Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000008 (gene) - C. hemisphaerica

Overview
NameXLOC_000008
Unique NameXLOC_000008
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:324098..332443+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000008 ID=XLOC_000008|Name=XLOC_000008|organism=Clytia hemisphaerica|type=gene|length=8346bp|location=Sequence derived from alignment at sc0000001:324098..332443+ (Clytia hemisphaerica)
attgttttgatgctggattttttaattCTTCAGCATGAGATCTTAACTAG CAAAATGTCTTGGCATGTCTCCTTTTTCtttaatatatttcaaaaaagta CAAAGAGTACTAAGGTACAGATTGGAGAGAAATATTCTGCTGTTGAGTAG CATAAAGCAACTGCTGCTTTGTGTATCGTACCAGTGCTTTCAGATCTTAA TAAAACTGTTTATCATATACCTTTAACAGGTATATtatacaacaaaatat aatGTCATCGCACAAGGCAGTAGAGCATACAGCTGCAAATCTGGATGGTT TATGGACAGTAATAGCAAAAACGAGGAACTTTGATAATGAAGTTTCATCT TCCAAGAAAGCTATTGTTGTCATTCCTGGTAATCCTGGTTTGGTTGAATT TTATGAATTGTTTATGGAATGTTTGTACAAGTTAAAGGGGATTCCAATTA TCGGTTTTTCACATGCAGGTATAAATggatttctcttttttataagaacc attcAATTTTTATTAAGGGTCAGTTACTTTTTTGGATGTACTTTGAGTCa caaattgtaaattttcaaaaactctcTGCGATTCCAGTCTTTTTCGTAAT GTATGGTATTTTTAAGCCTGCCTTACTGTTCTTATATAAAGTGTGAATac tctttttcttaaaattaacATGAAGACAAAAAGTAAATCCAATTCTGCTC ATCATGTTGTTTCGATGTGATCCTGATGTGAACATCGAAAATCTAAAAGC TAACTAAGCAAGTTTCACCCATTCTCtatcaaatacacgtttttttataa taacatccATAATATTTTTAGCCTTTGGGTGTTCTTCtaagctttttgag tttttaagctgaaaaaaaacgttattaaaatgttctgaattttaaaccat tttgtgagtgtttttttcACACTTCCTAACTTGTTCATAATATCTTGGCC ATCAAACCCTTTTgttcatatagtttgttcttatgtgaaacaatgaaaca gaaaaaacaaaaacagtttttttgtaCTAATAGTTTCACAACCTTCTTCT GGGTTGATCATCAGCAAACTNgaaactaaaatttaccgcttaatttcgaa aaatatatcactcgaaaacaaaggaattgctagattcaatccgtcataaa aaatacggcgcattttttaaggcttcaatttttcttgcctgagaaaggtt agagattgacctctagccttcggcttgaaactcaatgattcgaacccact aaatgcaaagttccgatgttttgaaacccaatgccttaaccactgcgcca cggattcatgccgaaagagcgtttctgacggctatttatattgtacaaac tacagaccagactgtattNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNaatctgatacgtaaccacacccaaa ccacacccatacccaaccctaccaggtcgcctgcaggtcctgacactatt cccgcatgccggatccaAAAAATAggtacatgtctttcgtctttacgaag aagccttcaccgtcCAACATATGTCTTCTTGTCACTTGTCTTCTAGATCT TCAACCTTCTCTACCTTCTACCAGCACCAGGGTATGTATCTTCTTTCAGC AGACCTGGACTGGGTGGCAGAGCAGATATTAAATAGATGTAGTAAATTAC TATTACTATGNgtattaaaagaaattttttgtcaaagtgATTTAacagta aaaagtaaaaatagaccttttttcaaagaggatgtcatgttgaataatta tgtagtccagccataaaaacaatgatatatccatgcataattactgtatc