATTTTCCGTTCAAACGATCTGTATCCCCCCTCATTGAAGATGTTTCTT TGGTTGTGGTGTCGAACAATGATATTTGCTTCCTTTTCTTATAACCATAA TATTCACATCTTTGTCTTCTGATGAGACGATTCATTCTGTGATAAGTTTT CTCCACACCTCTTTGACATTGCAGCGAAATGATGTTTCGGCTCTCTCCGC TGGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNTGCCGctttatctttatttcaaattga aaataatcagtggaaatccaaaatgacttgaagattacaaaaaaacataa tagcaaGAAAGAAACTATGTTTTTTTAGACaggctattccaaaaataact aaaaaagtGTACTTACACGATCATTGCAGGGCCTCTTTAGCATTATTGAC GCACATATTCATCGCAAAGTCTTTacttcttacattttgttacaTTCTTT GGCTTACTGTAAAGTCCGTGTGAAAAAATGTTACATAATTTCGTGACAAA TCAAGTCGTTTCTTTCCCTCtttaatttctgccaattaaaatctctttat tAACATTGTTCAATGAGAGACTTAATTGGACTGCAATTGAATATATCGTA ATTTTTCCAcgattataaatgtgttaacacagggtcccaaagggaatggt gttgtttagttcaaacagttaattgtaatttttttgatgaaaccgcCTAA CAAATTTTTCAGCCTTTAAAATAGCGCCGAAAAAAGAGAAAGTATACGAa tcgttaagaacattttaaggctttgaggactcgaaaacacccgatttctt aggaagtAATGTGCGGGAAAATaataacatgttaagaacatttttaggct gaaaagtCAAGAACTcccgaaagcttcaaaatttttggatgttcttataa aaaaacgcgtatTTATGAAATATCGAagtgatttctttttaaatactttC CTGGTTCGTTATATATGTAAAACTCGTCAAACTCGCTGaccatgaaaatt attttcggaTGATTTGCGAAATATCTAATTCCCAAAAATTTTATGCTTTC TATAATGTAAAGTACAGGCTTAAATGCAACCTACTAGCCATAAGCGCAGC GTCGCGAGGCCCAAAACAGTGAATCAatcaaacgaaacaaaaagTAGCTG CCGAATGATTATACTATcttcattttatgaaagaatgccTCAAATAAATT GTTCTTCTTTCCTTCTACAAAACGCCTTTGCACTTGATTCAAATCAAGGA ACAAAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGgaacaaaaaatt gccttgcATTACATTTTTCAACTATAATGAAGTAAATCGAGATTAGCACT TAATTAAAAGACCTTCGTAGGCATAATGGCTAGCcgaaaataatctcaaa atggaatGATATGAAAGATTTAAGTCATGTATGTCATGTACAATGTCTTT CAAGAAGATTGATTTGAGCACGTCCAGTTTCCAATCGTTGGTTTTTAAAC ATCTTCAATTAGTCTAGTTGATGTTGAAAATCTGGTGAAGGTGTACAAAA AGAGCTAATCATACCCCTGTCACAGtgtcacagccccggtggagcttctc CCACTGTAGGGATTAAAGTTTATACATGGCATTTTCCAAGCCGAGAcaaa attttcagccaaattttgtaGTGGGTCCCACAAGGTCTGTAATACCGGCA GTACCGTGATGGTTTATAATCAATTATGGGACAAACTAAGGAGACAATTC CGGAAGTTTGGATctttcaatgtaaaaaatataGGATATTTCTTATCGTT TCGACTGAAAACTGCTAATTCTATGGTGCGAAAAAGCAAAGCACCTAATT TGGTCAACGAGGACGGCTCTTCTTTTTCCTGTCATTACTTTAACAGACAC ACGGGTGTTTTATTGGACACTAAAAAATGATCTTGTCACTTTCTAAAGAA AACATTCTCATAATGCtctcataaaattgaaaatatactacTTTTGCCAC ATCAGCTGCAAGAAAAGCTGGACCTTACTTTTACCCCGACGTAGAGAttg taatgttttttaaataCGAAATTATTACCTTTCCTTTTATGATGATTGTA TCTTCGATAAATtcggcatgaaaatttgatatttttatgaaaaagctttt tgtttaaatttcaagaagaacactttgatattttcttaaacgaagaaaag acaatcaatctagaaacatcaaattcttacattttaatgaaaaacgacaa aagGAATTATCCACCTTTTCGGAGCTTTAGCCAAGAAGAATGAACTAACG GGTGTCACAGGCCCAGTGTGAATCCCCTAGTCACCAGACACCCTGCCTCT GTACCCAATTTGGCTCGCATCCGCTAGTCACCCCAGTGGAAAAATAATTG CCAAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTTGAATGAAC ATATTTTAACTTGCTCGCAATTTGTGATTTCATGGTAAATTTTAGGACAA CAAATTAGAGCAGAGATTGATTTTAGAGAAACCTGAAagtattaattaaa actttattaaaaaTATTGTTTATGGAATATAACAGCTTGTCTGCACAGTC AGATCCCCTTTAGAAAACCCAAAAAAGATATCTTTAACGTTTGACAATAA AAGTATGTTTCAAAGTATGTTTCGGTGTTGCTTCNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNAAAGTATGTTTCGGTGTTGCTTCACCGGCTGTTTATGTATTG GATGTATACTAATCTGGTCGGgcatttatttattaaaaaaattcatcatt tccACATCCCACCTTCAGAAAAGTGGCTCTTTTTGGAAATCCAAAGCTGT