TCONS_00000019 (transcript) - C. hemisphaerica

Overview
Name
Unique NameTCONS_00000019
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length3382

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000019 ID=TCONS_00000019|Name=|organism=Clytia hemisphaerica|type=transcript|length=3382bp
taaagatggcggacaaGAAAGTGTGTTGATTCCTGTTTTTGCAGaggaaa
taaattaaataaaactacaTACAAGATGAAAGCAACAAATTTATCAAACT
CCATCAACATGTCATCGCCTTTGCATCATTTTCGAGAGAAAAATGACGAG
AAAGCTGTCAACATGTTGAGTATGATGAAAGATAAAAGTTTTGATCAACC
ATTGTTTGAAGCAGAGAAAGTCCAAGAAATGGAAGAACGCGCAAGATCAA
GATTGAGTGAATACGATCCAGCAGATTCCTCTTTGAAACAAGATGATTTG
TCTAAGTCATACCACAGTATCAGCTACTGCGCAAGTCCATGTCCTGGTAA
TATATCAACAAACAGTCCTGCACAACATTCCTTGAATGCTTCAtggcaat
tttttaattttatgggTGGATCAGCTGAAATTGAGAACAACACCAATTCG
CAGTATAAAAAACCTACTCAAGCTATAGTCACCATCAATGCAAGGACATC
TCGTATTTTGATTACCAACGAGACAGCATGTGACCTGTTTGGTTACACAG
ATGAAGAATTATGTGGCAAGCACATGAAAGTATCTCAACTGTTCACAATG
GAGGATGGTGTGAAACAGAATGTTTTGATTGAACAGAATATTGATAAAGA
AGGAAATATTGTTATGGTTTCAGGGAAAGTGTTAGAAGCCACCAATAAGA
AAGGAGACATATTCATGGTGTCTGTATGGATGAAACGTATACAAGCAGGG
AGTGATGTTCGATGTGTGCTCATTATGGAACCTGTTGATGTCAACAAAGG
AAGCTTCTTGTTTGATGCTGCtGGAACAATTTCAGATTGTGATTTCACTT
TTGCACTTTTGCATGGTTATGAAGATCCTCAAGATCTGATTGGCAAAAAC
ATTGACACGTTTGTCCCTTCCTTTCAATTACCATCACCTGGTCAAGTGCT
TTCAAAGGACATCAAAAAGCAACGCGTCACAAGCCGTACAAAAGACTTGG
TTCCATTCCCCTCAACAATCAAAGTCAGAATTCATGACCCGGAATTCCAT
CAGCTTTACATGGAACGAACAGCAGAAAACAAACGTCAAATGTCTAAATT
CTTATACAAAGGCTTCTTATGGGTGTTTTCTAACGTTAGTGGTTTAATGA
CCATCGATAATAAAGGTCTGGTGACGAGTTGTAATGAGAATTTCTTGAGA
ATCTTTTTGGGATATTTTGAAAGTGAACTAATGGGAAAGGAAATCACAAC
GCTGATACCTTACTTTTACGAACAAATCGACATGCTTCATCATGGTTCCA
TCCCTCAAACACCATCATCTTCAATTAAGCGTAATAAACATGGTTCATGT
AAAAAGGATGATCTGGTTATCGAATGCCTCGATGGTCCGCCTGCTACAAC
AAAATGTGGTCTCGATGATACAGATCTTGAAGAAGGCGAAATAAGAAGCA
CGAAGAACGACAGTGGAATAAATGACGAATCGGAAAGCCTGAACGATCAA
AGCACACCTCTTAAAGACGAGCGTTTGAATAACAGAGGCACACCGTTGCA
AGAAGAACATCTCGATAGTAGAGGCACGCCTCTTAGAGATGAGATATGTT
TGAATAATCAAGACACGCCTTTGAAAGACGAATGTTTGGATAACACAGGA
ACACCTCTTAATGATGAGATTTGCACTAATAAGTTGAATAATTGCGTCAG
CCATCAGGCGAATAAGAAGGACAAACTCGATGGATTTTCACCTCATACCA
TAAGTACACCTGTCTCAGATGAGAAGAGAGAAACGAACATTGATAGAATT
GAGGGGAAATTAACTGACCAGATTACCGAAAAACAAAAACTGGACTTTGG
TCAAAATGATCGCGAAGAATCTTTGCGTAAGACAGATATTGTTTTTACGG
ATCCTgttaaaattaaagatggtgCTGTTGTTAAGGACGCTTTTGTTGCC
AAGGATACTGTTTCTAGGGACGTTTTGCAacacaaacaaatcaaaacgAG
TGACTATGAGTCTTTGAGCTCGTCTATTGTGGACGATGTTTTGTCTCGGT
TATCCAAAAATACTGAATTATGTAATGAACAGAAAACACGAGTTTGTGCC
AGCAAGGCAACGTCTCAGAATTTTACAGCATCAGAACAGAGTGGACTCTC
TGAtcttgtttttgaggactgtaaAAAAGAGATTTTAGAGAAAGATAAAG
GTGATTTGAGTAAAATTTACCCTGGACAATATTACGGGCAAGCGAGACAC
AAAGATGGTTCAATGTTACCGATTTTGTTTGAGATCAAGAAATGGTCAAG
TAAAAGCAAGAACAAAGACAACAACAACGGACAACTCTTTTGTCTTTGGA
TGTCACGTGATCCCGATGAAGAAACCGAAACTTACGGTACCGAAAAGCAC
AAACAATTGTTAGCAAGTTTCAACAGTACAATGACTATATCGACGGGTAA
TTTCCAGGAGATGCTGAAAGAAATACAAGATATGAAACTAGAAGATCCTG
GGTCTGGTCTTTATAACGATAAATTTAACACCGCACGATGTATTGGAAAA
GGCGCTTTCGGTTTTGTTAACCTTGCAGAAAGAAAATCTGATAACGAACA
GGTTGTGGTCAAATTCATACgtaaagaaaaagttttgaaagacaGTTGGA
TTGATGATGCAAGCATTGGTCGCACACCTTACGAAGTTCATTTACTAAGC
AAACTACAGCATCCTAATGTCGTTAAAGTGCTTGAAGTATACGAGAACGA
TTGTTACGTTCATATGGTGATGGAGAAACACGGTGACGGAATTGATCTGT
TCGAATTCATCGATCGAAAACCACTCATGGATGAAGCTTTGGCTAGTTAC
ATGTTTCGGCAGGTGTTATCAGCCACAGATTAtcttcatcaaaacaaaat
cttACATCGTGATATTAAGGACGAAAACATTATAGTTGATCGATCGTTTC
ATTTGAAACTCATCGACTTCGGTTCAGCTGCACCATTAGAAAAAGATAAA
TATTTCACGACCTTCTGCGGTACCATCGAATATTGCTCACCCGAAGTACT
GCTCGGAAATTCATACCGTGGACCAGAACTTGAAATGTGGTCATTGGGAG
TCACACTGTATACGTTTATATTCGGTGAACATCCATTCTTTGAAGTTGAA
GATTCCATCAGAGCGGAGTTGTTCCCACCTTTCAAAGTGTCTAACGGTAA