atgcatattgtagtAATTATTCATGGttcatcattgtttttctgctggac tacataattattcaacagggtggcctctttgaaaaaaggtcttaTAGCTA TGCTATGGTATGGTGTGAGATtagatgtttttcatttttgttatgtTGGG CAGTTGGGAACTTTACACTTTATTTGGTATATATAAGCTGATTCTAATTA CCTACCAcactcttttttgttttttagtagAGAAAAATAACAGAAAATAG GAAGGTGGGAATCACAGATTGAAAAAGAAGATGCGATCTCTATTCTATCA AAGAAATAAAGTTTCAATCAGCAAATAGTTGTTTGGGAAAACGCAACAGC CTAGGCATTGAGTCAGTTTCGTATACCTATACTAGCTAAATAACTCCATC CATTCCGGGCTGGAAATGGTGCACAGTATGTGAATATATTCAGAGTGAGg cagtaccgtcaactgctccactTGGGGgcactatctgacaaaacatggga cggcaattcggccccCATTTCACCGAaactccaaagtcatttgatttgag ttaaggaaaggcatattaaaaaatacacaatttctgttttgattttACAG TTAGTTTATttcagaccagatatgcaacagtcccatgtttcaaccaattg TGCCAAATTAGAGCCGCTGACGGTAATTACGTTTGGCGTATTGGCACAAG GAGCCGATATAAAGTAAGATATTGGCGTaagtcaaagcttttcaagacGA GAGAAGCACCCCCATTCTAACGCCCAATTTCATGACGCCGCAGGTTTAAA AATGCATCCACCTAGCTCTCCCTTGACCACCATTGACCATATATATAAGg ccaaaaaaaaagtagttttgtttccggaaatgcgggtgacgaaaaaaaat ctcacccgggcggccggaaaatattttttttttcaattttcctagaaaaa NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNagtttttttctatttgcggccgggtg agatatatttttttccaaaaaaaagttcacccggccgatttccggaaaca agactacttttttttttggcctaaCANCCTGTTTCTATGAGACGTTTTTT GTGAGCCttcaaaaatgttacaaaacCAGTACTAATTTTTGAAACGGCTC GGCTTTCGGGGGGTTTGCCCCCTAAACCTCCATCAGGGCTAAGCCCTGGA CCCGTTTGGGGCACTGGATTACACTGCCCCAAAACCCAGTAATATCGCTG TTCTGTTCTTTTGGCTTAAACCTCAGTTTTAACGNGCAACTTTTAGGGGT GAGAAAATGAAATAATCCCAGGGCTGAACAGTCATTGTGTGAcatttttt aaaacacaaaaaattgacaaaaatctttaaggttgaataaaatcaactca aattaATTACaagccttgaaattttgactggtAATAGGAAATTTAATtac cttttcaaaaatatatttatgaaGCCATTCTTTATGATAGCAAAACGACT TAGGTACTAAATGAATTACCCTTATATGTTCAAAGTAAAGTATGTCACTC TTTGTcacaatcaattttttgaaaataatgtacacaaaaattaatgtttc aaTACTGCACGTCCTATAACACTCAGTGGTTAAAAATGAACAACTTTAGG TGTTGATTGTGCCAATAAATGACTTACTTTACgagtaaaaaagtaaaata tgtCATCCTTAAAGTAAGTCACTTTTTGTCACATTTTGCTTCTGGGTATA ATTCGAAATATAGTATTTCAATTTaggtaaaaattaaagcatTTTAAATT GGGAAATATATCTGGCTTATTAACCATATCAAAAATATAGACACTGTGCA CAATGTGCCCTGTTTCTATGAGACGTTTTTTGTGAGCCttcaaaaatgtt acaaaacCAGTACTAATTTTTGAAACGGCTCGGCTTTCGGGGGGTTTGCC ACCTAAACCTCCATCATGGCTAAGCCCTGGACCCGTTTGGGGCACTGGAT TACACTGCCCCAAAACCCAGTAATATCGCTGTTCTGTTCTTTTGGCTTAA ACCTCAGTTTTAACAAATAACAATTCGGTGTGGGCTTTGCATCATTTCCA CACTGGCATACATTGGGCCTGGAAATTAACTGTATTGAATTAACTGATTG TATCAAGTGTTGAGTCTGGGGTATCCCTAGATAGAACTTCTGCTAGTTGA Aacgtcatgttgaataattcaaaactccagcattaataaaacaatgataa gaaaaaattaataatgTATACTTGAACTAATTAAAATTATGAATTCAtct