CAAAAATAAACTCTTTACGAATCACCAAGACATAGAacctttccattttt cttttttcaaaatagtggCTCTTTTCGAAAGCCAAAAGCTTTCAAATTGA TTCTTTACGATATATCAGGATAGAGAACCTTTCCATTTTCCTAATGTCAG AAAAATGACTCTTTTCGGAAATCCAAAAGTGGCGAAAATGATTTCCTTTC CAATTAACAGGATAAAACACCTTTCcactttttttgtagaaaaaatatat ccttTCAATTATAGTAATTGTccgaaaataattacttttccatcgaatcg aaaaacaaacatttctcaatttttgatatcacgaaaactaattctttttt gtttcaaaatatggaaaagataatttttcggaaaaaggatttggaaatgt ataatttttttatttgatgtccgaaaatctttttttttcgggCTTCCAAA AAATGGAAAGAAGATGGTTTTATGCAGTGACAGCTGGGGAAggattaact taaattttgacaGTCTAGACTTAAAGTCCtatatatcaggattagaaact aggctagtcttaccccTTTTATCTTTGCCTATGTCAATACactgctgaca agttgacacaacacattgacaaataATCCCTGTGAGAAGTTTAaatatcg aaatctgcaacaaaaacgaaagtggtctcttcataatcttgatataggag tttcAGTCTATACTGATAGAAGATCCTGGAAGATCTTTCaatcattgctt aaatccttcaAACTAGAAATAtcagatttttgattttttttccaattctt caaatctccaaactcctttccaatctagAGAGAtcacattttttcttctt cattttcaagggAGGCAAGCTGggggaaaatagaaaatatatcCAACAAT GCaactatcaaaataatttttattttctcattcacaGCAAACACATACTT TCGGCAGATAGGTAGCTTCTGGTTGTGCTCGCAACAAGCAGAGGCCGCTT ACCGTAAAATGCAGCTTATAATAAGttaaaaaagagaatttccAAGGCTG ATCAATTTATTAACCCATTCAgacccattgaaagtttcttttgACACAGT AGCAAGTATTCAAAACATACTTGATCAACTTTTAGAGCAAGGCCATGTGC TAGTATCGTTTGATGTTGTATCAATTTTTACAAACAGCCCCCTTCAATGC ACCTTAAagattatttgtttgtttgttcagCCTTTCTTTTCCATAGGGAT TTCAACTAATTATGTTCTCATGTCCTATATTTGTATATGGTTTACTATTC AACtacattttattgattttattgttttatcctccaggaattttctaatt ttaattgttttgaatTATAAATTATATATAAATACAAAAATGGACTGACA TGTTTGTAAGAGAACTTATACTTGAATGGTGTATAGTTTTGAGTACAAAA TCTTGTAATTAAAAATAAGACGTCAAAATGACTTCTGAGAACAATTTTTT AGACAGAAGGTATTCagcacttaaaaaaaaaatcttcattgaCCTTTTTA ATAGaggaaataaattaaataaaactacaTACAAGATGAAAGCAACAAAT TTATCAAACTCCATCAACATGTCATCGCCTTTGCATCATTTTCGAGAGAA AAATGACGAGAAAGCTGTCAACATGTTGAGTATGATGAAAGATAAAAGTT TTGATCAACCATTGTTTGAAGCAGAGAAAGTCCAAGAAATGGAAGAACGC GCAAGATCAAGATTGAGTGAATACGATCCAGCAGATTCCTCTTTGAAACA AGGTAAGCGCGGCTGACTTTCTTTTTATGCAGTGTTAGAAGTTTTCTCCG CTCAGACAGATCTCTATCTCAGGGAAGTAAATAAAGAGGCTTGTATGTCT CAAAGTTTAATTCACTAAAGTTTCCAGAATATTTACTAACCTTGCTTTCA CCAGTGCTCTTATTCATTATTCTTGTTTCTTCCTGTTAGCTTACCTCAAG AAGGTTGAGATAATGTGTTCtctttaaaattcttaaaaaaataaaagtta actgTTGTCTTCTATAGTCCGTTCAGTGTCATGCATTGTTTTTGATAgtt aataaaatgaaaagaatcACATCTGAAAGCCGTTAACAAATATCTAACTG AAAATGAACAAACTATAATTTTAATCTTCATCTGTTATGAAAATGAcatc ttaaaataaaaatttgaatttaattttactATCTAGACAAGTAATATGGT GGTCTCCTGCAGTGTTTGTTTGAATCCAGCTATACTAGAAAAAGAGACTA ACAACTgtgataataataacaataacaattACAGTACAGTTTTTTATACA ATCTTAACCCCGCAAGGATTGGATCAGCCATGTcatttttcaataatatt taAACAAGGTCTTTttactttaaagattttttaaaataattattgTAATA GCTTGAtgtaatgtaatttaactaaactTTATTTTTCAGCTACCACTGAT TCAATGTCTTCTAAATCTAACCTCTCTACAATATCAAAGAGCAGtcataa atgtaaacaaaatttatatataaatagtaaatttaaaaTGTATGTCAAAG TTGactattaaaatgaaaaatatctttaatccTATGAATATGTATCGTTT TGATTCAAACTTTAAACAGATTTGATTAATATCTTTGAGCCATTATGTTA TGGCCTCCTTTTAATAATTAACATACAAATTGTACTTGGCTGGATTTGGT CCAGCTCCTTGTTTGAAAATACAGACTCTAAGTtgctttttaatcttttt tgcaGACTTTAAGGCCGGTCTTCACTTTTGCGCGATATGAGCAAAAACTT TTGACCGAAATttgtaacggatgaaaaaaagtagaacttcctttaacttt