Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073390 (transcript) - C. hemisphaerica

Unique NameTCONS_00073390
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1431

The following sequences are available for this feature:

transcript sequence

>TCONS_00073390 ID=TCONS_00073390|Name=TCONS_00073390|organism=Clytia hemisphaerica|type=transcript|length=1431bp

protein sequence of TCONS_00073390-protein

>TCONS_00073390-protein ID=TCONS_00073390-protein|Name=TCONS_00073390-protein|organism=Clytia hemisphaerica|type=polypeptide|length=414bp

transcript from alignment at scaffold_91:255692..269355+

Legend: exonfive_prime_UTRCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073390 ID=TCONS_00073390|Name=TCONS_00073390|organism=Clytia hemisphaerica|type=transcript|length=13664bp|location=Sequence derived from alignment at scaffold_91:255692..269355+ (Clytia hemisphaerica)
ttttagagaaaaataaaaccaaattaAGCAAAATTAAAGACAGCTCATTA CAATAAATTCAAGTACTGGATTTTGGGTTGACAGAAAACTCGACGATTTT AGTTTGAAAGACAATCCGGACACAATTCGAAATTGAGTATAAAAGACAAC ATGGTTTTGGAGCTTCAACCTGTTATCCTAGCTGGTGGTGAGGGATCTAA ACTTTTCCCGTTGACTGATACAATACCAAAATGTCTTCTCCCAGTTGGCA ATAAACCTATGATATGGTACCCGGTTCAATTTCTAGAAAAATACGGCTTT CAAGGTTTGTGTTTTCACTTACGTTTTTTTATACAGATAACGCTTATTTA TAAGCTTATAAGCATACGAAGGCTAAGATTTGCAGATTTTCTATGAATAG CAAaagcatacacgcttttttcttataggaatggtgtaaatccatttctt catggatattcttaacttttttggggaaattacCCTAAAGTATTCTTATA GTATTCTTAGATTAGGATCCTATAAgtttcaagcataaaatggcattttt gtgaaaggagggAGCCTTGGGGgtaatttaaaatttataattgaaaatgc tctaaaaatggcattcttagcttgagtagaaAAATTCcgtgatggtgata ttcttagcattattcttaattttttagccattttcatcatgaacattctt ataaagtgtatccttataaaaaagcgtgtatatgcCAGTCTGAAATGTAT TTCAAAGTTGgcaatttttttctgttctaGCACACAGTGCGGTATTTAAA AATATACTCTCCTTTGcttcaaaaaggtttttaagtggtcaagtaaaaaa gaAGACATAATGCGAACCGGATATAGGGGTAGACACTTATTAAGAAGTGC TGGATCGTAATGAACATTTAATTGcccgttagttagttagttagtttaGG TTCCTTTTTGTCCATTAAAGCTGAGATATTTCGACcagtcaaattattca aaacatatTCGTCCTCCATTCACAAGTAGGCTAATAAAAAACAGAGAGGA TGTAATTGCATTTTTGTATTGTTTCCTTTAGACTTCATGGTGATTGTGCG CAAAGCATCAGCGGAGAAGATCCATGAAGCATTGCGAACACATTGTCAAG AAAGTTCCAAATTTCAGATGATTTGTATCGATGATGACGAAGACATTGGA ACAGCAGAAGCAATGGTTTTGATCAAAGATAAAACCAAGGTATACAGTGt gtccaaaaaaaagtataaagtgAAATCTTCAAAACTCATCATCTAAACTG GGCTTTAgaataatgggcttttccagaaaaaaaaccgtgcaccccctgtt gaggatgtCCAACCTTTtatgacctacccccttggaattccaggcactTT TAGGATCATAACCCTCTGGAATTCCAaatgtttacaaattttcaatcatt acccctaGGAATTCCGCtttttttgacggattttcgtctactcTTATGGA ATtaaatttcaaaccttaccctcttggaacggaaatggacctcctcaaca gggggtgcacgatttttttctgcggGAAAAGCCCAATTGAAATGAGATTA AAATTTtctgttcaatcaatagatattcaataCCCAAGATGATTCAATAA