gtcattgttttgatgctggattttttaattCTTCAGCATGAGATCTTAAC TAGCAAAATGTCTTGGCATGTCTCCTTTTTCtttaatatatttcaaaaaa gtaCAAAGAGTACTAAGGTACAGATTGGAGAGAAATATTCTGCTGTTGAG TAGCATAAAGCAACTGCTGCTTTGTGTATCGTACCAGTGCTTTCAGATCT TAATAAAACTGTTTATCATATACCTTTAACAGGTATATtatacaacaaaa tataatGTCATCGCACAAGGCAGTAGAGCATACAGCTGCAAATCTGGATG GTTTATGGACAGTAATAGCAAAAACGAGGAACTTTGATAATGAAGTTTCA TCTTCCAAGAAAGCTATTGTTGTCATTCCTGGTAATCCTGGTTTGGTTGA ATTTTATGAATTGTTTATGGAATGTTTGTACAAGTTAAAGGGGATTCCAA TTATCGGTTTTTCACATGCAGGTATAAATggatttctcttttttataaga accattcAATTTTTATTAAGGGTCAGTTACTTTTTTGGATGTACTTTGAG TCacaaattgtaaattttcaaaaactctcTGCGATTCCAGTCTTTTTCGT AATGTATGGTATTTTTAAGCCTGCCTTACTGTTCTTATATAAAGTGTGAA TactctttttcttaaaattaacATGAAGAGAAAAAGTAAATCCAATTCTG CTCATCATGTTGTTTCGATGTGATCCTGATGTGAACATCGAAAATCTAAA AGCTAACTAAGCAAGTTTCACCCATTCTCtatcaaatacacgttttttta taataacatccATAATATTTTTAGCCTTTGGGTGTTCTTCtaagcttttt gagtttttaagctgaaaaaaaacgttattaaaatgttctgaattttaaac cattttgtgagtgtttttttcACACTTCCTAACTTGTTCATAATATCTTG GCCATCAAACCCTTTTgttcatatagtttgttcttatgtgaaacaatgaa acagaaaaaacaaaaacagtttttttgtaCTAATAGTTTCACAACCTTCT TCTGGGTTGATCATCAGCAAactctttttgtttgtttgctgATGATCAAC CCAGAAAAGGATTGCGAAAATATCAgtacaaaaaactgtttttgtttttt tctgtttgacTTAAAAATTTCTACTATGAATAAGAAGATTCTCCacaagt ttgttcttataaaaaacgtgttttcCACATCTCAGGACATTCACCGATCC ACCCATACACAGATGAACCAATGAGAACTCCTCCATTAACCTTGCAAGAA CAAATTCAACACAAGAAGGACTGTGTCCGACAATTCATTCCTGACGACTG CAATATCATCTTTATCGGACATTCCATAGGAGCTTATATTATTCTACAGC TTATGGACCATATACCAGAAAGGTGAATACACTCTTCTCAAAATAATAAG GGGCAAGGCTTCGGATCCGTAGAATCTTTCGTAGGANattgtacttaaca acatatccaaaaatgaaaaaaatctaagtttcaaactattggaactgccc caaactgccccattcttaaaaaaactggctcttaaaaatttctactatgt atggaGCACTCTANtctttttgtttgtttgctgATGATCAACCCAGAAAA GGATTGCGAAAATATCAgtacaaaaaactgtttttgtttttttctgtttg acTTAAAAATTTCTACTATGAATAAGAAGATTCTCCacaagtttgttctt ataaaaaacgtgttttcCACATCTCAGGACATTCACCGATCCACCCATAC ACAGATGAACCAATGAGAACTCCTCCATTAACCTTGCAAGAACAAATTCA ACACAAGAAGGACTGTGTCCGACAATTCATTCCTGACGACTGCAATATCA TCTTTATCGGACATTCCATAGGAGCTTATATTATTCTACAGCTTATGGAC CATATACCAGAAAGGTGAATACACTCTTCTCAAAATAATAAGGGGCAAGG CTTCGGATCCGTAGAATCTTTCGTAGGACACATTCGCGTGTGATTGGTTT GAAAGTAGATAGAATTTCGAGACTTTTTTGAGAAGGGGCATAAAAGGCTT GGCAACCAAAAGTTTTTAGGGCGATTTTTTATCCCCCGCCAAATAGTAAA ATTTGAcgattttttaatgtttttactGAGTTTTGATTCTCCTACttgga tttttaaaagttaaaaccctttgttgataattttaaaaaatactttgact TTGAAATAGTTTGTTTGACCTGAAAATATGAAAGATAATGAAGGAAAAGT