tttttttcgcgcaaaatttttttatgacgtaatcttttcttcaggcaaaa aaggtcaAGAAAAAAGCTGTCACCCATATCGCGCGGAAGTGGAGACCAgc attttgataaatatgataagATCCAAGAGCTAGTATCATTATTTACTATA TAGATTATCAAAAGttgatttgaaatcaatttcttcGCATTTTTTTCTAG ATGATTTGTCTAAGTCATACCACAGTATCAGCTACTGCGCAAGTCCATGT CCTGGTAATATATCAACAAACAGTCCTGCACAACATTCCTTGAATGCTTC AtggcaattttttaattttatgggTGGATCAGCTGAAATTGAGAACAACA CCAATTCGCAGTATAAAAAACCTGTAAGTATAATAATGCTCAGGGAGCAT AAGGTGCCATTGCATAAAAGTAGAGTATCTCTGGCTATGATGCACAAGTT TGTGGGTTTCAAACAACAAGAGTTTTTAGAACTATATTATAAtctttttt ctcaacttcagttgagctagaatctgacaaagACGTATGTGTATGTGGTA Tgtgtgtatgtatgtctgtctgaaaactttggggcaggatggagacttca aaaatgatcggatttggctgaaatttggcagacttgttccttgggtgttc atctgggggcgttttttttcattttttgaaaattttaatttttaagggcC TGGTCATGAGTTTTAgctccaaaacgaggctgaaactttggggGTAGgct tgagacttcaaaaatgattgagtttcggctgaaatttggcccaatagttc attgggtgaatatcttagaatgttttttttcatattttgaaaatttttat ttttgggacctggggacaagtttttcatcaaaacgAGGCTTTAGTTTACA TTGGACTTTTCTATCAATTTTACATTTGGGCCTATGCATGATTGAAAAAT ACtaaagttgagcccagtgcggtttGCAAGTTCGTCATATGGGAATATAA TGAAACCTCTTGTCCCATCTGAGCTAATTCAATATTACTGTCTCATGTcc caaaagcaaaaaaaataatgatggtttatgaaaatctttttgaccaaaaa attaaTCATACCACATCAAACTTAATCATAATTTTTATCTCATCAAAATT AAAGCCAGGTTGATGATATTTAAATTTCTGAGCTTGCAAGAACATTGCAG TTTTTAAAACGAATCATTAAAACAAAACAGTGCACACTACgtcatttgat tttttatttgacaatgGAAGGTCTTCTTTCTGAAATACATAACACAGACC ATCAGTTTATAACACTTTGATGTTGGtcaacattttaatttttttttgca taatttgCTTTTACAATATCAGCAAGcaccttcaaaataaaatttaactt tCCCTTTAGACTCAAGCTATAGTCACCATCAATGCAAGGACATCTCGTAT TTTGATTACCAACGAGACAGCATGTGACCTGTTTGGTTACACAGATGAAG AATTATGTGGCAAGCACATGAAAGTATCTCAACTGTTCACAATGGAGGAT GGTGTGAAACAGAATGTTTTGATTGAACAGAATATTGATAAAGAAGGAAA TATTGTTATGGTTTCAGGGAAAGTGGTATGTGTTTCgaatcattattttc aaaataaataaataaaattaagaagTCAGTATCTTTGTGTTCTATGATAA ATaaaggagcgatggccaagtggtcaaaggcgtcagcgtctcaaaTCAGG GATTCGCAGTTCGAATCCCCGCACCTTCCAATGTTCTGTTCaattcatag atagccgagccggctggccgtggaccccgtgaaaacaatcgaaagactgt ctataagtcctagattactgggctatccacgtaaaatatcgactctatct atctatctataggGTAAATTTCCACATAAGGTGATTATTGTGTTGTATTT AAAAAAGGTTGTCAAAGTATAAAGGTTTTTGCAGGAgtattatgaaaatt ttcatatgtttttagttttgttgtttaaaataaatttcttgCAGTAAAGG TTCTATACATATTGTTCgaaccttttcaaattcaaatagaCGTCTGTCTC AGcaaagtataaaaaaattttgtgtttcataattcaacaaaattgaaaaa attcaacaaaatctgacATGAATTTGAGAAGTCTTTGGTACCCATTCTTT TGTATTGTTTTAGGTGAACCAAAGAGCAAAGAACACCGCTAAGGGTTGTT TTTCAgagagaaaataacaaaatattgttttcacTTTTCAGTTAGAAGCC ACCAATAAGAAAGGAGACATATTCATGGTGTCTGTATGGATGAAACGTAT ACAAGCAGGGAGTGATGTTCGATGTGTGCTCATTATGGAACCTGTTGATG TCAACAAAGGAAGCTTCTTGTTTGATGCTGCtgtaagattttgaaatttc agtcaTAACTTCTGTGGACTTCTCCAGGTACCAGAAGATCAGCATTCTTG GATAATTGtctttgaaatttagaaaatattttcaaagtagTGCTTGTAAA GACCTTGAAAACAGTCAGAATTGTCTTAAATTTACGACATTGTTCCATGT AGggagttttatttttcattttctgaaattATTCCTAGGGGATTCAGAGA CTGCGTGAGATACAAGGCTTTTAATTCATTTCTTAAgcctggaaattttg aaaaaataagagAGTGTCTTTAGTATGAGTTgtaaaaatttttgacaaaa taacaATACAAATAATATACCAATTTCAAGCATAATAAAATTTATGCCTC ATTATCTCATTGCTAGGGAACAATTTCAGATTGTGATTTCACTTTTGCAC TTTTGCATGGTTATGAAGATCCTCAAGATCTGATTGGCAAAAACATTGAC ACGTTTGTCCCTTCCTTTCAATTACCATCACCTGGTCAAGTGCTTTCAAA