Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073463 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073463
Unique NameTCONS_00073463
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2122

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073463 ID=TCONS_00073463|Name=TCONS_00073463|organism=Clytia hemisphaerica|type=transcript|length=2122bp
TTCTTAAAAAGCACAAAAAAATGTTGACGCCATGCTGGAAAGCTGAGTCG
GATCATGATGTAATCCAAAACAAATCGTAAACACATCATAGTGAATTTAA
AACCTAACTGGCTGCGCTCGTTGAATGAGACAGATCTTAATCAGTTATGG
TCTAAATAGCTCATTGACCAAATGTTTACCGAGCTCATCACTCATTCGGA
AGAAGAGTTACAGTGCTTTCCCTATCACGGGAATATTTCAGTTTAATAGT
CGGACCAAGGCTAGAATCTTGCTTCTTCCGAACCTTGGTGCGTTTAGCAA
TGGAATCAATTTCAAATTGGCGGACAATTCTGatattttgtctttattgt
tgaATGTTTTGGAAAATCTAAAGTAAATTCCAATTTTGGATCATTTGCAA
TCTCGTTCAGAATGCATcaatgaaatcaaagaaagatGAATAGGTATCAT
CAAGCCAGGACTCTGGAAAAAAGAGTCAAATTATACAAGGCACAAGAGCA
AGAATCTGGAGGAGAGCCAGCTTGGAAAGATCTTGGAGTTGGTGATATCA
ATATAGTACCAAATTCTGATTCTGATTATTTTAGAAGCAACTATTATGGG
GGAATGATTATGCTGATGAATTCAGAAGAAGATGgttcAGTCATCTTTAG
AAATCCTGTCTCAACTAGAGTTCAATATCAGGAACAAGGGgaTGTCATAA
TTCTCTGGACAGAAGTCGATGGCCCGAAAGAAACATTTGCGCTTAGTTTT
ATGGACCAAGAAAATAGGGATGATTTTTTAACTCATATTGAGGAGACTAA
ATTGAAATTGGAACGTAGTGATAAAAATGGGGATGCTTACAAAGGTCTGG
ATGACCAAGATTTTGATATGCACGGCCAAGGTCTTGGTATGGATTTGAGC
TCAGAAGAAAGTCTTGCCATTCCTCCTTGCGAATTCAGCAAACTTAATGC
CTTGAATGAAACATTACAACGTTATTTACAAAGCAAAAATCTCCATGATG
ATCTAGTAACACTTTTAGAAGCCCAAGGATATATTCCAAAGTTGATAGAG
ATTTTTCATATGTGCGAAGACCTGGAAAATACTGACGCACTTCATACACT
TTATAGTATTTTCAAGACTTTATTCATGTTGgaaaaaaatgcaatatttg
aaACGATGTTTTCTCAAGAGTACATTTTGGATATTGTTGGTATACTTGAG
TACGATCCTTCAAAGACGACGCGGACACCTCATAGAGAGCATATCAATGA
TCGTGTCCAATTTAAAGAAGTGATTCCAATTGCAAACAAAGAACTACTTG
CTAAGATCCATCAGACTTTTCGAGTTCAGTATATAAAAGACATTTTAATT
CCTGTGCCATTGATTTTTGATGAGACTGGTACAACGCTGAGTTCCtttat
tttcttcaataaaGTCCAAATTATTGACCTAATAAAGGAGGATCAACATT
TTCTTGATGAGTTGTTCGAACAATTGACGAATGATGAAGTATCTGATGAC
AAAAGGAAAGACATTatTCTTCTATTGAAAGAACTTTGTGTTTATTCGCA
ATCGCTGCAACCAGCAAGACGAGAAGAATTCATCAAAATGTTGGCAAATA
TTGGAATGTTGCAGTCTATCGAACAACTCTTGAACATAGATGACAAAGAC
ATCCAGCAAGCATTAATAGACATTGTTTGCACCATCACTGAGTGTACTCC
ATCCATCATTCGAATCTATGTTTGCCGTGAAGCATCTTACACCATTGACG
AGGATACAATGATGTTGAACGTCATGATCAGTCATCTCGTCAACTGTGAA
ACTGAAGGTATGAGTGTCATCCTACTGCAGACCCTACAAACGTTGCTGGA
CCCTGAAAACATGTGTCAAACGGCTAATagcACGATTGAACGTTCGGAAT
TCTTGAGTTTCTTTTATCGTCACAACATGCACGTTCTGACGTCTCCCGTA
CTTGCTGTTACTGCCACGGATGAACTGGTCGGAAAAGACGACTTCCAGCG
TGCGACAGTGTTTGACAACATTGTGAACTTGTTGACTTTTTGCGTGGAAC
ATCATCAATCTTCTATCAAGAATTACATCGTCAGTAAAGATATGTTACGC
CGTGTTCTCGTTCTTTTACANN
Run BLAST on NCBI

transcript from alignment at scaffold_92:136919..157194-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073463 ID=TCONS_00073463|Name=TCONS_00073463|organism=Clytia hemisphaerica|type=transcript|length=20276bp|location=Sequence derived from alignment at scaffold_92:136919..157194- (Clytia hemisphaerica)
TTCTTAAAAAGCACAAAAAAATGTTGACGCCATGCTGGAAAGCTGAGTCG GATCATGATGTAATCCAAAACAAATCGTAAACACATCATAGTGAATTTAA AACCTAACTGGCTGCGCTCGTTGAATGAGACAGATCTTAATCAGTTATGG TCTAAATAGCTCATTGACCAAATGTTTACCGAGCTCATCACTCATTCGGA AGAAGAGTTACAGTGCTTTCCCTATCACGGGAATATTTCAGTTTAATAGT CGGACCAAGGCTAGAATCTTGCTTCTTCCGAACCTTGGTGCGTTTAGCAA TGGAATCAATTTCAAATTGGCGGACAATTCTGATATTTTGTCTTTATTGT TGAATGTTTTGGAAAATCTAAAGTAAATTCCAATTTTGGATCATTTGCAA TCTCGTTCAGAATGCATCAATGAAATCAAAGAAAGATGAATAGGTATCAT CAAGCCAGGACTCTGGAAAAAAGAGTCAAATTATACAAGGCACAAGAGCA AGAATCTGGAGGAGAGCCAGCTTGGAAAGATCTTGGAGTTGGTGATATCA ATATAGTACCAAATTCTGATTCTGATTATTTTAGAAGCAACTATTATGGG GGAATGATTATGCTGATGAATTCAGAAGAAGATGGTTAGTTTTATTTTCC ACATTCTGTCGTTTTTAGCATTTTTAGGCCATATTTTTCAACTGGCTCCA GTTGTTTCAGAAGTTTGAGTAGTTTTCTTTCAGATAATATATACAGGAGA AGCAGAAAGACCAAGAAAGGTGGTGGCTATAATCTAAAATTTTGTCAGTT AATGTTCTGTCTGTTTATGAGTTGAACATTAAAATTTCTTCTAGAAGTTA TATTGATTTGATTGATTGCAACTGCATTGGGTGCAGTGTGTATTTTCAAC