GTTTGCTCAAAACTTGTTAACGATTATTCCTAAGATGATAGTGGAGAGAC TATAATACATTTTAACACCTATCTTTTATAGATCGCTTCATGGTATATTA CTCTTCCCCACCATCACGAACATGATTGGAACAGTTGACGGAAAATTCTG GAATCTGATAACTTCATATCTCAAACTCCCTTTACTATGGACTGCATATT TTTCCTCTTATCTACCTTACGCCCTACAAGATGTTTTGATACGATGGCGT GCAAAATGGCGGCAAATTGACGCCCCGATCGTACCAGTGTGCAGACGATG TGTCTCTTGGGACGTTTTAAGTCAAGGTTTCCGTATGGTCGAATGTGAGT TAGTAGAAGTCAAAACTTTGAATCCGGAATTATCCCGGATTATACGACGA TATTCCAATAAATTGACGGTTTATTATGGTGACGGTGACGCATGGACgcc tttttctttttatgaggAATTTATACAGAAATTTCCTGAAGTGAAAACTT TCTACGGACGTGATGGTTTTAAACATGATTTTGTACTTGACTCTTCGGAA GGTGTAGCGAGGCTATGTAATAAGTTTATTGAGAAGTTATGATAGTTCAT GATTATAAGcatcttttacatttttatcataaCCTAGCTTTAACTTCAGA TATCCTCTATGTATAAGACACAGATTTGCAGCCGTTATaagtttttttac aatatttggAGGATGTACCGTGTTTCAATCCCGACTTATGGAAGATTTCG AAAATCGTTAAAACTCATTTTCGGGTCAATAACTTTTTGCCCAAGGTGTA AAAATCGACTCTACCCCACATTCGAAAGcagataaaattatctttccaac ggtgtctAGAAACCTTCTATTCGaattttttctaggttgacTCTATTTTC GACAAAATTCTACAGGACTAAAACTGTAAAAGTTGACATTccgttttata aaaatatacctTTTCGACTACTAAAATCTATTgctagtttgagtaaagaa aattaATACTCAAAGTTTTATGCCATTCTTTAGTAGTATACTCAAACTAG TATGAAGCTTGTCATTAATATTGATCACTGTTATTAGTTTTCGCTTACAC AAGGAATGTATAGAATTTATTCTTGaattttaaatatctttttggGCGAT ATCGTGTAACCCTGTATTAATGATTCAATACTCTGACCACTCTAGAACCA TCTATGTAACATGGTCAAAGGAATTTTTGTTTCTAGTTAATTTTTAAATT GTTATGAGAATTATTAGATGATGATGTTCATGTAAATAGATGAATTTGtc tttaaaacttttatttCGCATTTTATGAGAGattttatttctgatttttt aaattattgcTCGGGTCTAACGGAAATCTTTAGGTCTCTAAAATGGCAAT TTAATGCTTCGAAAATACTACCTTTTGACGTGagttttctcgaattttca acCATTGGAGACCGAAATAATCGCATGAAAACTCTTAAATTTGGTATCCC TTAGActctttaagtgccaatgtcgagtATATTGGACATATGGGCT
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000012TCONS_00000012Clytia hemisphaericatranscript
TCONS_00000013TCONS_00000013Clytia hemisphaericatranscript
TCONS_00000014TCONS_00000014Clytia hemisphaericatranscript
TCONS_00000015TCONS_00000015Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00000014-proteinTCONS_00000014-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:324098..332443 +
Orthologs
The following orthologs are found for this feature:
Ortholog NameDescriptionOrganism
C2orf43PREDICTED: UPF0554 protein C2orf43 isoform X1 Homo Sapiens
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.36 1 0.47 0.5 3.36 2.04 3.02 2.92 2.73 2.38 2.75 2.17 2.17 2.14 2.32 2 2.28 1.69 1.38 1.65 1.51 1.86 2.08 1.93 4.68 5.09 0.34 0.42 1 0.93