GGTAGGTGAAAAAGctactttttatttataaacaagGGGTAATATACTTT TATCATCTCAAagtctgaaaattaaaacacGACACTGTCATACTTTCCTA CGGGGTTGATACCCCACCCTTGAAAACAGCCCCCACCCTTTACCACCAAC CCCGCCCTAAATGTAGAAACTCTTTGAACCCTGCCCTTTCAGAAAAACTC CGCCCTTGACCACCAAAATATCCATACCCCAcccttcaaaaaaaacaaaa aaatttccacgtGTTTCCAGACTCTTAGAACTTGTTCTCAGATAGGCCAG AGTAAGTccagtttttatatttatactaaaaataacagaaatgtttgaat ttttcattatcTTGCAGAATTACTTGAGGGGATAAAGCTCCTCTTTTTga gaagaatatttttatttgtggGCGCCCCCGCCACGTGCTGGGAAAAGATT GATTTAATGATgattaaaaatcattaaaaacaaaacaaaacacaatataa aaattgaaggaaaaagCCCCCCACCCTTTGCCACCAACCCCGCCATAAGT CAAGAAATCCCTGTAAACCCACCCTTTCtgacttttttgggaaaaccgTT TACCCCACCATCTAGCTAGGGTGGGGTGGAAAGTATGACTGTTCCTTGTT TGACAAAAAGTTGAAGACCAGAAAACTAGGGAAATATGGTTATATACTTT CTACCTTCTCTCACATATTCTTAAAgaataatcttaaaaaaaaatacagc tAACTCCTTTTATAGGACATCAAAAAGCAACGCGTCACAAGCCGTACAAA AGACTTGGTTCCATTCCCCTCAACAATCAAAGTCAGAATTCATGACCCGG AATTCCATCAGCTTTACATGGAACGAACAGCAGAAAACAAACGTCAAATG TCTAAATTCTTATACAAAGGCTTCTTATGGGTGTTTTCTAACGTTAGTGG TTTAATGACCATCGATAATAAAGGTCTGGTGACGAGTTGTAATGAGAATT TCTTGAGAATCTTTTTGGGATATTTTGAAAGTGAACTAATGGGAAAGGTA ACTGTTAATACTTTGTTCAttcaatctttcattttatttcattaaCTCCA AgctctttagatttttttttagcCCAAAGGGTGGGCATACAATATGAGGT CAtacatgaaaattttttcacgATTTCAAAATGTAGATTGTTAGTACCTA TAAAGTCATGTTTCATAAAACCTGTTCTAGACGACCTATGACCCCAAAAA TTTGCACATGCAGGAGAGATTAAGATTTATTAAACgtcagaaaattttaa atcgTTTCTAAAACTTTTCGTTGATATAAAAGAAGATCaacgtggtagat tctacccctcTAGCAAATAgggttcgttcgttcgttcgttcgttcgttcg ttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgtt cgttcattcaTTGGGTAAATAACTATCCTCATTTTTTTGTACCTGTATTA TGCGTACCCCACTTTGCAATACAACATGATAAGAACGATGTTAGACGATA TTACAGTAGATGTCAACTCAGAGGAAAGAAGAATCTGTGAAATAATGACT ATTTTCTTTTCCAGGAAATCACAACGCTGATACCTTACTTTTACGAACAA ATCGACATGCTTCATCATGGTTCCATCCCTCAAACACCATCATCTTCAAT TAAGCGTAATAAACATGGTATGTTTTTCATCTTGAGCagaaatgcaatta aaaggctccaattttgatgatatttttataACTATTATAGCCCTTAACCC ATAACCCTTTACAACCCTTTAACGTCGACTCTTACTACGCTAAAGCTCAA TTATGCTCCATTTTTGAGCCTCGCCCTAATTTATTTCTGATCCCTTaccc ggtgtaaaaagggctgaTTAGGTAGTTGGATACTTTCACAtaaatttcac attttaaaggttttgttttcaagtaagagtgatatcgtttgcttactcgt caattttaatgcacaagctttttcacattggattgacatggatgtggagc aagattggtcagaaagaggaaaagaaaaacatttttttgcttatatcagc atgatATAACAATATGCAGAcactgatatgaaatatgtgtctgatatgaa acgggaacacttctGCCAACATAAAACCTTTAACTCCCTTTAGTTTTCGT CAATTCAAAAAATTCACTTTCGGTAGTTTAAAAGGGTACAGGGGATTAAA AAAGGACTTGCATAGACTTCCATGCTAGTGATCTTTATTCTTTGTCTGGA TTATGGACATCCCCTAAAACGCAAAATTTGTCTTGGTTTTACGACAACTA ATCcaccattttttgttttgatttttggttaACAACTACGGGATTCGCGT TTTTACGCTCGAGAATCCATCTTTTACGCTCGAAGATCCGCCTTTTACAC TCGAAAATCCACCGTTTACGCTCTAAAATTCACCTTTTACACTCAAAAAT CCACCGTTTATGCTCGAAAATCCATGCAACAGAAAGCAACATGCGGATTT TAGTGGTCGAAAacttttgtgagtattttgcgAGAAAGTTACCTTTGTAT CGAATGCTTTTTTTCAGGTTCATGTAAAAAGGATGATCTGGTTATCGAAT GCCTCGATGGTCCGCCTGCTACAACAAAATGTGGTCTCGATGATACAGAT CTTGAAGAAGGCGAAATAAGAAGCACGAAGAACGACAGTGGAATAAATGA CGAATCGGAAAGCCTGAACGATCAAAGCACACCTCTTAAAGACGAGCGTT TGAATAACAGAGGCACACCGTTGCAAGAAGAACATCTCGATAGTAGAGGC ACGCCTCTTAGAGATGAGATATGTTTGAATAATCAAGACACGCCTTTGAA