TGGATAAGactgttttctttttgttttgaaaagtcatAGAAGATTTGTGA
AATTGTCAAACACACTGATCTCTGACTGCTTAGCTGGATCAGGCTTCCCT
TATAAAATGAAGCTTGTTTAGTTGAAGAGCTGTCTAGTCAGCCAATTTGT
ATTCTATTCTGTGTGGTTGTTATAACAGTGAG
Run BLAST on NCBI

transcript from alignment at sc0000001:494495..520408+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000019 ID=TCONS_00000019|Name=TCONS_00000019|organism=Clytia hemisphaerica|type=transcript|length=25914bp|location=Sequence derived from alignment at sc0000001:494495..520408+ (Clytia hemisphaerica)
taaagatggcggacaaGAAAGTGTGTTGATTCCTGTTTTTGCAGGTTTGT TATTTCACTTTGAAACACACTGCATGAAAAATGATCTTTCCGACTGTCCG ATAGACGGTGAAAAGGATTTCTTTCTTCGTATTTACGTGCACCGTAAAGG ATTTCTTTTCGAGTGCACGATAAGGACGAAAAGTATCCTTTAGAAGCTTT CcgaaaagaatatatttccatTCTTTTCCGTAACCGAAAAGTTATCATTT TCTGTCTCGAAAAGTACTGGAAAGAATAcctgtttcttttcaatttacGA AAAGGATATCTTTTCGGTCTCGAAATTGCANNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNATTTTATGATTTTCCGAAAAGAACTACTATCAGACGTTGGAAA TTCACGGAAAGAAAAGATATTCTGCtggtaaatttatataaaaagaaaaa tttcttcaaaccTTCCGAAAAGAAGAACTATCAGAACAAGAAAGTGTAcg aaaagaactaattttctgataaaatattttttaaaggaaTAGGTTTTCAT CGAAGCTCTTGCATAGGAAAGCTTTCTAAATTCGATATTGTACAGGAAGA ATTGATTTTTCGATCTTTTTTGATGGAATGACTGAACTATTTATTTGGTG TACGAAAAATACTTCTTCTAGACGACGGAAATTCACggaaagaaaaaatg ttttgctggtaaatttatataaaaagaaaactttcatcaAACCTTCCGAA AAGAAATAATATCAGAAcaggaaagtgtaaaaaaagaactaattttctgA CGTATTTTAAATACGAAGTTTTCATCAACCGACATTACTGCCGTTTCAAT GAAATTAGACGATAGATTAAATTCGATACttggatgattttcttctttaa aattaaagtcaatattaaataaattcatattaatatatatggtgaagttA AATTATATGTACTCATAATTCTTGtgctaaaaatatatataagtaTACCT TATTTACACAAAATGACttatattaataaaataataaattataatatcta atttttcttgtaaaaaatgacaaaaattgatgTGGTATAGTAGGAACTTC GGTATAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNAAAAATTGTTTTCGTATAAAAAAGGTT GAACCAACTAACAAAAGAAGTCGGACAATTACTTCTTCAATTACTTTCTC CGATTTTCCGTTCAAACGATCTGTATCCCCCCTCATTGAAGATGTTTCTT TGGTTGTGGTGTCGAACAATGATATTTGCTTCCTTTTCTTATAACCATAA TATTCACATCTTTGTCTTCTGATGAGACGATTCATTCTGTGATAAGTTTT CTCCACACCTCTTTGACATTGCAGCGAAATGATGTTTCGGCTCTCTCCGC TGGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNTGCCGctttatctttatttcaaattga aaataatcagtggaaatccaaaatgacttgaagattacaaaaaaacataa tagcaaGAAAGAAACTATGTTTTTTTAGACaggctattccaaaaataact aaaaaagtGTACTTACACGATCATTGCAGGGCCTCTTTAGCATTATTGAC GCACATATTCATCGCAAAGTCTTTacttcttacattttgttacaTTCTTT GGCTTACTGTAAAGTCCGTGTGAAAAAATGTTACATAATTTCGTGACAAA TCAAGTCGTTTCTTTCCCTCtttaatttctgccaattaaaatctctttat tAACATTGTTCAATGAGAGACTTAATTGGACTGCAATTGAATATATCGTA ATTTTTCCAcgattataaatgtgttaacacagggtcccaaagggaatggt gttgtttagttcaaacagttaattgtaatttttttgatgaaaccgcCTAA CAAATTTTTCAGCCTTTAAAATAGCGCCGAAAAAAGAGAAAGTATACGAa tcgttaagaacattttaaggctttgaggactcgaaaacacccgatttctt aggaagtAATGTGCGGGAAAATaataacatgttaagaacatttttaggct gaaaagtCAAGAACTcccgaaagcttcaaaatttttggatgttcttataa aaaaacgcgtatTTATGAAATATCGAagtgatttctttttaaatactttC CTGGTTCGTTATATATGTAAAACTCGTCAAACTCGCTGaccatgaaaatt attttcggaTGATTTGCGAAATATCTAATTCCCAAAAATTTTATGCTTTC TATAATGTAAAGTACAGGCTTAAATGCAACCTACTAGCCATAAGCGCAGC GTCGCGAGGCCCAAAACAGTGAATCAatcaaacgaaacaaaaagTAGCTG CCGAATGATTATACTATcttcattttatgaaagaatgccTCAAATAAATT GTTCTTCTTTCCTTCTACAAAACGCCTTTGCACTTGATTCAAATCAAGGA ACAAAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGgaacaaaaaatt gccttgcATTACATTTTTCAACTATAATGAAGTAAATCGAGATTAGCACT TAATTAAAAGACCTTCGTAGGCATAATGGCTAGCcgaaaataatctcaaa atggaatGATATGAAAGATTTAAGTCATGTATGTCATGTACAATGTCTTT CAAGAAGATTGATTTGAGCACGTCCAGTTTCCAATCGTTGGTTTTTAAAC ATCTTCAATTAGTCTAGTTGATGTTGAAAATCTGGTGAAGGTGTACAAAA AGAGCTAATCATACCCCTGTCACAGtgtcacagccccggtggagcttctc