TACTTTTCCTTACGTAAATGTATATAAATGTTCTCTTTAAGATGTGCATT TCAAGTTTGTGTCCAATATCCCATTTAATAATACCGCGAGTGGTCCTACA TCCGACAGCACTGCCTAAACCCCTATGGGGTCTTTCAAAGATATACAAAC TAAAATAAAAACAAACCTCTCGCTGTGACGCAATGAAGATACCAAAGTCA GTCAGTACCTTTAGCCAAATTAGGAACATTTTTCTTACTTTTACTAGTAT TCCTAATTAGGAATCTTATTCCTAATTAGGAAGAAAAAAATTCCTAATTA GGAAGAAATATTTAAAATTTTAATATCTCTGAAACAAGCTACATTCGCAA ATTCCAAGTATGACCAATAGATTCGGTATACCAAATATGATAACTGTGAA AAAAATTTAAAAATTTCATTCGCGGATGGTGGAATTATTAACGCCCCAAA AAAATAATTCCAAATTAGGAATTAAACGAACTGCTGTTTTTATTATCACG AAGAAAAACAGAAAGTGAGTTTCCCGCGTTTTATAAATAAGATGTCAATT TAGGAATTTACTACTGGGAGAAGTGAAGCTTTTTCTAGGGATTATAGCTC GGTCCCCCGAGCAAGTCAAGAGCTCAATCTTTCTTTCCCACCTAAATGGA ATGGAATGGAATCTTATGAAGTACTTTTTAACGTGCGATTTTTTCTATTT TTGGAGAAAATCTAGGTATTTGCTTCATATTCCTAATTAGGAATTTTTTT CTTCCTAATTAGGANTCCCACCTAAATGGAATGGTAAGAATCTTATGAAG TACTTTTTAACGTGCGATTTTTTCTATTTTTGGAGAAAATCTAGGTATTT ACTTCATATTCTTAATTAGGAATTTTTTTCTTCCTAATTAGGAATTAAGA TTCCTAATTAGGAATACTAGTAAAAGTAAGAAAATGTTCCTAATTTGGCT AAAGGTACTGACTGAAAGTGTCAACTAAACTGAGAGATTTGATTCATTGA ACCAATTGAACCAAATATAACAATAATTGCTTTCTTATACAAAACATATA ATCTTTTACTACAAAATTGTTAACGTTTTAATTTTAAACACACAAGCAAC GGATTCAGAATAATAGATGTAATTATTTTTACAACTCACACTTTTTTTAT CACATTAATTGACATCTTGAAATTATAGCCATCTTGTTAGATATTTTGTT TTGAGAGTTATTGGAATATTTTAGTTTATTGTTCAACTTGGAGAGGGAAT GTTTGTAAACATAGAATTTTTTTCATAGCAGTTATTTAGAGGGGGGGTGG AACTTAGGCATGGCTGTCAAATTTAGGCATGGCTGTCGGATTTAGGACCA CTCACGCTATCCATGAAACATAACCAGACGGTATCAATCGAACAACTTCA AACAAAAAGTGCAATCGAACGAATCGAACGTAATCGAATGCGATTCAATT GTTGAATGTAATCGAATCTCAGTCGAACTGCCGATTCCTGGGTAATATTC GATTGTGTTCGATCGCGTTCGAGTGAGGTTAGATTGGTTTGATAGTTGAC TATGTTCGATTGTTTTGATTGATTGTCGATTACATTCAATTACAGGCTTC GGCATATGAGGCGTGCGATCGCACGTGCACGCCTCCACANTTTAATTTAC TACTGGGAGAAGTGAAGCTTTTTCTAGGGATTATAGCTCGATCCCCCGAG CAAGTCAAGAGCTCAATCTTTCTTTCCCACCTAAATGGAATGGTAAGAAT CTTATGAAGTACTTTTTAACGTGCGATTTTTTCTATTTTTGGAGAAAATC TAGGTATTTACTTCATATTCTTAATTAGGAATTTTTTTCTTCCTAATTAG GAATTAAGATTCCTAATTAGGAATACTAGTAAAAGTAAGAAAATGTTCCT AATTTGGCTAAAGGTACTGACTGAAAGTGTCAACTAAACTGAGAGATTTG ATTCATTGAACCAATTGAACCAAATATAACAATAATTGCTTTCTTATACA AAACATATAATCTTTTACTACAAAATTGTTAACGTTTTAATTTTAAACAC ACAAGCAACGGATTCAGAATAATAGATGTAATTATTTTTACAACTCACAC TTTTTTTATCACATTAATTGACATCTTGAAATTATAGCCATCTTGTTAGA TATTTTGTTTTGAGAGTTATTGGAATATTTTAGTTTATTGTTCAACTTGG AGAGGGAATGTTTGTAAACATAGAATTTTTTTCATAGCAGTTATTTAGAG GGGGGGTGGAACTTAGGCATGGCTGTCAAATTTAGGCATGGCTGTCGGAT TTAGGACCACTCACGGTATCCATGAAACATAACCAGACGGTGTCAATCGA ACAACTTCAAACAAAAAGTGCAATCGAACGAATCAAACGTAATCGAATGC GATTCGATTGTTGAATGTAATCGAATCTCAGTCGAACGACCGATTCCTGG GTAATATTCGATTGTGTTCGATCGCGTTCGAGTAAGGTTAGATTGGTTTG ATAGTTGACTATGTTCGATTGTTTTGATTGATTGTCGATTACATTCAATT ACAGGCTTCGGCATATGAGGCGTGCGATCGCACGTGCACGCCTCCACACA AGCCCCAAAGGCACTGAGGCGTGCGATCAGGACATGGCTCCGCCCCCCAC TTATTTGGGGGGGGTGTAAATCTCAAATTGGCTTAAAAGTGGGTGGGAGC TGTCTCATTTTATAAATTCAGGGGGGGACCTAAAAAAGTGGGGGGAGCTG AAGGGCTACACTAAAGTTCTGGGGGGCTAATTAGGAAACTGTAAAATACC CCCTCACTATTGTTTTGGTTAATAAGTTATAGATTTTTCTATTGAATTTA TTATCTCTTACATTCTATCAAAAAGTAGGCTAAAATGGCAGATTTCTACC CTTAAAATTCCAGAATTTTGTTGTTGCCCAACCATGGTGGGCAACATTTA TTTAAATTTTCAATTTGGAACCCAATTTTTTTTAACCCGTATTTTTATGA TGTACATGAATTCTTTCTTCTCTTCCTCAGTTGGTTGACGTCCCATGTCG ATACGTAAAAAAACTAGTAATAATACTACCAGAAATGACAGTAGCTTTTT TTGCTGGGACCCGAACCTTGAAAGCAATTTTTGCAGGGACCTGAACCTTT ATATTTCAACTGGGACCTGAAGCTTACTGAAAAGTGGGGGGACCTAAATC GTAGGGGGGACCTAAATTTGTTGGGGGGACCTAGAACCCCATTCGGAGCC ATGGAGGAAAATATATAAAATCAATTCAGGCGTGCGATGCATCGCACGTG CAGAAAAACTTCTTTAAAAAAGAAAGTTTCTTTCTTAATCTTTCCACGCT TTTCTCTCTGGCATCATAAAAGAAGAAACTCCCTTATTTGCTTGCCTTTT TGCTGAAGAGAAAATCTCTTCGTTAATTGTTGCTGAGTAATTTTTCTTTC TCTCTGGTTATTACGTCATAACAAATGTTCGGTTCATTGCACATTTTTAT TATCTTTAGTAACACCCTTCTCACAGGCCCGGTGGGATTTTTTCAGCCAG TGGGGGTAAAAATAACGGACTAAAAGTCAACGGGGATTAATAATCCCATA CTCTTTATTGCTGGGTATTTCAATTCTTTTGTCAAAAATTTCTCTTTGTT GAGGATTAAGAGATCTTATACGAGTATTTATTTCATTATCAGGAAGCAAA