AGACGAATGTTTGGATAACACAGGAACACCTCTTAATGATGAGATTTGCA CTAATAAGTTGAATAATTGCGTCAGCCATCAGGCGAATAAGAAGGACAAA CTCGATGGATTTTCACCTCATACCATAAGTACACCTGTCTCAGATGAGAA GAGAGAAACGAACATTGATAGAATTGAGGGGAAATTAACTGACCAGATTA CCGAAAAACAAAAACTGGACTTTGGTCAAAATGATCGCGAAGAATCTTTG CGTAAGACAGATATTGTTTTTACGGATCCTgttaaaattaaagatggtgC TGTTGTTAAGGACGCTTTTGTTGCCAAGGATACTGTTTCTAGGGACGTTT TGCAacacaaacaaatcaaaacgAGTGACTATGAGTCTTTGAGCTCGTCT ATTGTGGACGATGTTTTGTCTCGGTTATCCAAAAATACTGAATTATGTAA TGAACAGAAAACACGAGTTTGTGCCAGCAAGGCAACGTCTCAGAATTTTA CAGCATCAGAACAGAGTGGACTCTCTGAtcttgtttttgaggactgtaaA AAAGAGATTTTAGAGAAAGATAAAGGTGATTTGAGTAAAATTTACCCTGG ACAATATTACGGGCAAGCGAGACACAAAGATGGTTCAATGTTACCGATTT TGTTTGAGGTAAGTAAAAAGTCATGATAATGTAGATTGTTACAGCTTTTG TAACACTTTTCCTTTTTTGTTAAAGCGAAGCTAACGATATtgaaattaga gcctttaggctgttggtttgccgtcacccgatcCTAGGTTTTGGAGTTGG GTGGGTcggtatttaaaaaaataaaatctgaaaagctAAAAGGGAATTCA TTCTATTGTTATAAACTTTAAATAGAACGAGACAGACACAATAGACGttc tgatttgaaaaaaaaaatgttctttaaaattggcaataaaTTTTTTGGTA TGTTTCGAGTTGGAGTCGATTGGATCGGATGACGGCACaccaacattttt ttaattgcAGCCTTTTATCGCTTTTTAAAATGACGAgcttgcaaaaaata ttgcagtttttttttaaacaaattatcaTAAAAGATTTAACACCTATTTC TAAAATCGCGTGATGCACACCATTAATTTTAAGATGCACTGACGTTTTGT GCCAGATATTCAAAAAAGGTAGCATGGATAGAAGGGATTATTTTTCTAAA GGGACCTCAAATTGTTTGGGCGATAAAAATTGTTTGGGCGATAAAAATTG TTTGGGCGATAAAAATTGTTTGGGCGATAAAAATTCGAGTTATTGAGGAT CAACTTTAATATATTGAATGCCCAGCTGgcccacaacgttgtttcgacgt ttttctaacgttcacaacgtccatataacgttagaaaaacgttgaaacaa cgttgtgtgccagctgggtgtgTTCAAATAAATTTCTAGCGACTTGGTTT CGTACAtagaatacagttgacgctctctctaattcgacgttctacttcTA CTATTCAACACACTCCATCATTCGatagtcaccgtcaacaagaaactctc ataaacaacgttctactattcgatatgctCCATTATCcaatattcaatga aaatccgattccccttgaaaatcgaattagagagtgtcatcTTTACTGTT CGATATTAAAGTTCATTTATCACACTTTTTTAGATCAAGAAATGGTCAAG TAAAAGCAAGAACAAAGACAACAACAACGGACAACTCTTTTGTCTTTGGA TGTCACGTGATCCCGATGAAGAAACCGAAACTTACGGTACCGAAAAGCAC AAACAATTGTTAGCAAGTTTCAACAGTACAATGACTATATCGACGGGTAA TTTCCAGGAGGTTCGTTTTTTACAAATTTATCTGTACTGAAAGCTTTCCC TGGAGTCTATTAGACCCTGGAACTCGTAAGAAAAGTAAACTTTTTAGCTG AGATTGACAATAAAATTCGggacaaagaaaaatttgaattgcttcaaaaa aagatttgtaaTGTATACTACATACATAagattttgtttggttttatcCA GGGTAGTGGTGATAGAGATACTTTTTCTGTACTTTCAGGTGCTTTACGGG GGACGAGTCATGAGGTCCGGGTGGttgggaaaaaattaattaaacatTTT ACTTACCGAGTTTGTCAATAATTCGAcgttaagtaagtaagtaagtatat tcatctggtggttcattccccttttctatttgcgctagacctgggaaaTT GAaggctgaggtggagcgccacacctactctcagctcccagtaacttacc gcttAGGTCAGAtcacccaatctaagctactcatccgctgagttggcggt gaccggggatcgaacccacaacccttagattgtaaagcgaatgctctacc gactgagctacccggccacAAAAGGAGAATAAGTAAACTGTTTGTAGTGT CTGTGTGAGAGTCTTCGGGTTATCTGTGAAAATTCCATTGCTATATTTCC CAGATGCTGAAAGAAATACAAGATATGAAACTAGAAGATCCTGGGTCTGG TCTTTATAACGATAAATTTAACACCGCACGATGTATTGGAAAAGGCGCTT TCGGTTTTGTTAACCTTGCAGAAAGAAAATCTGATAACGAACAGGtaata tggaaatatgaaaatatcGACTCCGACTATCAGCCTCTGAAAACTTATAA GAATACGTATGGTGAAATCGGCCACAAAATTAAGACTATGGTAAGAATAC TGGCATCATGGATTTTGGCAACTGAACCCAAGAATgcccatttttagagc attttaccaTTAAATTGCTAATTATTCCCCAGCAatgccaattttttttg ctccATGTATGTATTTCATGCTAGATTTTGGAtccaaacctaagaatacc ttaagaatattttcagaatgattttccccaaaaaagttaagaatattcat