CCACTGTAGGGATTAAAGTTTATACATGGCATTTTCCAAGCCGAGAcaaa attttcagccaaattttgtaGTGGGTCCCACAAGGTCTGTAATACCGGCA GTACCGTGATGGTTTATAATCAATTATGGGACAAACTAAGGAGACAATTC CGGAAGTTTGGATctttcaatgtaaaaaatataGGATATTTCTTATCGTT TCGACTGAAAACTGCTAATTCTATGGTGCGAAAAAGCAAAGCACCTAATT TGGTCAACGAGGACGGCTCTTCTTTTTCCTGTCATTACTTTAACAGACAC ACGGGTGTTTTATTGGACACTAAAAAATGATCTTGTCACTTTCTAAAGAA AACATTCTCATAATGCtctcataaaattgaaaatatactacTTTTGCCAC ATCAGCTGCAAGAAAAGCTGGACCTTACTTTTACCCCGACGTAGAGAttg taatgttttttaaataCGAAATTATTACCTTTCCTTTTATGATGATTGTA TCTTCGATAAATtcggcatgaaaatttgatatttttatgaaaaagctttt tgtttaaatttcaagaagaacactttgatattttcttaaacgaagaaaag acaatcaatctagaaacatcaaattcttacattttaatgaaaaacgacaa aagGAATTATCCACCTTTTCGGAGCTTTAGCCAAGAAGAATGAACTAACG GGTGTCACAGGCCCAGTGTGAATCCCCTAGTCACCAGACACCCTGCCTCT GTACCCAATTTGGCTCGCATCCGCTAGTCACCCCAGTGGAAAAATAATTG CCAAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTTGAATGAAC ATATTTTAACTTGCTCGCAATTTGTGATTTCATGGTAAATTTTAGGACAA CAAATTAGAGCAGAGATTGATTTTAGAGAAACCTGAAagtattaattaaa actttattaaaaaTATTGTTTATGGAATATAACAGCTTGTCTGCACAGTC AGATCCCCTTTAGAAAACCCAAAAAAGATATCTTTAACGTTTGACAATAA AAGTATGTTTCAAAGTATGTTTCGGTGTTGCTTCNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNAAAGTATGTTTCGGTGTTGCTTCACCGGCTGTTTATGTATTG GATGTATACTAATCTGGTCGGgcatttatttattaaaaaaattcatcatt tccACATCCCACCTTCAGAAAAGTGGCTCTTTTTGGAAATCCAAAGCTGT CAAAAATAAACTCTTTACGAATCACCAAGACATAGAacctttccattttt cttttttcaaaatagtggCTCTTTTCGAAAGCCAAAAGCTTTCAAATTGA TTCTTTACGATATATCAGGATAGAGAACCTTTCCATTTTCCTAATGTCAG AAAAATGACTCTTTTCGGAAATCCAAAAGTGGCGAAAATGATTTCCTTTC CAATTAACAGGATAAAACACCTTTCcactttttttgtagaaaaaatatat ccttTCAATTATAGTAATTGTccgaaaataattacttttccatcgaatcg aaaaacaaacatttctcaatttttgatatcacgaaaactaattctttttt gtttcaaaatatggaaaagataatttttcggaaaaaggatttggaaatgt ataatttttttatttgatgtccgaaaatctttttttttcgggCTTCCAAA AAATGGAAAGAAGATGGTTTTATGCAGTGACAGCTGGGGAAggattaact taaattttgacaGTCTAGACTTAAAGTCCtatatatcaggattagaaact aggctagtcttaccccTTTTATCTTTGCCTATGTCAATACactgctgaca agttgacacaacacattgacaaataATCCCTGTGAGAAGTTTAaatatcg aaatctgcaacaaaaacgaaagtggtctcttcataatcttgatataggag tttcAGTCTATACTGATAGAAGATCCTGGAAGATCTTTCaatcattgctt aaatccttcaAACTAGAAATAtcagatttttgattttttttccaattctt caaatctccaaactcctttccaatctagAGAGAtcacattttttcttctt cattttcaagggAGGCAAGCTGggggaaaatagaaaatatatcCAACAAT GCaactatcaaaataatttttattttctcattcacaGCAAACACATACTT TCGGCAGATAGGTAGCTTCTGGTTGTGCTCGCAACAAGCAGAGGCCGCTT ACCGTAAAATGCAGCTTATAATAAGttaaaaaagagaatttccAAGGCTG ATCAATTTATTAACCCATTCAgacccattgaaagtttcttttgACACAGT AGCAAGTATTCAAAACATACTTGATCAACTTTTAGAGCAAGGCCATGTGC TAGTATCGTTTGATGTTGTATCAATTTTTACAAACAGCCCCCTTCAATGC ACCTTAAagattatttgtttgtttgttcagCCTTTCTTTTCCATAGGGAT TTCAACTAATTATGTTCTCATGTCCTATATTTGTATATGGTTTACTATTC AACtacattttattgattttattgttttatcctccaggaattttctaatt ttaattgttttgaatTATAAATTATATATAAATACAAAAATGGACTGACA TGTTTGTAAGAGAACTTATACTTGAATGGTGTATAGTTTTGAGTACAAAA TCTTGTAATTAAAAATAAGACGTCAAAATGACTTCTGAGAACAATTTTTT AGACAGAAGGTATTCagcacttaaaaaaaaaatcttcattgaCCTTTTTA ATAGaggaaataaattaaataaaactacaTACAAGATGAAAGCAACAAAT TTATCAAACTCCATCAACATGTCATCGCCTTTGCATCATTTTCGAGAGAA AAATGACGAGAAAGCTGTCAACATGTTGAGTATGATGAAAGATAAAAGTT TTGATCAACCATTGTTTGAAGCAGAGAAAGTCCAAGAAATGGAAGAACGC GCAAGATCAAGATTGAGTGAATACGATCCAGCAGATTCCTCTTTGAAACA AGGTAAGCGCGGCTGACTTTCTTTTTATGCAGTGTTAGAAGTTTTCTCCG CTCAGACAGATCTCTATCTCAGGGAAGTAAATAAAGAGGCTTGTATGTCT CAAAGTTTAATTCACTAAAGTTTCCAGAATATTTACTAACCTTGCTTTCA CCAGTGCTCTTATTCATTATTCTTGTTTCTTCCTGTTAGCTTACCTCAAG AAGGTTGAGATAATGTGTTCtctttaaaattcttaaaaaaataaaagtta actgTTGTCTTCTATAGTCCGTTCAGTGTCATGCATTGTTTTTGATAgtt aataaaatgaaaagaatcACATCTGAAAGCCGTTAACAAATATCTAACTG AAAATGAACAAACTATAATTTTAATCTTCATCTGTTATGAAAATGAcatc