ATAGATTCCATTCTCAACTTCAGTTGAGCTACAATCTGACAATGTCTGTC TGTCTGTGTGTGTGTGTGTGTGTCTGTCTGTCTGTCACAAAAACTTTAGG GCAGCCTGGAGACTTCAAAAATGCTTGGATTTGGCTGAAATTTGGCACAC TTGTTCCTTGGGTGAATATCTGGGGGTGCTTTTTTCGTTTTTTTTAAATT TTGATTTTTGGGGCCTGGGGACAAGTTTTCGTCAAAACAAGGCTAAAACT TTGGGGCAGCCTGGAGACTTCAAAAATGGTCGGATTTGGCTGGAATTTGG CACACTTGTTCCTTGGGTGAATATCTGGGGGTGTTTTTTTCGTTTTTCAA AAATTTTAATTTTTGGGACCTGGGGACGAGTTTTTCTCCAAAACGAGGCT AAAACTTTTGGGCAGCCTGGAGACTTCAAAAATTGTTCGATTTGGCTGAA ATTTGGCACACTTGTTTTTTGGGTGAATATCTGGGAGTTTTTTTTTCATT TTTCAAAAATTTTGATTTTTGGGGCCTGGGGACGAGTTCTTCTCCAAAAC GAGGCTAAAACTTTGGGGCAGCCTGGAGACTTCAAAAATTGTTCGATTTG GCTGAAATTTTGCACACTTGTTCCTTAGGTGATTATCTGAGGACGTATTT CTTTTATTTTTCAAAATTTTTTAATTTTTGGGTCCTGGGGACGAGTTTTC GCCAAAACGAGGCTAAAACTTTGGGGCAGCCTGGAGGCTTCAAAAATTGT TCAATTTGGCTGAAATTTTGCACACTTGTTCCTTGGGTGAATATCTGGGG TTCTACAATTGGGCCTATGATTAGTTTGAAGGCACTGAAGTTGANNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNTACGAGTATTTATTTCATTATCAGGAAGCAAAATAGATTCCATTGG TATTGCTGCCCTAAATGGTACTGTGTCTTCATTAGCTTCATCATCTGATT CATTATTATTATTTGCAGTATTACTTTCAAGCTCAGCATTTGTTTCATCA TTTTCCTGCTGTCATTCATATTGAGTGTGATGGGGATTTTACTTTATATC GCAAAGAGAAACACATTTTTAATCTGATTTTTTATGAAAACGCTTTTTCC TCTCGAATAAAAATTCGTTTTTCTGTTTGATTCAATCTTTGATATAAGAA AGCTTCTATGTAAACTCTTAAAATTATATAAAATGTATCTTTTATACCCT GTCTCACCTTCTAATGAGAGATAAAATAACTAATTTTACTTTAAAACTTC GCACGTTATCGCACGTCTAAAAGGATTGGGGCGTGCGACTCATCGCACAA AATTTTAATCTAGGCATGCGACGATCGCACGTCATCTTTTTTCTTATGCC GAAGCCTGTGATTAATCTTCGATTTAATTTGATTACGATTATGTTCGTTG AGTTTGAAATTGCGATTAGATTAAATTGGATCACTCCATTGGAGCTGTGG GTGTGTGGTGTCTGTGGGTGGCCGAGTGGTAAGTACCGTACAAAAGCAAA TAAAATCTAATACAATTGAATTGAATCAATCGAACGTAATTGAAGCAATC GAACAGCAAATCCTGGGTAATATTCGATTGCAATTCGATTGTGTTCAATT GCGTTCAATTGATTCGGCGTTTGATTTGTTCGATTGACACCGTCTGAACA TAATCAACATATTGCTCAACACGCGTTTGTAAGTTACACACTCGTTATTT GTTAATCCCATTGGGCGATAGGCAGTTAGGTGGCAGGTGTTCTCTAATTC TCCAATCAGCGTCCGGTTATTTTGAATGAAAGAAAAAAAGTGCGCTATCA GTGAAAGTTATCGTGACATGTTATGGCAGAAAGTATGATTGATAAACTTG GTGGATTTACCAAAACAAATTTGATGTCAAAGAGAACAGTAAGAGAAAAT ACAGGCCAGATATCAACAGCTCCATGTTTCGACCAATCGTCCCAAGTTAG AGCAGTTGATAGTACCACTGAATCTCCTTTGAGCGTGTTGTCAAATTTAC AGAGCCTATTGCTAGATTGTAGGTTTGTTTGTAAGGTCTGTCATATGTGA CCTTTACTTTATTCTATCATATATGAAAGTATTGCATTTAAAAGCAACAG TGGTCAAAATAAGGTTTTTACTTCTGGTCAGTTATTCTAGAGAATCAATT AGTCATGTTCAGTGTCACCCAAAAGCTGACCGGTTCACCCTGAGTGGCAT GGATTTTAAAAGTTTGTCCTTTTGTTGGCTTTAAAACCCTTACTTTCATA TCAATAAGTTTTTAAATGAGCTTGAAACAAGCAAGTAAATTTGCTTTTCA AAGCTTTAATACTCAAAACATGTATGTTACCACAGACAGAGACAGGACTT GAAGATTTACTGAGTGTTGATATTCGCTAAAATATAAGGGAAAATTCTAC TAATTCACAAAGGTAATTTTACTAAGTTCCACAAAGTTAAAAAGGACAAA AATATAGAAAAATAGCTTGGTTGAAAACTCTCAAAAACTATGGGGAAAAC TCAATCAAAAATTATGGTGAAAACCCTCTAGCTCAACAAAAAGTCAGTTG AAACTCTCAAAAGTTATGGTGAAAACTCTCTTACTGAAAAAAATCAAGAT AAGCGTACAGAGGCGTTATGATTGGGGGGAGACTAGGGGGAGGCTAGCCA TACCTACCTCCCTTTCCAATTGCCGGCCATCCTGCATGACAAGACAAATT TTGCATATCATCTCAGACAGTACCAAATTTCGAGAAAGGATTCTAGGCAA ATTCTACCACTAAGCATCTCTGGGTCTGTTTTTGTTTTTTTATATGCTTA TAAAAAAAACATGTGCCCTTCATTTGCTTAGAATCCTTCCTCAAAATTTG GTACTGTCTGAGATGACATGCAAAACTTCAAATCTCGCTCTTGTCGTGCG TTTTCGTACGTCTGTCACGTTTGAAATGCTCATAACAATCATCCAGGACT TTGCAATTGCAAAGGGAGGTAGGTGTATGGCTAGCCTCCCCCGCAATCAT AATGCCTCTGTATTGAGGCTTTTTGTTGAGTTAGAGGGTTTTCACCATAA CTTTTGAGAGATTTCACCATAATTTTTGAGAGTTTTCAACTGATTTTTTT TAAGTTAAAGGGTTTTCAACCAAGCCATTTTCTAGGTGAAAGCATGACCT TTCAGGTCTATCGTAGTAGAGTTTTTGAAATATGAATCAGTTTTTTAAGT CATTAATGAATATATCGATGTCAGTTTCTGAATCATAGTCTTTAAACTTT TGCAATTTGATGATGAGTTGCAGCCTTTTGAAAAAATTCAATTTTAGTTT TCCCTAAGTTTATCATAAACACCTGTCTTATAGGTTTGTGCAAGTGTGTA AAAATTTTCACCTTCATGATGTTCTAAAAAGTAGGAGGAACTCCTGGTTT TGTTCACTAAATAATCCCTACTTTTTTAAGGTCAAGTAAAATTTCCTGAA AACTTAATATATATTAACTTAATAAACTTAATAATATATAGTCATAATAG TTTTACTTTTTTGGTTCTACTTTAAGGAGACAAAGTTTTTAATGGGGACT GATTCTAAGAACCTGTTTCTTAATTTCTGCTTGTAGAGGGCGTACTGGGA ACCCAACTTGAGTCTTCCCAAAAATTCGCAAAATTGGATGCTTGCTTAGA