GTTTTTGGGATTGAAATAGAAGTAAACAAGCCATGaactttcccaaaaat ttgggccgactataAATTTGGGTCAAATTAAATGTTTATTATTAAGCTTT CCCCttattttccaatattttaagctttctcctattttccatctgcttgt aaatttagaaatggcccaaatttttagtcggtctttATTATTAGTCGGCG CTTAGTGACTAGATTTTGACGAgctgactaaaattagggccaaccaataa ttaaggccgactaagtttcgGCCGATAAAGTGAAAAAGGTTAAACAAGTT AAAAAGGGTTCATTATTTGAGTCCGGGATTGGTCTAAATTTGTTCTTATC TGTCAAAAtagattttcttgtttttatgtGAAATTGTTATTATAATAAGG CGTGTACCTGCGTGTACCCCTATAAACCCTCGACTAAGCTATATAAACCA GCTCTGATCGGATTTTGTTTTAAAGTGGTCTCAAAAAAGCCAATGCAGTG CTAAAACTTTGCCTAACTTTCAACGGCACTACATCACAAGTATtaaagga aaagtagatctagcgctgtATTACACTTCTATTTTGTAATGCTACCATTA AGGTACCACTTTAAAAAAAGATGGCTAAAAAAATGCTTagaaaactggtc aaaataagaatttattaggaacacttttaggcttaaaactcaaaaagtta agaacatccgaaggcttcaaagattttggatgttcttataaaaaacgtgt actggaCTATTGATCAACTctatatttttctatttagaCTGACTTATTGG TGGTGAGTAGTGATATGGTTACAGATCTTGCTTTACATAGGCTGGTTGAT ACGTATCGAACGTACGATGCTACGTTATGCGCCGTCATGGCGAAACGTGT CGACGTACACCCACAAGTCGAACAGactaaatcaaataaaaagagTAAAA TTACAGACCCGAATGTAGGTGAGTCaaagctctctaattcgatcttctag gggaattggattttcattgaataagggagcttatcgaataagggagcgtc gtttatgagagtttcttgtcgaatagtagaacgtcgaattagagagcgtg aACTGTATTTGGCTTTTTTTTCGCCACGGAAAAACACGTGGTGtaatttt caaccaataagatttttttcatttcgaaGAGAAGATTATTAGTTTAAATA AGAGtggtatcgtttgcttactcatcactttttatttaaaagctttttca cattggattgacacgaatgttgagcaagattggtcagaaagaggaaaaga aaaacctttttttgctgatatcagcataacataacaataggcagacactg acCTTAtctgaaatatgtgtctgatatgaaacgggaacacttatgtaaaa acctTTAAGCCCCAAAAGGGGTagaaaggaatcttcaaccCTTCTCAAGC AAGAACGAACTGACGGATTGAATTTAGCTCTTTCTTAATTTTTAAGCAGT GTATTTTCTGAAATCTGGTAATGGGTTTTACTTTCATTCTGGCGTTTTTG TGAAAACCGCGTGGGTTACGCAAATCGATTATCTAATATTCCCATGGCga attggcggccgcccactctaaagctctaaagaagaGTGCCGATTTCCCAT TGAAGAGAAATGATAGTCGGATTCAACTACCATAGTGCgtaaacatgaaa atatttcggttggacccgccaatcctcgaaaacgagggctggatTACCAG GCCTCCCGCTGTAAAATCCTTGACACAGTCTTGCAAAATTCTGTAATATA AActttccagatgttgaaaatttcccCGACCTTCAGAActtttagcgtgt cggatgaaaatttctgcatctgggtgccagataagcaaatcgaacgtttg cttctaTTTTGGCGGAATTTATTACTTAAAAACCTCTATAGCGATTTACT GGTCAACATCATGACATACATATCCTTAATGATTATCGATTTTAGGGACT CGCGATATCGTTTCAATCGATCCGAAAGAAAAccgtttattatttttatc gAACGAAGCAGATTTGGAACAGGAAACGATATCTTTCACTAAATCGCTAC TCAAAAAGTAAGTGAAATACAGATGTTTTGTTTTAGAGCTTTCCAAACAA AATGTCCATACGATATTAGGGTCTTTTAATTATTGTTCgttaatttttga atttagtTTATACACCCGCGATTTTTGCTATTTCTCGCGAAAACGTGTGa gattttgaaactttctgtaattcgaaatgATTCCCAGTTCCTGTCAAAAA CAGATATTGTCTTCAATACGAATACTAGTAATTCTTTCATCCGAACAAAA TTAGAATttccgttcgagttcgaattagcaagaGTTAACTGCAGAGACAA AACTGAAAGTAGGAAGGATAAATTTCGAAAGATTGGAACTCTCtacctct ttaattcgaactgaAGCATTAATTTTCATAGCCCTCTATGATatgagaaa agagaaaattacAGTATGATTGACCAACTTGGTTGTGTAAAAGATTAACT