ttaaaataaaaatttgaatttaattttactATCTAGACAAGTAATATGGT GGTCTCCTGCAGTGTTTGTTTGAATCCAGCTATACTAGAAAAAGAGACTA ACAACTgtgataataataacaataacaattACAGTACAGTTTTTTATACA ATCTTAACCCCGCAAGGATTGGATCAGCCATGTcatttttcaataatatt taAACAAGGTCTTTttactttaaagattttttaaaataattattgTAATA GCTTGAtgtaatgtaatttaactaaactTTATTTTTCAGCTACCACTGAT TCAATGTCTTCTAAATCTAACCTCTCTACAATATCAAAGAGCAGtcataa atgtaaacaaaatttatatataaatagtaaatttaaaaTGTATGTCAAAG TTGactattaaaatgaaaaatatctttaatccTATGAATATGTATCGTTT TGATTCAAACTTTAAACAGATTTGATTAATATCTTTGAGCCATTATGTTA TGGCCTCCTTTTAATAATTAACATACAAATTGTACTTGGCTGGATTTGGT CCAGCTCCTTGTTTGAAAATACAGACTCTAAGTtgctttttaatcttttt tgcaGACTTTAAGGCCGGTCTTCACTTTTGCGCGATATGAGCAAAAACTT TTGACCGAAATttgtaacggatgaaaaaaagtagaacttcctttaacttt tttttttcgcgcaaaatttttttatgacgtaatcttttcttcaggcaaaa aaggtcaAGAAAAAAGCTGTCACCCATATCGCGCGGAAGTGGAGACCAgc attttgataaatatgataagATCCAAGAGCTAGTATCATTATTTACTATA TAGATTATCAAAAGttgatttgaaatcaatttcttcGCATTTTTTTCTAG ATGATTTGTCTAAGTCATACCACAGTATCAGCTACTGCGCAAGTCCATGT CCTGGTAATATATCAACAAACAGTCCTGCACAACATTCCTTGAATGCTTC AtggcaattttttaattttatgggTGGATCAGCTGAAATTGAGAACAACA CCAATTCGCAGTATAAAAAACCTGTAAGTATAATAATGCTCAGGGAGCAT AAGGTGCCATTGCATAAAAGTAGAGTATCTCTGGCTATGATGCACAAGTT TGTGGGTTTCAAACAACAAGAGTTTTTAGAACTATATTATAAtctttttt ctcaacttcagttgagctagaatctgacaaagACGTATGTGTATGTGGTA Tgtgtgtatgtatgtctgtctgaaaactttggggcaggatggagacttca aaaatgatcggatttggctgaaatttggcagacttgttccttgggtgttc atctgggggcgttttttttcattttttgaaaattttaatttttaagggcC TGGTCATGAGTTTTAgctccaaaacgaggctgaaactttggggGTAGgct tgagacttcaaaaatgattgagtttcggctgaaatttggcccaatagttc attgggtgaatatcttagaatgttttttttcatattttgaaaatttttat ttttgggacctggggacaagtttttcatcaaaacgAGGCTTTAGTTTACA TTGGACTTTTCTATCAATTTTACATTTGGGCCTATGCATGATTGAAAAAT ACtaaagttgagcccagtgcggtttGCAAGTTCGTCATATGGGAATATAA TGAAACCTCTTGTCCCATCTGAGCTAATTCAATATTACTGTCTCATGTcc caaaagcaaaaaaaataatgatggtttatgaaaatctttttgaccaaaaa attaaTCATACCACATCAAACTTAATCATAATTTTTATCTCATCAAAATT AAAGCCAGGTTGATGATATTTAAATTTCTGAGCTTGCAAGAACATTGCAG TTTTTAAAACGAATCATTAAAACAAAACAGTGCACACTACgtcatttgat tttttatttgacaatgGAAGGTCTTCTTTCTGAAATACATAACACAGACC ATCAGTTTATAACACTTTGATGTTGGtcaacattttaatttttttttgca taatttgCTTTTACAATATCAGCAAGcaccttcaaaataaaatttaactt tCCCTTTAGACTCAAGCTATAGTCACCATCAATGCAAGGACATCTCGTAT TTTGATTACCAACGAGACAGCATGTGACCTGTTTGGTTACACAGATGAAG AATTATGTGGCAAGCACATGAAAGTATCTCAACTGTTCACAATGGAGGAT GGTGTGAAACAGAATGTTTTGATTGAACAGAATATTGATAAAGAAGGAAA TATTGTTATGGTTTCAGGGAAAGTGGTATGTGTTTCgaatcattattttc aaaataaataaataaaattaagaagTCAGTATCTTTGTGTTCTATGATAA ATaaaggagcgatggccaagtggtcaaaggcgtcagcgtctcaaaTCAGG GATTCGCAGTTCGAATCCCCGCACCTTCCAATGTTCTGTTCaattcatag atagccgagccggctggccgtggaccccgtgaaaacaatcgaaagactgt ctataagtcctagattactgggctatccacgtaaaatatcgactctatct atctatctataggGTAAATTTCCACATAAGGTGATTATTGTGTTGTATTT AAAAAAGGTTGTCAAAGTATAAAGGTTTTTGCAGGAgtattatgaaaatt ttcatatgtttttagttttgttgtttaaaataaatttcttgCAGTAAAGG TTCTATACATATTGTTCgaaccttttcaaattcaaatagaCGTCTGTCTC AGcaaagtataaaaaaattttgtgtttcataattcaacaaaattgaaaaa attcaacaaaatctgacATGAATTTGAGAAGTCTTTGGTACCCATTCTTT TGTATTGTTTTAGGTGAACCAAAGAGCAAAGAACACCGCTAAGGGTTGTT TTTCAgagagaaaataacaaaatattgttttcacTTTTCAGTTAGAAGCC ACCAATAAGAAAGGAGACATATTCATGGTGTCTGTATGGATGAAACGTAT ACAAGCAGGGAGTGATGTTCGATGTGTGCTCATTATGGAACCTGTTGATG TCAACAAAGGAAGCTTCTTGTTTGATGCTGCtgtaagattttgaaatttc agtcaTAACTTCTGTGGACTTCTCCAGGTACCAGAAGATCAGCATTCTTG GATAATTGtctttgaaatttagaaaatattttcaaagtagTGCTTGTAAA GACCTTGAAAACAGTCAGAATTGTCTTAAATTTACGACATTGTTCCATGT AGggagttttatttttcattttctgaaattATTCCTAGGGGATTCAGAGA CTGCGTGAGATACAAGGCTTTTAATTCATTTCTTAAgcctggaaattttg aaaaaataagagAGTGTCTTTAGTATGAGTTgtaaaaatttttgacaaaa