AATTTTTTAAAAATCTTTGGATTCACAAAACTCTTGAAATATAATCCTCA CGTAAAATTTGAAAAATAAACAAAAATGGGTCAAAACCTTTATGAAAATT TCATTTTCTGTGCTCACAAAAATAAGTCCTGAAAAAATTGAATTATTTTT TAAATAAATTCCCTTGTCGAAATATCTGCTTGCAAAAATAAATACATGTA ATGTATATCACTGGCTTTCAGATCAATCAGTTCCTTGAGTTGTTCAGAAA GGGCATCGACATCTGACATCAGGGACTGCAGCTGCTTCTTAAAGAGTGAT ATTATACATTGGTGATAGTTGCGATGGTACAGGTGAAAATTTCTGTAAGA TACTGGATTTCATGTCCCTGCTCCTCCAGCAACAAAGGTTGTGTTGATGG ATAGCACCTAACCAATGAGAGAAAATAGCTGTGCCTTAATGTCAGATTTT CCTTCCATTTGAATGATGTTGGTTGATTGATGACGTATGGAGTGAGTCAA GCGAAAGATAGATGTACAGTCAACGGTCCTTTTCAAATTCAAGATTTCAA TAGTCATTCATTCAAGATCTCAAAATCTGTGACTTCATTGGGTCCCTTTT CACTCTAATGTTGTCAATATTCAATGTTGGACCCAAAACAAACAAAAAGC TTAAATTATTTATGGTCTCCCAGTATTTTTGCAAAAGGTGGAAAATGCCA ATTAACAACTTGTTTTCCAAAACACTAATTTTCACACTTTTCCCCCTTCT ACTTTAACTTTCGTTTTCAACTACAAACAAACAAACACATCACCTCTAAT TTCATGTCTGAAAAATCTTATATGACCACCTCACAGCACACTCACACAAG TTTTTAGTAAAAAGTCTAGCTGTTATGGAGCATTGTACCCACAGAGTAGA GTATTGCTTAAGCATGAAAAAACCCTTTGGTTAATGAGGAGGGATTAAGG GAATAACTTAAGCTAAGGCTACACTGAGCAATTTTTTCAGGCGCTTGGAA CGCAATCTAGATTGCATTGCAAGTGCTCGAAAAAAATGAGTGTAGCCAGG TCGAATTCTCTCGATCTTTTCTGCAACGCAATAAAAACGCAAAAAAATAT TGCAAAAAAAATTGCAAAAGGCTGCAACAAAATAGATCAGATCTATTTTG TTGCAGCCTTCTGCCATTCTTTCTGCCAAATAAGAGGAGAAATTTTCTTA ATGTTTACTTTTCTTCTTTTTTCCTATTGTTTAAAACACTCGAAGAGTAC CTAGTGATGTATGGAATAGAATTTTTAATAAAAGATTATTTTTTTGGCTG GATGAAATATGAAATTTCTCACAGCTGAGAAGGAAATTGTATATGGTGTT TGAAAGAAGATAACATGATGGCGGAGAAAAACAAGAGACTTTCGGATGAA GAAAAGAAAACGCTATTAATTATTTACAAGGAGAACCCTCCACTCTGGGA TGGTACAAACCCATACAACAAATCAAAACCGATGAAGGAGTCGCTGAAAG CTTATGGAACAATTTGATGATAATTTTTCTACTGAACAACTCGACAAAAC TTTCCACTCTCTGCGCACCTCTTTTGTCCGAGAACTCAAGAAAACCACTG AACATGCTGCATCAGAATCATCAGATATACCCCTCAAAAAGTGGAAATTC TACGATGAAATGCAATTTCTGATTCAGGAGATTAATCGAGAAAAGAAGAA AACAAGTTTTAGCGAAACTGAAATGGAGGAGCTTATCGAGTTTTACAGAG ACCATCCTGCGTTGTGGAACCACCCTATCTAAGGATTATAGAGATATAAC TTTGAGGGAGGCGTTGATGAACAAAGTTAGGGTACATTACGAAGATAAAT TTACTATGGACGAGATTAAACAAGCATGGCATAACACCATATCCCGAGTC AGGGTCAAGACTTGTTCCTTGATGCTTCTTCTCTTTGCCTTTCCTTTTTG ACTTGATGAAGTTTATATTTCACAGTGGAATTACTTTGCCATCATGGAAT TTGTTGATGTAACCTGTGGAATCGACGAATCTGTCAACACAATGAGGAGT CAGATGACCCAGCACCGCCTAAAAAGAAATCTAAAGCAAGGACAAGAAAC AATGAATCAATATGAGAGCAAGAAAAAGCAGAAGAGCAAGCGGCAAAAAC ACAGCTTTGGAAGGCTTTAGCTGACTCGTTATCGGCTCCGCCCAGAATCC AACAGTCCCAATTTGCACAGTAACAACCTAAACCAACGCCTTCAAGTCAA CTCGAAGCTAGAGCCAACTTGTTTGGGAAGCCAACTTGTTGCTGATCATC TTTTACAATGCGAGTCTTGTGATTGGACAAATCATGGATTTTTTTTTGGT ATGAGCTCAACCTACTACCTCCTTGGCGACAACAAAAACAGTGTTTGAAA TTCAACCCGGACAAGGTGACCAAGGTGGAAATTTCACCCCTATGTTACAA GGTGACCAAGATGAAAATTTCACCTCTATGTTACAAGGTACAAGCCCAGT TCACACAGAAAGAAATTCGTTCTCCCCCAGCTCTACATACTCAAATGACT CATTCGTAAACTACTAACACTTGAAAACATACAACAACATTTTTTGAGTT TGATATAGATACATTTTTATTCTGATTAAAGATAAACTTTCCCAGTTCAT GGTAATATAAATCTGTGGCATTTCCATTCTTGAATAATTCAAAATATTAG GAAAAAGATAATACTATATCTTATTGAAATATTATTCTAGCTTCTAAACA GGTTTTTGACTTGTATACAGTCAAATGATAAAGATTTCTGTGAATTTTGA TCAGTGTCAAATGCCAACTCTTGCAGATTGCCATTGCCAGTTACTGCCCC TTTCAAGTTGAAATAATCTGTAAATTCTTCTCTGATCGATTTTGCTATGT CTGGTGAAGGATTCCCATGTAGGTCGTTAATGATTGGAAACCAGATCCCG CTTCCAGATTCTTCAATTAATTCACCTTTAGCAGATTCCTGGTCAACTAA GCCCACGGGCAAGTAGATCTTTCCGATTGAAGATGAGCTTCTTTGCCAAT TATGTAAAGCAATGGTAGCCAAAGTTATGGTTCTTACTTTTTCAGGGCCT AAAGCTATAGGTTTACAAAAGAAACGCCACCTATTAGCCAAGATTCCGAA TCCGTTTTCTGAAATCCTCTTTTTCCGAAAAGACGGTAGTTAAAGATTCG TTTTTGTACAGAAAGACCTTTTTGGGGGAAAGGTTTCATCAGATAGCTCT TTAAAGGAAATGCGTCATCATCGGTTACAACAAAAGGGATTTTTATTCTA CGTCCAGGCAAACTTTGTGATGAGGGTAAATTAAGGGCTCCATTTTTCAG TGATTGTTTTAATTTGCATTGGTCCCATATCCCTCCATCAGAATCACACC CATCTGCACCAACTTCAATATAAAGAAACTCGTACTCTGGGCCAACCAAC GCTAATAGCACTATACTGTCTGTCCCCTTATAGTTCCTGTAGTGAGAGCC CGATTTGTCGGGTTGCTGCATCACTATATGCTTCCCATCGATAGCCCCAA TGCTGTTTGGAAAATTCTATCTTTGACCAAACTTACGCAAAATTTCATTC AAGCCATTCTGCTTAAGATCTTTGTGTCTTTTAGCACGTAAAATTCTAAA TTAAAATTCCAACGAGCGAAATGTCTCTCCAGTCGCAATCTTTGAAAATC