ATCGGCCATTTAAAGTGTACcttaaaaaaccgagttatgtaactcgaaaa tttaatgtGATCCTAAAATGACTGAGTTGTGTAACTCGGAAAATTAAGGT ACACCTGAAAAAACTGAGTTATGATGTTAAAACTCGGGTTttcataactc gggttttcataactcgggttttccagGCCTCCTATGATATGAATCATCCT CTAATTCCAAGAAGTTTTTGTCTCTTTAAGATCGAATAAGATTAAGATAA CCTGATTTCAAATACTTTTTGCTTCCATACTTTTCAGATATCCAAAGATG AAGATACAGAGCTCTTTAGTCGACGCCCATCTATACATCATCAAAAATTG GCTTCTCAGCTATCTCGCTCAAAAACCGTGAGTACACAGAGCTATAGAGC CACAGTTTGATTGTTTCTGCGTTAAAGCCGATCTCCACTTgtgcgcgctg cgatcgcactttctcgagcaaagcttccacgctattggtcaaaagaaaaa tgaaacacttccattggcgcgatctgacgtaacggttgaataaagttgaa atgtatttaacttttttttcgagcgcgcgctacatttttatgacgtaatc ttttttccaagcaataaggattgaagccaaaaggtgtgATCGCATAGCTC ACAAGTATCCAAATAGAAGTCATGTCAGGGCCAAAATAAAGTGTTATGAC TCCTAGCAGCTGAACGCAACTATTTTTTTGTGTGTCATGGAACGACCCTG CCTTCTTATCATTTTTCCTAAAGTTGTCAACTGGccgtgattttattttt aagccGCATTTGAAAAACGGCTTTTTCAATAGCATACCgtcgcgaatcta aaaatagacattgatttttatgtttgactgaaattcaatcccatcaccct ttgcgtttattacgcttgcacgcaaattacactcaattacaaagagcaag taataactttcacgacttttgaaataagacgaaaaggattgtgggattga atttcggtcaaatgagagaagtaataatcatGTTTCATGTTTCATTTGCA CGAcgaaattttaattctaaaaaccccaaaataagttaaaatcaggcttt atagagcaaaataaggaacCTTCCTTCCCTCtgtcagctgaaaatatttt tacaaattaataaacgatggggggtcctaataaggtccgggggttggaaG ATTTTCGTTTTGGAGCAATCTNtatttaaaatataaagcactgaggatcc ttcacttgcgatcggagtgatctgaggatttaaaaattgatacgaaaatt gatgtcatgtagtcatacgcgaagtttgaattttgaaagtggttgagcga tatataggaacttagtcgaccgcgcgcacattataccaAAGGAGTAATAA TCATGACGTTTGCACGACGAAGCGCTATTGATCTGATCTTTTGTCGTATA CCATCCTCTTAGTTTAATTTTAAAGTTGATGATCTCTAATTCCACGCTCT AGTTTTCGAACTTTTCGATATGCTCCATTATTCCATAATACTAAAAGTCA CCGTTTACTAACTCTTATACAATGTGTCCCATATAAACTATTAAGTAAAA CACTTATGAtttatgcaaaatattatgacttgtatactcaatatattttc tctttttttcaaccaatcagaaaagttctttatttagTTTTGGTTGATTC GAAGTAATGCTTAACCATCTCCCTCAGTGTTTCTTGCTAATTCTTTTATA AGCAGACAAAACatcatctttttttataaggaaccttaacctTCTTAACT Ttcctctgagcctggagttccttatttttacagagaatttcagcctcaaa gttcctcaTCGAGtcccttatttacatagctgctaagtttggattcacaa aaattggattccttaaaacttgttttcttattctcagcctgagcagttcc ttaacaattccttattttttggaccattttcagcctcgagttccttataa acgtgtaccttataaaaaaaaaaacgtgtatttcaatCGCAAAAACCTAT TTAATCATTTCGGGAATTGATTATCTATTGATTAAACAGGGATTTTTATC TTACTTCAATTATTCTAAACACAGTTTAGAaaatgagttttgaggatttt actttatatagaAGTTACCCTATTTTCTCTATCCAGTCACAactatacag tgtgtcccaaaaaaagcaaaaaacttttatagaaagtaaaatcctcatga TTTAAGCGATATCTTATGACTTGCATACTATTTCAATCTTCAAAagcttt tcaattattttgggAGTTGAATATCTCTATCGATTGTACAGAGAATTTTT AGTCTTACTTCAATTATTCTAAGcacaatttagaaaatgagttttgagga ttttactttataccTACCAAAATGTGTctgctttttttgggacatacTGC AGACTTCCCTtttaaaatcgaattagagagtgtcaactgtattaTATAAA