taacaATACAAATAATATACCAATTTCAAGCATAATAAAATTTATGCCTC ATTATCTCATTGCTAGGGAACAATTTCAGATTGTGATTTCACTTTTGCAC TTTTGCATGGTTATGAAGATCCTCAAGATCTGATTGGCAAAAACATTGAC ACGTTTGTCCCTTCCTTTCAATTACCATCACCTGGTCAAGTGCTTTCAAA GGTAGGTGAAAAAGctactttttatttataaacaagGGGTAATATACTTT TATCATCTCAAagtctgaaaattaaaacacGACACTGTCATACTTTCCTA CGGGGTTGATACCCCACCCTTGAAAACAGCCCCCACCCTTTACCACCAAC CCCGCCCTAAATGTAGAAACTCTTTGAACCCTGCCCTTTCAGAAAAACTC CGCCCTTGACCACCAAAATATCCATACCCCAcccttcaaaaaaaacaaaa aaatttccacgtGTTTCCAGACTCTTAGAACTTGTTCTCAGATAGGCCAG AGTAAGTccagtttttatatttatactaaaaataacagaaatgtttgaat ttttcattatcTTGCAGAATTACTTGAGGGGATAAAGCTCCTCTTTTTga gaagaatatttttatttgtggGCGCCCCCGCCACGTGCTGGGAAAAGATT GATTTAATGATgattaaaaatcattaaaaacaaaacaaaacacaatataa aaattgaaggaaaaagCCCCCCACCCTTTGCCACCAACCCCGCCATAAGT CAAGAAATCCCTGTAAACCCACCCTTTCtgacttttttgggaaaaccgTT TACCCCACCATCTAGCTAGGGTGGGGTGGAAAGTATGACTGTTCCTTGTT TGACAAAAAGTTGAAGACCAGAAAACTAGGGAAATATGGTTATATACTTT CTACCTTCTCTCACATATTCTTAAAgaataatcttaaaaaaaaatacagc tAACTCCTTTTATAGGACATCAAAAAGCAACGCGTCACAAGCCGTACAAA AGACTTGGTTCCATTCCCCTCAACAATCAAAGTCAGAATTCATGACCCGG AATTCCATCAGCTTTACATGGAACGAACAGCAGAAAACAAACGTCAAATG TCTAAATTCTTATACAAAGGCTTCTTATGGGTGTTTTCTAACGTTAGTGG TTTAATGACCATCGATAATAAAGGTCTGGTGACGAGTTGTAATGAGAATT TCTTGAGAATCTTTTTGGGATATTTTGAAAGTGAACTAATGGGAAAGGTA ACTGTTAATACTTTGTTCAttcaatctttcattttatttcattaaCTCCA AgctctttagatttttttttagcCCAAAGGGTGGGCATACAATATGAGGT CAtacatgaaaattttttcacgATTTCAAAATGTAGATTGTTAGTACCTA TAAAGTCATGTTTCATAAAACCTGTTCTAGACGACCTATGACCCCAAAAA TTTGCACATGCAGGAGAGATTAAGATTTATTAAACgtcagaaaattttaa atcgTTTCTAAAACTTTTCGTTGATATAAAAGAAGATCaacgtggtagat tctacccctcTAGCAAATAgggttcgttcgttcgttcgttcgttcgttcg ttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgttcgtt cgttcattcaTTGGGTAAATAACTATCCTCATTTTTTTGTACCTGTATTA TGCGTACCCCACTTTGCAATACAACATGATAAGAACGATGTTAGACGATA TTACAGTAGATGTCAACTCAGAGGAAAGAAGAATCTGTGAAATAATGACT ATTTTCTTTTCCAGGAAATCACAACGCTGATACCTTACTTTTACGAACAA ATCGACATGCTTCATCATGGTTCCATCCCTCAAACACCATCATCTTCAAT TAAGCGTAATAAACATGGTATGTTTTTCATCTTGAGCagaaatgcaatta aaaggctccaattttgatgatatttttataACTATTATAGCCCTTAACCC ATAACCCTTTACAACCCTTTAACGTCGACTCTTACTACGCTAAAGCTCAA TTATGCTCCATTTTTGAGCCTCGCCCTAATTTATTTCTGATCCCTTaccc ggtgtaaaaagggctgaTTAGGTAGTTGGATACTTTCACAtaaatttcac attttaaaggttttgttttcaagtaagagtgatatcgtttgcttactcgt caattttaatgcacaagctttttcacattggattgacatggatgtggagc aagattggtcagaaagaggaaaagaaaaacatttttttgcttatatcagc atgatATAACAATATGCAGAcactgatatgaaatatgtgtctgatatgaa acgggaacacttctGCCAACATAAAACCTTTAACTCCCTTTAGTTTTCGT CAATTCAAAAAATTCACTTTCGGTAGTTTAAAAGGGTACAGGGGATTAAA AAAGGACTTGCATAGACTTCCATGCTAGTGATCTTTATTCTTTGTCTGGA TTATGGACATCCCCTAAAACGCAAAATTTGTCTTGGTTTTACGACAACTA ATCcaccattttttgttttgatttttggttaACAACTACGGGATTCGCGT TTTTACGCTCGAGAATCCATCTTTTACGCTCGAAGATCCGCCTTTTACAC TCGAAAATCCACCGTTTACGCTCTAAAATTCACCTTTTACACTCAAAAAT CCACCGTTTATGCTCGAAAATCCATGCAACAGAAAGCAACATGCGGATTT TAGTGGTCGAAAacttttgtgagtattttgcgAGAAAGTTACCTTTGTAT CGAATGCTTTTTTTCAGGTTCATGTAAAAAGGATGATCTGGTTATCGAAT GCCTCGATGGTCCGCCTGCTACAACAAAATGTGGTCTCGATGATACAGAT CTTGAAGAAGGCGAAATAAGAAGCACGAAGAACGACAGTGGAATAAATGA CGAATCGGAAAGCCTGAACGATCAAAGCACACCTCTTAAAGACGAGCGTT TGAATAACAGAGGCACACCGTTGCAAGAAGAACATCTCGATAGTAGAGGC ACGCCTCTTAGAGATGAGATATGTTTGAATAATCAAGACACGCCTTTGAA AGACGAATGTTTGGATAACACAGGAACACCTCTTAATGATGAGATTTGCA CTAATAAGTTGAATAATTGCGTCAGCCATCAGGCGAATAAGAAGGACAAA CTCGATGGATTTTCACCTCATACCATAAGTACACCTGTCTCAGATGAGAA GAGAGAAACGAACATTGATAGAATTGAGGGGAAATTAACTGACCAGATTA CCGAAAAACAAAAACTGGACTTTGGTCAAAATGATCGCGAAGAATCTTTG CGTAAGACAGATATTGTTTTTACGGATCCTgttaaaattaaagatggtgC TGTTGTTAAGGACGCTTTTGTTGCCAAGGATACTGTTTCTAGGGACGTTT