gatggaTTGAAAAAACACCTATCCTATAagaagaaaaagcgtgtatccaa aagatatttctattCAATCGAAAGGTTGTGGTCAAATTCATTAGGGACGC GTGCGCCTAGCAGACTTAAGGCcagggcaaaccgatccaaNctccccccc ccccccccttcagcCCTTTAAAAAGCCgatcttacatttttttataagaa tatactttattagaatatttatggtgaaattgaacaaaaaatttaagaat atggtaagaataccgGCATCAgggaatttggcaactgaacctaagaatgc catttttagatcATCTTACCATTATGTAAGATGCCGATTATTACCCAGCA ATGCTAAAGGCTtccacaaaaatgccaaattttttttctggaggtatgta ttacatgctAAATTTTGGCTAGATTTTCTATCCAAACCTAacaataccgt aagaatattttcatgACACCTATCTTATAAgaagaaaaagcgtgtaatca TGATATTTCTGTTCATCAAAAGGTTGTGGTCATTTTCATTAGGGACGCGT GCGCCTAACAGACTTAGTctgccatcttgttttcaattctggttGTCAAC AGCtcatttcgaatgttttgaaattcgaacgttcgaaaatttaaaaaaac ttcaaaacgaAACACACTCCCACGGGATATCGGTTAAGTGTATAAAGGAA TATGATGATATATGTGCTCATACCTATAAACCATTTAGCAAGGTGTTCTA TTCATCAATAGGTTGTGGTCAAATTCATACgtaaagaaaaagttttgaaa gacaGTTGGATTGATGATGCAAGCATTGGTCGCACACCTTACGAAGTTCA TTTACTAAGCAAACTACAGCATCCTAATGTCGTTAAAGTAAGTGATTGAG TTGTTTTACATTTAATCTTTTGACATTATGGTGTTTTGCCACAGAGGACC TAAAGCTTAACTGCTATTATTTGAGTTTTGAGTATTAAACCTGAAATCCT GGTttcaaaatattcgaaaaaaaagtCGAAAGGAAGACGAATAACCAAGC GCAGAAAAAAGcatgacgtctagtataggctagtaTTGTAATGATTGCCA ACAATTGAGATTTCTAGACGTTACGATATTCCAGCCTGTCACCATGATTA CTAGTAAAATTAAACTTGCAGTTTCTTTTCCGTTCACAAATTGAGTAATT CTTGAAAAGTGTTCGCAGTTCTTCCGTCTCGACGGGTTTCCGTCTCTTCG AAGTATGAAAAGAGACTTTTGCGCCGTagaatttagcaaaatcaagCGAA ATATTGAAAACCTGGGCTAATTTTTCGTGTTGAGTCCATTTTCCGTCTCC GAGGAAAAACTTTGCTTTGAAGCTGGAAATCAGGTTGTTTTATATTCTGA CATTCGCTTATCAGACTTCTCTGGTCTAAACAAAAATTCTATgaaccctt tccgtgcccatGTCAAGTATATTTATATTTAAAGGAGgtgactctaagct atccaacgagctatgaacgagcttctaactccttctagatccggagatat ttAAGCTTTTAaatttgaactagcgattttcttaaaaaaactgaaaaaaa gggTTAAGGTATATGATACTTATATCAAAAtagcaaaatctgaaaattct actcatttttttgtttttgacagGTGCTTGAAGTATACGAGAACGATTGT TACGTTCATATGGTGATGGAGAAACACGGTGACGGAATTGATCTGTTCGA ATTCATCGATCGAAAACCACTCATGGATGAAGCTTTGGCTAGTTACATGT TTCGGCAGGTTGGTAGAATGATTgcccatttttgttttttttctgttacG GAGACAGTTagcttctgattggtttagTTCCTGAATGACAGACAACGACG TTAAAAAAGTGCTTTTACAAGTTTTtgcaaatcgcttcagtcaccactcc accgtcctcaaaagttcAGATACATAAACTGGCTAATAAGAAATTTCGAG TAGCTCaataaaaacctttttaaattctTTCGGTTGTTTTCGTTTTACGA TGACCACCAGAAGGCTGGGAGGATTGAACAAAACATCGAAATGACTTGTG TATCAAactcacagatatcttatataaaacactatatAGAGCCTCTTTTC CCTAAGCCTtggcaggtgaagcaaaataatgcgctaTCTTTGCTATAACC TCAGTAGAAACCTTGGTTTTCACTAACGACTTCAAAATTTCCAGGCTCGC GCAAGCGAAATTGTGAcgttattttatttaatattatGGTGGAATGACTG ACTACGGAGTGACTGTAACAGTTGGGAACAACCCGCACGTCCCCGCACCC AATTTTGGCTAAGTGCCTCTACCGGGCCTCCTTAGTCTGTCAGCATCTTC TAGACAAAACAGAAACTAACCGGCTCCGTCGCAGATAAACGCCATAtaaa ccacagatctgtaaggctcgaagggctagataagcgacttttatcgaaaa gtgaagcctaggtttggaaggatttcctactaaagtcacgtgactaaaat atgcaatttcaccggtttgagagatgtgaaatagcgtttgccgcctactt tttttgatctcgcgctccaaaaacaattaaaatgctagatcctatccgcg ggcacgaaatttaaaaagtcaattttttgtttcattttttttttgctgga gaaagcttgaATTGCATATCTAgcacttcgggctttacagatctgtgata TAAACTCGCTAACTTTGCTTGGTTtgaccatggaggtataaagaaagaca ggagaagtatgctattgtaaccaagctcgccctacgattaaaaaagttac gatgtatgcatgctcataatctcgtATATCGTCAGGGGGGGGTACagccg