TCTTTTCTACTGCCTACAATATCAAATCAAAGAGGGTAACTTATTTGTGG CACACCCGGTATCATTTCTGTCTTGCCAGTAAGAGGGTTTTTGGTTCAAA TGACCATCTAATCCTAAGGTTTCTGTCCACATTCACAAAACCTAGTTGCA ACACTGTCTCCAATCTTGAGATAATGCATATCTCCTGTTTTGATAACGTC ACAGGACCCAACAAACCAGACAAAGTTAATTTATAAAATCTTTTTCTACA ACTTATTCAAATATATTCTCCTAACAATTTTCCAACAAACTCAACTTCTT TTCAAACTTGAGGTACGGTATTTTTCCTGTTGATCAAAATTTCTGCTAAC TTTTAAAGTCAACCTCAAGGCCTAATGTTACCAATACCTTAAGGGAACTA ATTTTCGTGATGCGACTAATTTTCACAGTTGGCGCCTAGTTTTTGTTCAA ATTCTTTCATTTTTCTAGGGGTTTTTACTGATTTTCAACGAAAATTGTAT TTCACAGAACTAATTTTCACAGTTGGCGCCTAGTTTTTGTTCAAATTCTT TCATTTTTCTAGGGGTTTTTACTGATTTTCAACGAAAATTGTATTTCACA GAACTAATTTTCACAGTTGGCGCCTAGTTTTTGTTCAAATTCTTTCATTT TTCTAGGGGTTTTTACTGATTTTCAACGAAAATTGTATTTCACAGAACTA ATTTTCACAGTAAGGGCAAAATTATTTTAAAGGGAACCAAAAAGTGCATC TGGGAGCTGAAATTTTTTTTTCAGTTAACATTTTCAAATTTATATGTATC ATTTCTCATAGTATCTGAAACTTGTTTGCAGTTGTTTTAGAGCTACAGCA CTTCCGAAACATGAATTTGCCATTTTTTAGGCTAAAAAACCTTGAAATTA AAGCTTTTTAGCCTAAAAAACAGCCACAGCCATATCTCAAAAAATACAAT GAATGCTTCAGTTTTAGTTGTTTAAAATCCAACATAGGCCAACAATTGAT CAAGAAAACTCATTTACAGCATGTTTGGCCTTCCCTGGATTGAACGGTTG AGGATTTTATTTTCCAAAAATCTTGCTTACGGAATGACGGAAACATTAAA AATGCTGTAAAGTTTTAAGGAAACATTTTTAGAGTAAAATATTTGGCAAG TTTCTACGTCTTACTGAGTACTTTCAAACCAGACATAAACTAATTGCCAT TGGGGGAAGACTGGTTTTTAATTGAGAAATCATTTTTGGTTACGGAATGA CGGAAAAATTAAAAATGCTGTAAAGTTTTAAGGAAACATTTTTAGAGTAA AATATTTGGCAAGTTTCTACGTCTTACTGAGTACTTTCAAACCAGACATA AACTAATTGCCATTGGGGGAAGACTGGTTTTTAATTGAGAAATCATTTTT GGTTACGGAATGACGGAAAATTATCTTACTTTTATACTGAAATAAAAATT ATGAAATTTTCACTTAACCATATCACCTCAAACATTTTTTAAGCTGATAC AGTAACTTTGTATCAAAATCTAAGCATTTGATCTATCTTGAAAACCTTTC CATTAACCCTATATAGGGTTCTAAAGTTAAATTAAATTTTTACAACCGAT TCTGTTTCATATCATGTGTACCGCATTCATGATAAATTTAAAAAATTGGT TGAGTGTTACCAAAAATCTTTTTGATTTTCTCAAAGTGTTATAGTTGCTN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAGC ATGAAACTCGGAGTAGTGTACTTTTTTATTTTGTGATGAAAGATAACTTT TAAAATTTAAATTGGCTCTGATTTCATTGAGCACTCTGCAACATCAATCA CAAACAAATCTAGTTGCTATTGCTAAAAATCATGACTTTGATAGCATGAA CATCAGTCAGTGTCAATTTATTAACCACTTTAAAAATGCAAATTTTTGGG TGACACTCTGTTTCATGGAAAAAATGGGCAGTTTTTTAGCTTTAAAATGC CATAACTTTAGTTTCGCTTGTGCTACAGACTCGTATGAGCTCTCATTTTT CAGCATTTTTTATTGTGCATCCTCTGAAATTAAAATCATTCAATGACAAC CTCCACTTTATGCACAGCATCCTTTTGAAATCAAGGTGGTCTCTGGCTCC CTTTAAAATAATTTTGCCCAAAATTTGTTCCCGCAAAAATTAGTTCCACA AAAATTAGCTACCACAAAAGTTAGTTATAGTAAAAGTTAGTTCCCTTAAG AACTGGATTATTTGCAGCATCCACAGGGTAATGTTCAAAATGGCAAACCT GCAGCTCACTCACACACTACTTTAAGTATATAGAATTGAACCTATTTTTT GTTTTTTTTAGGTTCAGTCATCTTTAGAAATCCTGTCTCAACTAGAGTTC AATATCAGGAACAAGGGGTAAGGCATATTTTATGAAAATTTTACTTTTAT GAACACACAATGACAAACTATATTTTTGCTTTCCATCCTCAATTAATTTA ACTAACATATGTTTGCATTTTAATCTTATTACTTTTTGGACTACCTTCCT TTTCAGGCAGATAAAATTTATAAAGATTGTATTTAAAACCCGTACAGACC ACAACCTGTCAAAAAAACTAAACAATCTGATTGTTTATCAATGATCATTA GTCAAAAATATTTATCTTTTATTTCTTTTGTAGGATGTCATAATTCTCTG GACAGAAGTCGATGGCCCGAAAGAAACATTTGCGCTTAGTTTTATGGACC AAGAAAATAGGGATGATTTTTTAACTCATATTGAGGAGGTATTTTTTTAG CAGGCATAATTTTCTTACTCATAAATAGCAAAATACGTTTTTTCCAGACA GCCCTTTTGATAAGAATGATCGAATGAGAATCTCTCGAAACTGTAAAACT TCAAGCCACCAAACTTCCCATATAGATATCACTTGGAAATATGACATTCA TACTTATTTAGATGAGCCTTTTCAAGGAATGATCTTATTATAAAACTTGT TGATTCTAATTATTGTGTTCTGTTTTTCTCAGACTAAATTGAAATTGGAA CGTAGTGATAAAAATGGGGATGCTTACAAAGGTCTGGATGACCAAGATTT TGATATGCACGGCCAAGGTCTTGGTATGGATTTGAGCTCAGAAGAAAGTC TTGCCATTCCTCCTTGCGAATTCAGCAAACTTAATGCCTTGAATGAAACA TTACAACGTTATTTACAAAGCAAAAATCTCCATGATGATCTAGTAACACT TTTAGAAGCCCAAGGATATATTCCAAAGTTGATAGAGATTTTTCATATGT GCGAAGACCTGGAAAATACTGACGCACTTCATACACTTTATAGTATTTTC AAGACTTTATTCATGTTGGAAAAAAATGCAATATTTGAAACGATGTTTTC TCAAGAGTACATTTTGGATATTGTTGGTATACTTGAGTACGATCCTTCAA AGACGACGCGGACACCTCATAGAGAGCATATCAATGATCGTGTCCAATTT AAAGAAGTGATTCCAATTGCAAACAAAGAACTACTTGCTAAGATCCATCA GACTTTTCGAGTTCAGTATATAAAAGACATTTTAATTCCTGTGCCATTGA TTTTTGATGAGACTGGTACAACGCTGAGTTCCTTTATTTTCTTCAATAAA GTCCAAATTATTGACCTAATAAAGGTAAGCCAAACTTGAATTTCTGTATC