TGCAacacaaacaaatcaaaacgAGTGACTATGAGTCTTTGAGCTCGTCT ATTGTGGACGATGTTTTGTCTCGGTTATCCAAAAATACTGAATTATGTAA TGAACAGAAAACACGAGTTTGTGCCAGCAAGGCAACGTCTCAGAATTTTA CAGCATCAGAACAGAGTGGACTCTCTGAtcttgtttttgaggactgtaaA AAAGAGATTTTAGAGAAAGATAAAGGTGATTTGAGTAAAATTTACCCTGG ACAATATTACGGGCAAGCGAGACACAAAGATGGTTCAATGTTACCGATTT TGTTTGAGGTAAGTAAAAAGTCATGATAATGTAGATTGTTACAGCTTTTG TAACACTTTTCCTTTTTTGTTAAAGCGAAGCTAACGATATtgaaattaga gcctttaggctgttggtttgccgtcacccgatcCTAGGTTTTGGAGTTGG GTGGGTcggtatttaaaaaaataaaatctgaaaagctAAAAGGGAATTCA TTCTATTGTTATAAACTTTAAATAGAACGAGACAGACACAATAGACGttc tgatttgaaaaaaaaaatgttctttaaaattggcaataaaTTTTTTGGTA TGTTTCGAGTTGGAGTCGATTGGATCGGATGACGGCACaccaacattttt ttaattgcAGCCTTTTATCGCTTTTTAAAATGACGAgcttgcaaaaaata ttgcagtttttttttaaacaaattatcaTAAAAGATTTAACACCTATTTC TAAAATCGCGTGATGCACACCATTAATTTTAAGATGCACTGACGTTTTGT GCCAGATATTCAAAAAAGGTAGCATGGATAGAAGGGATTATTTTTCTAAA GGGACCTCAAATTGTTTGGGCGATAAAAATTGTTTGGGCGATAAAAATTG TTTGGGCGATAAAAATTGTTTGGGCGATAAAAATTCGAGTTATTGAGGAT CAACTTTAATATATTGAATGCCCAGCTGgcccacaacgttgtttcgacgt ttttctaacgttcacaacgtccatataacgttagaaaaacgttgaaacaa cgttgtgtgccagctgggtgtgTTCAAATAAATTTCTAGCGACTTGGTTT CGTACAtagaatacagttgacgctctctctaattcgacgttctacttcTA CTATTCAACACACTCCATCATTCGatagtcaccgtcaacaagaaactctc ataaacaacgttctactattcgatatgctCCATTATCcaatattcaatga aaatccgattccccttgaaaatcgaattagagagtgtcatcTTTACTGTT CGATATTAAAGTTCATTTATCACACTTTTTTAGATCAAGAAATGGTCAAG TAAAAGCAAGAACAAAGACAACAACAACGGACAACTCTTTTGTCTTTGGA TGTCACGTGATCCCGATGAAGAAACCGAAACTTACGGTACCGAAAAGCAC AAACAATTGTTAGCAAGTTTCAACAGTACAATGACTATATCGACGGGTAA TTTCCAGGAGGTTCGTTTTTTACAAATTTATCTGTACTGAAAGCTTTCCC TGGAGTCTATTAGACCCTGGAACTCGTAAGAAAAGTAAACTTTTTAGCTG AGATTGACAATAAAATTCGggacaaagaaaaatttgaattgcttcaaaaa aagatttgtaaTGTATACTACATACATAagattttgtttggttttatcCA GGGTAGTGGTGATAGAGATACTTTTTCTGTACTTTCAGGTGCTTTACGGG GGACGAGTCATGAGGTCCGGGTGGttgggaaaaaattaattaaacatTTT ACTTACCGAGTTTGTCAATAATTCGAcgttaagtaagtaagtaagtatat tcatctggtggttcattccccttttctatttgcgctagacctgggaaaTT GAaggctgaggtggagcgccacacctactctcagctcccagtaacttacc gcttAGGTCAGAtcacccaatctaagctactcatccgctgagttggcggt gaccggggatcgaacccacaacccttagattgtaaagcgaatgctctacc gactgagctacccggccacAAAAGGAGAATAAGTAAACTGTTTGTAGTGT CTGTGTGAGAGTCTTCGGGTTATCTGTGAAAATTCCATTGCTATATTTCC CAGATGCTGAAAGAAATACAAGATATGAAACTAGAAGATCCTGGGTCTGG TCTTTATAACGATAAATTTAACACCGCACGATGTATTGGAAAAGGCGCTT TCGGTTTTGTTAACCTTGCAGAAAGAAAATCTGATAACGAACAGGtaata tggaaatatgaaaatatcGACTCCGACTATCAGCCTCTGAAAACTTATAA GAATACGTATGGTGAAATCGGCCACAAAATTAAGACTATGGTAAGAATAC TGGCATCATGGATTTTGGCAACTGAACCCAAGAATgcccatttttagagc attttaccaTTAAATTGCTAATTATTCCCCAGCAatgccaattttttttg ctccATGTATGTATTTCATGCTAGATTTTGGAtccaaacctaagaatacc ttaagaatattttcagaatgattttccccaaaaaagttaagaatattcat gatggaTTGAAAAAACACCTATCCTATAagaagaaaaagcgtgtatccaa aagatatttctattCAATCGAAAGGTTGTGGTCAAATTCATTAGGGACGC GTGCGCCTAGCAGACTTAAGGCcagggcaaaccgatccaaNctccccccc ccccccccttcagcCCTTTAAAAAGCCgatcttacatttttttataagaa tatactttattagaatatttatggtgaaattgaacaaaaaatttaagaat atggtaagaataccgGCATCAgggaatttggcaactgaacctaagaatgc catttttagatcATCTTACCATTATGTAAGATGCCGATTATTACCCAGCA ATGCTAAAGGCTtccacaaaaatgccaaattttttttctggaggtatgta ttacatgctAAATTTTGGCTAGATTTTCTATCCAAACCTAacaataccgt aagaatattttcatgACACCTATCTTATAAgaagaaaaagcgtgtaatca TGATATTTCTGTTCATCAAAAGGTTGTGGTCATTTTCATTAGGGACGCGT GCGCCTAACAGACTTAGTctgccatcttgttttcaattctggttGTCAAC AGCtcatttcgaatgttttgaaattcgaacgttcgaaaatttaaaaaaac ttcaaaacgaAACACACTCCCACGGGATATCGGTTAAGTGTATAAAGGAA TATGATGATATATGTGCTCATACCTATAAACCATTTAGCAAGGTGTTCTA TTCATCAATAGGTTGTGGTCAAATTCATACgtaaagaaaaagttttgaaa gacaGTTGGATTGATGATGCAAGCATTGGTCGCACACCTTACGAAGTTCA TTTACTAAGCAAACTACAGCATCCTAATGTCGTTAAAGTAAGTGATTGAG