cagggtactaacccatagggtactaacctgatttttaagaaaaattgtct caggtaccaccaccccctttttagtaccgggtacttactttttcttaagg aaaaagggacccccacccccCTTTTAGTACTgggtacttacttttttttt aaggaaaaagggacccccaccccctttttagtacTGGGTACCGGCTTTAA AATTAccaaggaaaataagagacaccACCCTTAAAACTTGCCAAGCATGG TCCCAATCTTTCAAAAGCCAGCAAAAGCAGCTCTTTGTTGTTATTATGAC TTGCATATACCATGTTTTTAACTCAGATCCTCTTAAAGGTTCTTTAAATC AAACATACCTTTTAATTACAAAGGTAAAACAAGGAAATTCCttggcaaaa gtaaaatattatatagctgTAATAACGgcaataaaagtatatatatctat cagaagaagtaaaaatcaagttgataaaaattgaagaatagtATGAAAGC TTGGATTGGATGGATTTCGTTATGTTTTTCTTCAATAGAAGGGTGATTTA TTCAAATTGTTCAAAGCTGTGTCAATTTTATGAAAGAagttgaaatagaa aaaagttgcattGTTGGCTCTGGTTGGCTTTGCTTAGTTGACCTGCCTCC GTCTTAATTGCCATaaacagacaaacaaacaaacaaacaaaaataaacag aaataaGCTAAATCATCAGTTTGGATAAGAACTTTATTGTTTAAAAGACA GATTGTATCACTTTGGATGCAACAGCTTGTAATTCTTTTCATCAGAAGGC AATGACAAACATATACCACGTTCTAACGAACTATCCTTCTCACTAATTAA AACAATACTGATTTTGAACAATAGCTTTCTTTACATTAGCTATTTCAATA TTTGTATAACTTAGTGGTCATAAAATTCNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcattttctggcttgagaa aatatcttttcaaaacaaaattgaacggatagcgaaatggaacataaatt tgtttcgtggacgaagttttatctaattttcggatattaaaaggctagaa tcttcaatactgattattagaatgttcagagcaaacttgagttctaataa aaagtcttatttcatcgggcgagcttagaatttcttttgatacattttat aaaagaaatcaaaagactttaacgaccaattaccgacacattcaactcct gttttctttatacctctatggtttGACCAAACACTAGAAAGAAAACTACT ACTTCTCTACTCCTTCTCTTAATATAAAGTTTTTGAGGGGTCATTATTTG AAAGTCgttaaataattttattttgcgTTTTCCAGGTGTTATCAGCCACA GATTAtcttcatcaaaacaaaatcttACATCGTGATATTAAGGTAGGTTA TGCTTATTCGCCATTATTATCAACataaaaaatatgagcaatctgattgg ctaaaaacgcgtacataaatgctATATTTCATATTGTACTTTACAAATAC AAGACCGCGTTCAAAAAAGGGGTCCGGTAAGTGAGCGTTCATATATTATA CAATTTTTCTGATTATTCTCTTCGCTTCCAATGCACAACAACTTATcaaa agagtttatgaaaaaaatgttttgatctttttaatgaccatTCGATTCTT TTTTCGAAGGTTTTGATGTTTATTAATCtaattaaaagtaaaagaataaa atattggggaaaaaatcaaaacaaagaaaactgaATAGacataatatttt tcaagttgatgataaaccagttatcacacttttactcgtacaataagttg ttttaaagttttatttgGGGAACTTATTAAAGACTATTTCTCGTAAATTA GGCTGTTGAATAAAAACTTGAAGTTAATGTTGAGAGTGATGCTTACActg catttttaaacaaataaaaaacactttttctccACCTTCGGCACCGCGCg agcacaaattttgagaaGTTCGTTCgtttattctgctttgtcagcataga ggcgcGCCTCCTTTCTATATCGTGAAAataatacagtggagtctctatgA TTTGAACGCGTACGGGGAAAGCAAatctgttcgagttatggagtaaggtt tacaaggcattgttaactgaagggaccagaaaaagtgttcgagttaagaa gactATCGAgttagaggttcgagttaaagagtatCTACTCAGGGTTGCTA CGTCGAAGGAGATAGTTCTCAATGAAGTCTCGTAAACTTTGCGGAATTAG GAAACTTTTATCCTAGCATTtgaaattcccaaaaatttctGCTTGCTTTT ATACTCGGAACCAAATCTTTATATTTATGTTCAAGCTGATATTTCTTACT TCGTTATATTCCTCCCTTTTCAAATGACTGTTAAAGGAAAAGCTGAAAAA CTTCGTAATGGATAAAATGTCTGGAAAATATTGGGTATTTTGccaaaatc tggaaattttttgacaaaaatctggaaaatatGGCTTTTGAGAATAAAAG TTTTCAAACTGGCAAACGTGTAGCAACTCTGTACAGTATCTTTCATGCGT CTAAACTaatttattatgtttttttctatCTCACAGGACGAAAACATTAT AGTTGATCGATCGTTTCATTTGAAACTCATCGACTTCGGTTCAGCTGCAC CATTAGAAAAAGATAAATATTTCACGACCTTCTGCGGTACCATCGAATAT TGCTCACCCGAAGTACTGCTCGGAAATTCGTAAGTCAAACTATCATACAG AACTTGGAAAAAAAGGGACCcgggtttttggacctaccccggttgaggtc ctataaattaacctctgttcgtccgttcgtccgttagttaccaacttttc tcgagattggctcattagttttttctgattttggcacaaagatgcaaaat