ATCTTTTCATCTTATAGAAAATACGAAAGCCTCAAGTCAGATTTCATACC TCACGTTATtcacaaacaattttcaaaaccaaaagTGCAGAGTCAGCAAA TTCAAGATTCAATACTTGAAGAGGAGAATGAAGGCGGCGAAAAAACGGAC AAAAGCGCTAAAGGTAATCCTTTCTCTTGACGCTTAGGGGTGGTGCCATT TTGGTCAGTTATTTTCTTTTCCATAagagtttttaaatatttcctttcca gaaggaaatatttgttaaaacggtaatttttcttctccttcttcttctcc tccttctccaagtctaacgctcggttttggtcaatttcgtgagtttgtac atgagtctctttttaaatcaagctccggcggtacaaacagtaggatgttc tttttttcgaggcggaagacgtcattttttcAAGACACGTCGTAGGAAAT ATGCTTACGGTGTTCTATTCTCCTTGCCGATCGGAAAACGTCGCCCGGTC cgaaagcgtattgttgatcggaccatactgctttttaacagtcataacaa agatggaggcaaaaaatagacaacaaatgttgctctttcgctatttttct ttggtttttatgctttcatGAGTTGAGTTGGATCAtgttttttgtacgat tgtctggatttgatgtttcgtttacatactCTTGGTGTGAGAGATACAAT CTCTTATCTTGATGCTcatggaaaaacaggacattttgtcaactttcaca acaagcaacttcaattttgcctgtatatttacCTAAAGTGGCTGTGGaca aatctgaccatgttatacctgaaaaaaaaatacttgcggcatcaaaaaag tttgaactcacttttatgGTATGCGCAATGGTCAGATGGCGATGGTTATG GTGATGAACTATGATTTAGCTAGCTTTGagctaaaattttaaacatggag caaaattgactggttaatgattgaatttccctttgtgtttttatctacaa caatgaattaactggttagtgacagttagtgaaaactctCTTTGTGGGGA AAATTCTGTTGCGGTTCACAGAACTGTGATTTCAAACTTTTTAAGCTGAT ATAACCGGAACACCTTGgccaatatgaagaatgttaactcttaaaatttt gattgtattgAATATGGAATTAAACAATTGGAATCATTGTCTTGAACTTg gtacttggagattttcttgcCCGTGCATTtataatgtggaaaactttatT TGGTCGTGGAGATtttttccacgtgcgttttaaacgtggaaacttttgtt aGTCCGGGAGCTaaacccaaaaaatggcattttgcttaacccaagattct acaggataaactatacatttttggaatcctcaactatcctagttttggaa atggtcggtccccaaagctaactcctggtcaatttctcatactgggcccg agtttagggggtactttttatcctttgtaaggatttgttaaggaaaatgc cattccagggatgatataatttgcttatctagtcaatcagttaaccaatt gctttgaaactttgcaaaaagtttcaaggtaggctgatgattattttcgg caaaaaatttttgtgaaaagNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNttatttcagg gctgcagggggtaaaattgcccatttttatgggtttttaccttatttgag caattttcaccactaatcttggttaaaacgtcatcaaaaatagctttaac ttgattttcgtgtaatatatcctgaaagattacaatgctgacttaaaact aacaaaaccagggtgcaaatggacaaaccagcTGGTAAAAATNNNTTATT TCTGACCACTcattttgtagtaggagcaatgggaaagttatttgtggttt tcattgtctgtaatcagggtcactgtgggcaaatcaANNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA AAacttaagttatggccaaattataacatttttttgacgtaattttgtca gtttttgctttgagattccactatattgctattcagagcttcccaaaatt gtaatctttcaggatatattacacgaaaatcaagtttaaactatttttga tgacgttttaaccaagattagtgttgaaaattgctcaaataaggaaaaaa cccataaaaatgggcaattttaccccctgcagccctgaaataatactaaa tactgtttgtttgaaatttNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNggtaggtcccagacttaaaaagggtca aaatttagttaaaatacccaaattttccctctttttccccaggcaaacct ataaaaataatcatcagcctaccttgaaactttttgcaaagtttcaaagc aattggtcaactgattgactaaatacagcaaattatatcatccctggaaa