ATTGTTTTTAAGCAAAAGTTGAAAATGTCTCACTTCTGAGGAAAATGTGT TTAAAACTTTCTAATTTTCATATAATCACTCTTCGATCATACTTTTTCTT AACTTCTTGATGAACAGGAGGATCAACATTTTCTTGATGAGTTGTTCGAA CAATTGACGAATGATGAAGTATCTGATGACAAAAGGAAAGACATTGTAAG ATAATACACTACAACAATCCCAATAAGTTTTGTGGTGCTTGCCACTACCA CAAATCCCTTGTTAATACTGCTTTATTAGGTGGTTATAATGCAATTATAA TCCATCCATTCGGGTTTTTTTCGAATTCTTACCCTGAAAAAATGAAACTT GGTATCCTTTGACATTTTAGCAATTTTTTATATTTAGATTCTTCTATTGA AAGAACTTTGTGTTTATTCGCAATCGCTGCAACCAGCAAGACGAGAAGAA TTCATCAAAATGTTGGCAAATATTGGAATGTTGCAGTCTATCGAACAACT CTTGGTAAATTATAGTTAGCTTGTGCTTTTACCTTAAACGCAAACCTTTC ATACTCTCCATGCATTTCAACTTATCCTTTGCCACAAGTTAGATTACTTC CCCCTCCATGTATCCCAGTAGGTCCTAGTAGTTTAGCAGTAACCCTACTT GTCCCCTACATGGTACTTTTTATTTAGTTTTAATAACAACAAGTTTTTTC AACTTCTTTTGATGTGTAGAACATAGATGACAAAGACATCCAGCAAGCAT TAATAGACATTGTTTGCACCATCACTGAGTGTACTCCATCCATCATTCGA ATCTATGTTTGCCGTGAAGCATCTTACACCATTGACGAGGTGATTAATCT TAACCATGTTCCTCCTGTCGACTTGGATATTTCCGATCGCTTTAGTCTAA TCAGTACCAACACCCTTTCTAAATTATTCACAATAAATAATTTGTATAAT AATAATTTTGAGTATTATACATACTGCTCTTACTGGTGGTGGGTCACAGG GAACTATAAGATCTGCAGCTAGAGTTAAAAGGCCTCCTTTTTAAATTCGT TTTCCTCTGTTTGGTCCTTTAAAAGAAATGTATTTATTAAGCCAGCCAAG GATTGTGGTGATTGATTGTATTTGACTGATTGATGTTTTTGTTTGTTTAC AGGATACAATGATGTTGAACGTCATGATCAGTCATCTCGTCAACTGTGAA ACTGAAGGTGAGACTTGTCCGCATAGTTCCTGCGCAAATTGTTCTAACTA ACTACTTTAGGTGACAAACTTTCGTGAGCAAAAACTTTTGCGAGGAAGAA AAGTCGCAAAATTTACGACATTAACTTTCGCGAATCTGACGGAAAAATTT TTTTCACGGGTTTAAAAATTTGTGAATCAAGACATGAAAACGAAAATTTT ACATGAAAAAAGTGGCTCAGAAGGCTGAATGTTTCTTGAATTAGATTGAA GCTTTTTTCTTTTGACATATGAGGCTTTAACAGGCTAAAAAGTGCCATCT ATTTTTTCAAAAGCTTTAAAGTTTTCGATAATGGCCATTACAAGACTTTT CAGAGACATTTAATTTCGCATAAAAGGGTAAAATTCGCGAAAATCGGGAA AGTTTCTACTTGGGAAAGTTTGTACGCCTAAAGATATCATCTTTAGTATG ATCTTAGTATCAACGTCTGGTTTGCGGAATTACATCCGTCTCTTACATCC TTTGCCATGATTTCCAGGTCATGATTTTTCATGTCATGTCAATGTCTAAT TTCTTGCAATTTCGCAATGAAGAGTTATTCTTAAGTTGAACTTTACTTGA ATTGATATTTTAGGTATGAGTGTCATCCTACTGCAGACCCTACAAACGTT GCTGGACCCTGAAAACATGTGTCAAACGGCTAATGTAAGTTCACTGTGTT TATTTTCTGATCTGGCGAAGTCAATATAATTATCTTGAAGTTAGCGGAAT TTGAGGTTTCGAACCATTCTTTTTTCTCTTTTGAGAAGCTTGGAGGGGCT CATTAAACAGCAAGTTGATCTGATGTAAATAGCCTTATCTGTTCAGCTTT TCTTTGCTTGGTACACCCGAAGGGATTTCAAAAAGATTTCAAAAAAGGAA AGTTATTTTAGTCTTTTTAAATCTTGTTTTCATTTTCAGAGCACGATTGA ACGTTCGGAATTCTTGAGTTTCTTTTATCGTCACAACATGCACGTTCTGA CGTCTCCCGTACTTGCTGTTACTGCCACGGATGAACTGGTCGGAAAAGGT ATCTTGTCTCTCACTGATTGAGGAGGAAATTTTGATGCCTACTTCGTAAT TTTTGATAGGGTATCCAGACTGAACAAACACCTCAACATACATAGTTCTA AAATAGGCCATTTCGCAGTCGAAATGGATCATCGGTGATCAGGACTGATT GAGCCTCCATAACGGCTTTCTGTTGGCTAGACGCAAAAATATTCAAAAAT TTTCAAAAAGTTGAACAAATAGTAAGTCATCATTCGTGCGCAGTTGTCCT GGTTAATCAATTTGCTTCACGACTATGAAATGGCCTATTTTAAAGTGGTG AAAAGTCTGATACAGTTTGTTTGATACTGTGTGCGAGTAAACCCTTGTTG ACAAAACCTTAAAACTTTGGAAATCCAGGTGGATGAGCAAAATATTTACA TAAAAAAATTGAAAAATTCTCATAGACTGTCAAACCTGCCTAAAACAACA ATACAAAACCAGCCACATGCAAACAACCNAGACATTTAATTTCGCATAAA AGGGTAAAATTCGCGAAAATCGGGAAAGTTTCTACTTGGGAAAGTTTGTA CGCCTAAAGATATCATCTTTAGTATGATCTTAGTATCAACGTCTGGTTTG CGGAATTACATCCGTCTCTTACATCCTTTGCCATGATTTCCAGGTCATGA TTTTTCATGTCATGTCAATGTCTAATTTCTTGCAATTTCGCAATGAAGAG TTATTCTTAAGTTGAACTTTACTTGAATTGATATTTTAGGTATGAGTGTC ATCCTACTGCAGACCCTACAAACGTTGCTGGACCCTGAAAACATGTGTCA AACGGCTAATGTAAGTTCACTGTGTTTATTTTCTGATCTGGCGAAGTCAA TATAATTATCTTGAAGTTAGCGGAATTTGAGGTTTCGAACCATTCTTTTT TCTCTTTTGAGAAGCTTGGAGGGGCTCATTAAACAGCAAGTTGATCTGAT GTAAATAGCCTTATCTGTTCAGCTTTTCTTTGCTTGGTACACCCGAAGGG ATTTCAAAAAGATTTCAAAAAAGGAAAGTTATTTTAGTCTTTTTAAATCT TGTTTTCATTTTCAGAGCACGATTGAACGTTCGGAATTCTTGAGTTTCTT TTATCGTCACAACATGCACGTTCTGACGTCTCCCGTACTTGCTGTTACTG CCACGGATGAACTGGTCGGAAAAGGTATCTTGTCTCTCACTGATTGAGGA GGAAATTTTGATGCCTACTTCGTAATTTTTGATAGGGTATCCAGACTGAA CAAACACCTCAACATACATAGTTCTAAAATAGGCCATTTCACAGTCGAAA TGGATCATCGGTGATCAGGACTGATTGAGCCTCCATAACGGCTTTCTGTT GGCTAGACGCAAAAATATTCAAAAAATTTCAAAACTTTGAACAAATAGTA AGTCATCATTCGCGCGCAGTTGTCCTGATTACTCATTTTGCTTCACGACT