ggcaatggccaaaatgtgacggagcccgattttcNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNatggagggcaagattctctaaagaatggctgaagtggt ttttcccggaaaattcttattcgccttaaaaaacggattttcgtattggg ggaaattccctttaaccaaataagaaaatatagcttttctcaatgttgac ttattattttttaaaaatttttttcacaatgatgaaaaatggcaatgcct aaactgtgacggagcctgattttcaaaagacatttttttacggccgaaaa tgccggaaatatgccggaaaaactggttttttggcattttctcgggATTC TATCAttggttttttctgattttttgctcaaagatgcgtattaacaatgc ccaaaacatggccgagttcgatttttgagaaaatttttttcccggttgaa aatgccggaaatcgccgtgtttgcagattttcagtggattttttccttat attcatttctatgttttttacacaaaaacattattgataacaatgctcac catcaagcatNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNcccccatcaacaatcaatgatgaattttttgcgttatgcattttcgc taaacgctatattttctgactgattttttttcatttttctcctcgcattg ctatctattcagcatctagcttgtttttcaTGATCTTTCTGGAAGGAATC AGTTTATTTCCTTCCAATCAATTCATAAAGAGCCATGCCCAAAATTTAAG ACCCGGGGGGGGATACTTGAGCAAAATGAGTGCAGgatatgtgcgagcca taaggatcCCTTTTCACACCCTAGAAAGTCTCTcaaccattaaaaagcaa ttgggtctctgtaagggttccaaaaattacgaaaataaaaaattgactcc TTGTACGGTCTAATTGTGTAAAAATTGTGCACAAAGGCGTACAAGCATGA GACTTCCCACAATTGAAGTTTAGGGGtcaaattttcagatatgggttgta atgtttttctaaacgaGCATGAatgaaaaatgctttccaacggtatgtaa TATGGcatactttggagaaaaaaaattcattttagcctgggaacctgttc tggtctgtaaaatacacaaacaggtgccaatttattgggtctgagattta aatcaatttttgacccctaaactacaaTTGTGCAAAGTCTCATGCTTGTA CGCCTTTTTGCACAATGTTAATGACTTTTGGCACATTTAGACTGCACTAT CCCTTAAAGGGTCACAGCTTCTTGAAATTTGTAGTACATATCCCCCCTGG GAAAAGGGATAATCagagatggtttgagatattgtGCTTGTAGATTCCTA CCATATAGTCCTGAGAGAAACCTCTGAATCTTTTTGTCTTAAGTGTTTTC CAAAGTTGAGAGAAAACAAGTTTCTTTagtatctttttgttttgtattta ATCAAGATATTGCCTTTTCTTTTCTTAGGTTTCATTGTTCCATTTGATCC ACTACTATTTaaatttacaacatttttttaaattttgactaCAGATACCG TGGACCAGAACTTGAAATGTGGTCATTGGGAGTCACACTGTATACGTTTA TATTCGGTGAACATCCATTCTTTGAAGTTGAAGATTCCATCAGAGCGGAG TTGTTCCCACCTTTCAAAGTGTCTAACGGTAATGGATAAGactgttttct ttttgttttgaaaagtcatAGAAGATTTGTGAAATTGTCAAACACACTGA TCTCTGACTGCTTAGCTGGATCAGGCTTCCCTTATAAAATGAAGCTTGTT TAGTTGAAGAGCTGTCTAGTCAGCCAATTTGTATTCTATTCTGTGTGGTT GTTATAACAGTGAG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000019TCONS_00000019Clytia hemisphaericatranscript
TCONS_00000020TCONS_00000020Clytia hemisphaericatranscript
TCONS_00000021TCONS_00000021Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00000020-proteinTCONS_00000020-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:494495..520408 +
Orthologs
The following orthologs are found for this feature:
Ortholog NameDescriptionOrganism
PASKPREDICTED: PAS domain-containing serine/threonine-protein kinase isoform X2 Homo Sapiens
Expression

Hover the mouse over a column in the graph to view expression values.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 PH_1	 PH_2	 St_1	 St_2	 GrOo_1	 GrOo_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2	 FGOo_1	 FGOo_2	 GO_1	 GO_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2
34.82 26.32 16.77 20.34 9.3 10.72 6.94 6.46 3.5 2.94 2.23 3.32 3.3 5.04 6.05 5.11 3.49 2.31 6.15 6.28 3.52 3.26 6.02 6.36 3.06 3.36 7.34 7.98 8.34 10.09