ggcattttccttaacaaatccttacaaagggtataAGTACCCCCTAcact cgggcccagtatgaaaaattgaccaggagttagctttggggaccgaccat ttcttaaactaggatagttgaggattccaaaaatatatagtttatcctgt agaatcttgggttaagcaaaagtgcttatttaaggagatataggatttgg ctcccggactatgttgtgaatttggagattttcttctccgtgcatttaaa acgtggaaaactttggttgtgaatttttagattgttttccacgtgcgttt taaaggcaaaaggttgaaacttttgttataaatttggagatttcttacat gtGCATTTAAacgatggaaaacttttgttatgaatttattttcttcaata cGCGttgaaaatgtggaaaactttataaatttggagatttcttacacgtg catttaaaagatggaaaacatttgttatgaatatatattttcttcaatgt gcgtttaaaacttgacattttcttccacatatgcatttaaaaaatgaaga aaactttggtgtcaattgacaattttttaaagtgatttcctggcctggca tgacaacttttttcctttttgtcattctttcatttcagataTTTCCCCTT TTCGGTATTTCTGGTAATAGGCGCTTAAAATAAAATGATATAATTATGCA CTATCCCAAGGCCTTTTGATGTGTTCAATAACACAACACTCTACTcagcg ggtgcgacgccgggtgacggctagtataatactaaaatccaacTAAAGTc cacctactctcgggtacctaatagccgggggggatTGGagtaaaaatgtc ctgggtggcaaatttttttaaaaggaggctaatacagcagaattgggaca aaaaagggaactttcaaaaacatttcccaaaaattaataagcgggggggg gttggaataagaatgtcctgggtgaaaaatcttcgaaaaattaattagcg gggggtggctattaggtacccgagagtaaagaAAATTAAAGGTTGTCTAG CTAATTTGGTTACTGCATTGTTATTCTCAGTCGAGTTCAGCTCGGATATA CTCCGTAATCCGTAGGTTTGAACCTTCGTCATCTTAGGAATAATCCTGCA AATACTAGCAATTACATAAACGAATTTTGAGATTCTtggggacttgtgtt gcttgatgttatctgagataaagcactttgaaatcttttgaggacatcaa taaatattttatcatttgtaaaggaaatatttatccgcatctttgcggct cttgtatttttttttacaagtagacacacttttaagaaacatgaggctca gaatgcctaaaaactaagacacgtctaagaaacatgctgaggctgagaat gagagaatgacatttttaataactgtttttttttctttgcatgaaaaata ggctgattatgtcaaaaagtttagaaacatgtaagaaacatttaaggctc aaaatgccgatttcttaagaaacattgaggctgcttagtaaaactagttt cttaaaaaaaaaacgtgtaggctaCGTCGTATCCGCTCCACTCCGAGTGT AAAACTTCGTGGATGAATAGTCGAATGcagtttcttttcatttttgaaag tttttgattttcacgGCCTGTTGGACGTGATTTTAGAATAGTGCCACGAT TTGTTAACTACGGATAGTTAAATTGAGGTGATTGTGTGTTTGATTATTTG ATTGAAACTAAtgagaatacaccttttcgaccgtagccgccaattgccgc acgggcattttttgtccactttatcccactaaaaccgtcccagtcctttt ttcgcacctatagacaatagaataatgattagaaaaggattggatcgagt ttagtgggATGGTTGAATAATTAAATGGAACGCGCCCGAAGGTGTATTGG ATTTAAACTAAAGAATGAGAAAGAATTAAGGTTACGGAAGGGATCACTAT GATTAAAATTCAATCCTTATTCTATTATTCAGATATTTTTTCCTTCGCAA CGGCAGACGAATTGGTTACCATGACTAAAGAATGGTCTGGTTACCAAGGC AACTGTCTGAAAGATCCAATCAAATGTTACGCTTACGTTTCGGATGATTT TTGCTTGCGTGTTAACACGTTGCCCGCGTACACGTATATAAATCGGCAGg ttagtgtttttatttttcatagcgATTGCCTtactagcctatactagacg tcacggctttttatctacgcagtaacgtctattccaGGTTTTTTCGGGCT Gcaaacatttaatttttttatgtcacttaaaactttcgaagctcctgcag tttACCcaatttacccccactgttgaggatattgatttttcgaagtatcg aactactttattagtaaagacccctggatatccactcttaaaagtATGCT CAACTCCCCGGATAttctctcttataaagatgtttaccccctggatatcg tattttttacttgaaaagacacttaaccccctggatatccgctccctttt