ATGAAATGGCCTATTTTAAAGTGGTGAAAAGTCTGATACAGTTTGTTTGA TACTGTGTGTGAGTAAACCCTTGTTGACAAAACCTTAAAACTTTGGAAAT CCAGGTGGATGAGCAAAATATTTACATAAAAAAATTGAAAAATTCTCACA GACTGTCAAACCTGCCTAAAACAACAATACAAAACCAGCCACATGCAAAC AACCTTTTCTTCATTCTTCACAAAAAGTTGTTTGGATGACTCGCCAATTT GCATAAATTATTTGGGCGCTATAAGGTGGCGGGTGGGCGTATGGAAAACC CTCGAAAAAGCTATTGAGCACTTGCATCAACCAATCGCCACATGCACCCT TAGATTCGAATGCAGACGATCTATGTAAATCGGACCGTATACGATAGACG AAAATTAAAAAAAACTAGGCTGTGAAAAAGTTTATGGTCTGGATACCCAG GCTAAATTCATGAGTAAATATTACAAACACCGCCAATTGTTCGCATGGGG ATATGCATTTAAGGTTATTTTTTTAGCCTCATTTGGTTCGTGTTTTGCTA ATTTGGCTGTTAACCTCAATTTCTGACACTTTTCCTCTTAGACGACTTCC AGCGTGCGACAGTGTTTGACAACATTGTGAACTTGTTGACTTTTTGCGTG GAACATCATCAATCTTCTATCAAGAATTACATCGTCAGTAAAGATATGTT ACGCCGTGTTCTCGTTCTTTTACANN
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045595XLOC_045595Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073463-exon-scaffold_92-1575043694:156561..157194TCONS_00073463-exon-scaffold_92-1575043694:156561..157194Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:142628..142683TCONS_00073463-exon-scaffold_92-1575043694:142628..142683Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:142257..142361TCONS_00073463-exon-scaffold_92-1575043694:142257..142361Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:141371..142012TCONS_00073463-exon-scaffold_92-1575043694:141371..142012Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:141150..141227TCONS_00073463-exon-scaffold_92-1575043694:141150..141227Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:140841..140957TCONS_00073463-exon-scaffold_92-1575043694:140841..140957Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:140506..140625TCONS_00073463-exon-scaffold_92-1575043694:140506..140625Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:140138..140192TCONS_00073463-exon-scaffold_92-1575043694:140138..140192Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:138285..138355TCONS_00073463-exon-scaffold_92-1575043694:138285..138355Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:137921..138029TCONS_00073463-exon-scaffold_92-1575043694:137921..138029Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1575043694:136919..137053TCONS_00073463-exon-scaffold_92-1575043694:136919..137053Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:156561..157194TCONS_00073463-exon-scaffold_92-1510915933:156561..157194Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:142628..142683TCONS_00073463-exon-scaffold_92-1510915933:142628..142683Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:142257..142361TCONS_00073463-exon-scaffold_92-1510915933:142257..142361Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:141371..142012TCONS_00073463-exon-scaffold_92-1510915933:141371..142012Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:141150..141227TCONS_00073463-exon-scaffold_92-1510915933:141150..141227Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:140841..140957TCONS_00073463-exon-scaffold_92-1510915933:140841..140957Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:140506..140625TCONS_00073463-exon-scaffold_92-1510915933:140506..140625Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:140138..140192TCONS_00073463-exon-scaffold_92-1510915933:140138..140192Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:138285..138355TCONS_00073463-exon-scaffold_92-1510915933:138285..138355Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:137921..138029TCONS_00073463-exon-scaffold_92-1510915933:137921..138029Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1510915933:136919..137053TCONS_00073463-exon-scaffold_92-1510915933:136919..137053Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:156561..157194TCONS_00073463-exon-scaffold_92-1491911889:156561..157194Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