TTGTTTTACATTTAATCTTTTGACATTATGGTGTTTTGCCACAGAGGACC TAAAGCTTAACTGCTATTATTTGAGTTTTGAGTATTAAACCTGAAATCCT GGTttcaaaatattcgaaaaaaaagtCGAAAGGAAGACGAATAACCAAGC GCAGAAAAAAGcatgacgtctagtataggctagtaTTGTAATGATTGCCA ACAATTGAGATTTCTAGACGTTACGATATTCCAGCCTGTCACCATGATTA CTAGTAAAATTAAACTTGCAGTTTCTTTTCCGTTCACAAATTGAGTAATT CTTGAAAAGTGTTCGCAGTTCTTCCGTCTCGACGGGTTTCCGTCTCTTCG AAGTATGAAAAGAGACTTTTGCGCCGTagaatttagcaaaatcaagCGAA ATATTGAAAACCTGGGCTAATTTTTCGTGTTGAGTCCATTTTCCGTCTCC GAGGAAAAACTTTGCTTTGAAGCTGGAAATCAGGTTGTTTTATATTCTGA CATTCGCTTATCAGACTTCTCTGGTCTAAACAAAAATTCTATgaaccctt tccgtgcccatGTCAAGTATATTTATATTTAAAGGAGgtgactctaagct atccaacgagctatgaacgagcttctaactccttctagatccggagatat ttAAGCTTTTAaatttgaactagcgattttcttaaaaaaactgaaaaaaa gggTTAAGGTATATGATACTTATATCAAAAtagcaaaatctgaaaattct actcatttttttgtttttgacagGTGCTTGAAGTATACGAGAACGATTGT TACGTTCATATGGTGATGGAGAAACACGGTGACGGAATTGATCTGTTCGA ATTCATCGATCGAAAACCACTCATGGATGAAGCTTTGGCTAGTTACATGT TTCGGCAGGTTGGTAGAATGATTgcccatttttgttttttttctgttacG GAGACAGTTagcttctgattggtttagTTCCTGAATGACAGACAACGACG TTAAAAAAGTGCTTTTACAAGTTTTtgcaaatcgcttcagtcaccactcc accgtcctcaaaagttcAGATACATAAACTGGCTAATAAGAAATTTCGAG TAGCTCaataaaaacctttttaaattctTTCGGTTGTTTTCGTTTTACGA TGACCACCAGAAGGCTGGGAGGATTGAACAAAACATCGAAATGACTTGTG TATCAAactcacagatatcttatataaaacactatatAGAGCCTCTTTTC CCTAAGCCTtggcaggtgaagcaaaataatgcgctaTCTTTGCTATAACC TCAGTAGAAACCTTGGTTTTCACTAACGACTTCAAAATTTCCAGGCTCGC GCAAGCGAAATTGTGAcgttattttatttaatattatGGTGGAATGACTG ACTACGGAGTGACTGTAACAGTTGGGAACAACCCGCACGTCCCCGCACCC AATTTTGGCTAAGTGCCTCTACCGGGCCTCCTTAGTCTGTCAGCATCTTC TAGACAAAACAGAAACTAACCGGCTCCGTCGCAGATAAACGCCATAtaaa ccacagatctgtaaggctcgaagggctagataagcgacttttatcgaaaa gtgaagcctaggtttggaaggatttcctactaaagtcacgtgactaaaat atgcaatttcaccggtttgagagatgtgaaatagcgtttgccgcctactt tttttgatctcgcgctccaaaaacaattaaaatgctagatcctatccgcg ggcacgaaatttaaaaagtcaattttttgtttcattttttttttgctgga gaaagcttgaATTGCATATCTAgcacttcgggctttacagatctgtgata TAAACTCGCTAACTTTGCTTGGTTtgaccatggaggtataaagaaagaca ggagaagtatgctattgtaaccaagctcgccctacgattaaaaaagttac gatgtatgcatgctcataatctcgtATATCGTCAGGGGGGGGTACagccg cagggtactaacccatagggtactaacctgatttttaagaaaaattgtct caggtaccaccaccccctttttagtaccgggtacttactttttcttaagg aaaaagggacccccacccccCTTTTAGTACTgggtacttacttttttttt aaggaaaaagggacccccaccccctttttagtacTGGGTACCGGCTTTAA AATTAccaaggaaaataagagacaccACCCTTAAAACTTGCCAAGCATGG TCCCAATCTTTCAAAAGCCAGCAAAAGCAGCTCTTTGTTGTTATTATGAC TTGCATATACCATGTTTTTAACTCAGATCCTCTTAAAGGTTCTTTAAATC AAACATACCTTTTAATTACAAAGGTAAAACAAGGAAATTCCttggcaaaa gtaaaatattatatagctgTAATAACGgcaataaaagtatatatatctat cagaagaagtaaaaatcaagttgataaaaattgaagaatagtATGAAAGC TTGGATTGGATGGATTTCGTTATGTTTTTCTTCAATAGAAGGGTGATTTA TTCAAATTGTTCAAAGCTGTGTCAATTTTATGAAAGAagttgaaatagaa aaaagttgcattGTTGGCTCTGGTTGGCTTTGCTTAGTTGACCTGCCTCC GTCTTAATTGCCATaaacagacaaacaaacaaacaaacaaaaataaacag aaataaGCTAAATCATCAGTTTGGATAAGAACTTTATTGTTTAAAAGACA GATTGTATCACTTTGGATGCAACAGCTTGTAATTCTTTTCATCAGAAGGC AATGACAAACATATACCACGTTCTAACGAACTATCCTTCTCACTAATTAA AACAATACTGATTTTGAACAATAGCTTTCTTTACATTAGCTATTTCAATA TTTGTATAACTTAGTGGTCATAAAATTCNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcattttctggcttgagaa aatatcttttcaaaacaaaattgaacggatagcgaaatggaacataaatt tgtttcgtggacgaagttttatctaattttcggatattaaaaggctagaa tcttcaatactgattattagaatgttcagagcaaacttgagttctaataa aaagtcttatttcatcgggcgagcttagaatttcttttgatacattttat aaaagaaatcaaaagactttaacgaccaattaccgacacattcaactcct gttttctttatacctctatggtttGACCAAACACTAGAAAGAAAACTACT ACTTCTCTACTCCTTCTCTTAATATAAAGTTTTTGAGGGGTCATTATTTG AAAGTCgttaaataattttattttgcgTTTTCCAGGTGTTATCAGCCACA GATTAtcttcatcaaaacaaaatcttACATCGTGATATTAAGGTAGGTTA