agatatttaaccccctggatatccacttttgaacaaaatcgttatccccc tggatatccgatatcctcaacagggggacACTGACTACTtatggaaaagc ccaatacacTTTTTCAAGTCAAGgcttctttttttcgaaaaccaTAAAAA TGGAACTCATTAAGAAACGGAATTAAAAattcccggtttttggtgatgTA CTCGCTAGTATCTTAATaccgaaaaacaaatttaaCTGCGTTATAGGTAA AAAAGTgtttcatgttttgttaaattGCAGAATTATTGCCAAACGTTCAA ACTCTATAGAGATTTGTGAGGTCTGAGGATCTTTCCGACCCCTTACACAA TTCAAACGTTtacttccataatggcggaagttacgtaacttaatAAAACA TGATAAGCCCCTATAGTCATCACAATTCATCAATGTTCTAATTGAACTTT ATTTTGATTATCATCCAGATCGTTAAAATGAAAGACACGCTAGCACCCAA CACCTCATATATCCGCCTACCGCCCTCCGTTGTCCAGGGCGGTAAAACAC AGGtacttttttttcttccaaaaattaattttcattcatttttattGAAC CGCTGATtggttaagaaaaaaatacattaaaagATATTATCCGATATTTG AAGTTTGGGTATCAAGGACTTGACTTTTCATCCAAATTCAGAATATTGAC ATTTTGCTTCGAAACCTTAACATCAACAAggctacacattttttatatat aCATACGGACCAGGTTGCTATGGCCCGAGGGCTCAAATTAgccgattttt ttttcactttcttgtAAAATAAAAGTATTTTAGATAATTTACGCATTGCA AATGACAGCCCTTGACCCACACAATAAGTATAGATGTAGTATAATATATC ATGCAaggcaattttttcagaaaaagagcTAGAATCTTAAGCAGCCTCAG GCCTGACtaaaaaattggagttgctAATAAAAGAATTTGGAATATTTTAT CATCACacgttgttttgattttcagatTGGGAATGATTGTATCATCGGTG ACTCGGCATCATTCGGTACAAACGTCACTATCAAGAAATCGATGGTCGGC AAATCGTGCATCATCGGGTCCAATGTCCGAATCACAAACTCTATTATTAT GAATCATGTGACTATAGCCGACGGGTGAGTGCGTGACGTCAATTTCATCA CGTGATCTTTCGCC

Coding sequence (CDS) from alignment at scaffold_91:255692..269355+

>TCONS_00073390 ID=TCONS_00073390|Name=TCONS_00073390|organism=Clytia hemisphaerica|type=CDS|length=11205bp|location=Sequence derived from alignment at scaffold_91:255692..269355+ (Clytia hemisphaerica)
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045542XLOC_045542Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073390-exon-scaffold_91-1491911889:255692..255995TCONS_00073390-exon-scaffold_91-1491911889:255692..255995Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:255692..255995TCONS_00073390-exon-scaffold_91-1510915933:255692..255995Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:255692..255995TCONS_00073390-exon-scaffold_91-1575043694:255692..255995Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:256773..256930TCONS_00073390-exon-scaffold_91-1491911889:256773..256930Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:256773..256930TCONS_00073390-exon-scaffold_91-1510915933:256773..256930Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:256773..256930TCONS_00073390-exon-scaffold_91-1575043694:256773..256930Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:258129..258309TCONS_00073390-exon-scaffold_91-1491911889:258129..258309Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:258129..258309TCONS_00073390-exon-scaffold