:142628..142683TCONS_00073463-exon-scaffold_92-1491911889:142628..142683Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:142257..142361TCONS_00073463-exon-scaffold_92-1491911889:142257..142361Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:141371..142012TCONS_00073463-exon-scaffold_92-1491911889:141371..142012Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:141150..141227TCONS_00073463-exon-scaffold_92-1491911889:141150..141227Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:140841..140957TCONS_00073463-exon-scaffold_92-1491911889:140841..140957Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:140506..140625TCONS_00073463-exon-scaffold_92-1491911889:140506..140625Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:140138..140192TCONS_00073463-exon-scaffold_92-1491911889:140138..140192Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:138285..138355TCONS_00073463-exon-scaffold_92-1491911889:138285..138355Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:137921..138029TCONS_00073463-exon-scaffold_92-1491911889:137921..138029Clytia hemisphaericaexon
TCONS_00073463-exon-scaffold_92-1491911889:136919..137053TCONS_00073463-exon-scaffold_92-1491911889:136919..137053Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_92supercontigscaffold_92:136919..157194 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0 6.03072 6.35408 1.91648 3.94721 0.502461 1.86714 0.604096 1.58844 2.84055 0 0 0 0 0 0 0 0 0 0 0 2.95264 7.42752 0 0 0 0
Blast
BLAST of TCONS_00073463 vs. Swiss-Prot (Human)
Match: P4R3A (Serine/threonine-protein phosphatase 4 regulatory subunit 3A OS=Homo sapiens GN=PPP4R3A PE=1 SV=1)

HSP 1 Score: 427.172 bits (1097), Expect = 5.466e-137
Identity = 236/566 (41.70%), Postives = 353/566 (62.37%), Query Frame = 1
Query:  469 KRVKLYKAQEQESGGEPAWKDLGVGDINIVPNSDSDYFRSNYYGGMIMLMNSEEDGSVIFRNPVSTRVQYQEQGDVIILWTEVDGPKETFALSFMDQENRDDFLTHIEETKLKLERSDKNGDAYKGLDDQDFDMHGQGLGMDLSSEESLAIPPCEFSKLNALNETLQRYLQSKNLHDDLVTLLEAQGYIPKLIEIFHMCEDLENTDALHTLYSIFKTLFMLEKNAIFETMFSQEYILDIVGILEYDPSKTTRTPHREHINDRVQFKEVIPIANKELLAKIHQTFRVQYIKDILIPVPLIFDETG-TTLSSFIFFNKVQIIDLIKEDQHFLDELFEQLTNDEVSDDKRKDIILLLKELCVYSQSLQPARREEFIKMLANIGMLQSIEQLLNIDDKDIQQALIDIVCTITECTPSIIRIYVCREASYTID------------EDTMMLNVMISHLVNCETE---GMSVILLQTLQTLLDPENMCQTANSTIERSEFLSFFYRHNMHVLTSPVLAVTATDELVGKDDFQRATVFDNIVNLLTFCVEHHQSSIKNYIVSKDMLRRVLVLL 2118
            +RVK+Y   E        W D G G ++      S Y       GM +L+ +E DGS++  + ++    YQ+Q D +I+W+E +      ALSF ++   D+    I + + K    D   D     +++ FD        D+SS   L +P CE S+L  + E +   L S    + L   LE +GYI KL+E+FH+CEDLEN + LH LY I K +F+L + A+FE MFS+E I+D++G LEYDP+ +    HRE +    +FKEVIPI++ EL  KIHQT+RVQYI+D+++P P +F+E   +TL SFIFFNKV+I+ +++ED+ FL +LF QLT++   ++KR++++  LKE C +SQ+LQP  R+ F K L+N+G+L ++E +L +DD  ++ A  DI   + E  PS++R +V +EA    D            +D +++N++I H++ C+T+   G +V L+  L+TL+DPENM  TAN T E++EFL FFY+H MHVLT+P+LA T  D+   KDDFQ A +   ++ LLTFCVEHH   IKNYI++KD+LRRVLVL+
Sbjct:    6 RRVKVYTLNEDRQ-----WDDRGTGHVS------SGYVER--LKGMSLLVRAESDGSLLLESKINPNTAYQKQQDTLIVWSEAEN--YDLALSFQEKAGCDEIWEKICQVQGKDPSVDITQDLVDESEEERFD--------DMSSP-GLELPSCELSRLEEIAELVASSLPSPLRREKLALALENEGYIKKLLELFHVCEDLENIEGLHHLYEIIKGIFLLNRTALFEVMFSEECIMDVIGCLEYDPALSQPRKHREFLTKTAKFKEVIPISDPELKQKIHQTYRVQYIQDMVLPTPSVFEENMLSTLHSFIFFNKVEIVGMLQEDEKFLTDLFAQLTDEATDEEKRQELVNFLKEFCAFSQTLQPQNRDAFFKTLSNMGILPALEVILGMDDTQVRSAATDIFSYLVEYNPSMVREFVMQEAQQNDDVSKKLTEQKITSKDILLINLIIEHMI-CDTDPELGGAVQLMGLLRTLVDPENMLATANKT-EKTEFLGFFYKHCMHVLTAPLLANTTEDK-PSKDDFQTAQLLALVLELLTFCVEHHTYHIKNYIINKDILRRVLVLM 544          
The following BLAST results are available for this feature:
BLAST of TCONS_00073463 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
P4R3A5.466e-13741.70Serine/threonine-protein phosphatase 4 regulatory ... [more]
back to top