TGCTTATTCGCCATTATTATCAACataaaaaatatgagcaatctgattgg ctaaaaacgcgtacataaatgctATATTTCATATTGTACTTTACAAATAC AAGACCGCGTTCAAAAAAGGGGTCCGGTAAGTGAGCGTTCATATATTATA CAATTTTTCTGATTATTCTCTTCGCTTCCAATGCACAACAACTTATcaaa agagtttatgaaaaaaatgttttgatctttttaatgaccatTCGATTCTT TTTTCGAAGGTTTTGATGTTTATTAATCtaattaaaagtaaaagaataaa atattggggaaaaaatcaaaacaaagaaaactgaATAGacataatatttt tcaagttgatgataaaccagttatcacacttttactcgtacaataagttg ttttaaagttttatttgGGGAACTTATTAAAGACTATTTCTCGTAAATTA GGCTGTTGAATAAAAACTTGAAGTTAATGTTGAGAGTGATGCTTACActg catttttaaacaaataaaaaacactttttctccACCTTCGGCACCGCGCg agcacaaattttgagaaGTTCGTTCgtttattctgctttgtcagcataga ggcgcGCCTCCTTTCTATATCGTGAAAataatacagtggagtctctatgA TTTGAACGCGTACGGGGAAAGCAAatctgttcgagttatggagtaaggtt tacaaggcattgttaactgaagggaccagaaaaagtgttcgagttaagaa gactATCGAgttagaggttcgagttaaagagtatCTACTCAGGGTTGCTA CGTCGAAGGAGATAGTTCTCAATGAAGTCTCGTAAACTTTGCGGAATTAG GAAACTTTTATCCTAGCATTtgaaattcccaaaaatttctGCTTGCTTTT ATACTCGGAACCAAATCTTTATATTTATGTTCAAGCTGATATTTCTTACT TCGTTATATTCCTCCCTTTTCAAATGACTGTTAAAGGAAAAGCTGAAAAA CTTCGTAATGGATAAAATGTCTGGAAAATATTGGGTATTTTGccaaaatc tggaaattttttgacaaaaatctggaaaatatGGCTTTTGAGAATAAAAG TTTTCAAACTGGCAAACGTGTAGCAACTCTGTACAGTATCTTTCATGCGT CTAAACTaatttattatgtttttttctatCTCACAGGACGAAAACATTAT AGTTGATCGATCGTTTCATTTGAAACTCATCGACTTCGGTTCAGCTGCAC CATTAGAAAAAGATAAATATTTCACGACCTTCTGCGGTACCATCGAATAT TGCTCACCCGAAGTACTGCTCGGAAATTCGTAAGTCAAACTATCATACAG AACTTGGAAAAAAAGGGACCcgggtttttggacctaccccggttgaggtc ctataaattaacctctgttcgtccgttcgtccgttagttaccaacttttc tcgagattggctcattagttttttctgattttggcacaaagatgcaaaat ggcaatggccaaaatgtgacggagcccgattttcNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNatggagggcaagattctctaaagaatggctgaagtggt ttttcccggaaaattcttattcgccttaaaaaacggattttcgtattggg ggaaattccctttaaccaaataagaaaatatagcttttctcaatgttgac ttattattttttaaaaatttttttcacaatgatgaaaaatggcaatgcct aaactgtgacggagcctgattttcaaaagacatttttttacggccgaaaa tgccggaaatatgccggaaaaactggttttttggcattttctcgggATTC TATCAttggttttttctgattttttgctcaaagatgcgtattaacaatgc ccaaaacatggccgagttcgatttttgagaaaatttttttcccggttgaa aatgccggaaatcgccgtgtttgcagattttcagtggattttttccttat attcatttctatgttttttacacaaaaacattattgataacaatgctcac catcaagcatNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNcccccatcaacaatcaatgatgaattttttgcgttatgcattttcgc taaacgctatattttctgactgattttttttcatttttctcctcgcattg ctatctattcagcatctagcttgtttttcaTGATCTTTCTGGAAGGAATC AGTTTATTTCCTTCCAATCAATTCATAAAGAGCCATGCCCAAAATTTAAG ACCCGGGGGGGGATACTTGAGCAAAATGAGTGCAGgatatgtgcgagcca taaggatcCCTTTTCACACCCTAGAAAGTCTCTcaaccattaaaaagcaa ttgggtctctgtaagggttccaaaaattacgaaaataaaaaattgactcc TTGTACGGTCTAATTGTGTAAAAATTGTGCACAAAGGCGTACAAGCATGA GACTTCCCACAATTGAAGTTTAGGGGtcaaattttcagatatgggttgta atgtttttctaaacgaGCATGAatgaaaaatgctttccaacggtatgtaa TATGGcatactttggagaaaaaaaattcattttagcctgggaacctgttc tggtctgtaaaatacacaaacaggtgccaatttattgggtctgagattta aatcaatttttgacccctaaactacaaTTGTGCAAAGTCTCATGCTTGTA CGCCTTTTTGCACAATGTTAATGACTTTTGGCACATTTAGACTGCACTAT CCCTTAAAGGGTCACAGCTTCTTGAAATTTGTAGTACATATCCCCCCTGG GAAAAGGGATAATCagagatggtttgagatattgtGCTTGTAGATTCCTA CCATATAGTCCTGAGAGAAACCTCTGAATCTTTTTGTCTTAAGTGTTTTC CAAAGTTGAGAGAAAACAAGTTTCTTTagtatctttttgttttgtattta ATCAAGATATTGCCTTTTCTTTTCTTAGGTTTCATTGTTCCATTTGATCC ACTACTATTTaaatttacaacatttttttaaattttgactaCAGATACCG TGGACCAGAACTTGAAATGTGGTCATTGGGAGTCACACTGTATACGTTTA TATTCGGTGAACATCCATTCTTTGAAGTTGAAGATTCCATCAGAGCGGAG TTGTTCCCACCTTTCAAAGTGTCTAACGGTAATGGATAAGactgttttct ttttgttttgaaaagtcatAGAAGATTTGTGAAATTGTCAAACACACTGA TCTCTGACTGCTTAGCTGGATCAGGCTTCCCTTATAAAATGAAGCTTGTT TAGTTGAAGAGCTGTCTAGTCAGCCAATTTGTATTCTATTCTGTGTGGTT GTTATAACAGTGAG
Gene-mRNA-Prot