_91-1510915933:258129..258309Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:258129..258309TCONS_00073390-exon-scaffold_91-1575043694:258129..258309Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:259337..259448TCONS_00073390-exon-scaffold_91-1491911889:259337..259448Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:259337..259448TCONS_00073390-exon-scaffold_91-1510915933:259337..259448Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:259337..259448TCONS_00073390-exon-scaffold_91-1575043694:259337..259448Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:260179..260268TCONS_00073390-exon-scaffold_91-1491911889:260179..260268Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:260179..260268TCONS_00073390-exon-scaffold_91-1510915933:260179..260268Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:260179..260268TCONS_00073390-exon-scaffold_91-1575043694:260179..260268Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:262409..262554TCONS_00073390-exon-scaffold_91-1491911889:262409..262554Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:262409..262554TCONS_00073390-exon-scaffold_91-1510915933:262409..262554Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:262409..262554TCONS_00073390-exon-scaffold_91-1575043694:262409..262554Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:267624..267790TCONS_00073390-exon-scaffold_91-1491911889:267624..267790Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:267624..267790TCONS_00073390-exon-scaffold_91-1510915933:267624..267790Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:267624..267790TCONS_00073390-exon-scaffold_91-1575043694:267624..267790Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:268610..268693TCONS_00073390-exon-scaffold_91-1491911889:268610..268693Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:268610..268693TCONS_00073390-exon-scaffold_91-1510915933:268610..268693Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:268610..268693TCONS_00073390-exon-scaffold_91-1575043694:268610..268693Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1491911889:269167..269355TCONS_00073390-exon-scaffold_91-1491911889:269167..269355Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1510915933:269167..269355TCONS_00073390-exon-scaffold_91-1510915933:269167..269355Clytia hemisphaericaexon
TCONS_00073390-exon-scaffold_91-1575043694:269167..269355TCONS_00073390-exon-scaffold_91-1575043694:269167..269355Clytia hemisphaericaexon
The following polypeptide feature(s) derives from this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073390-proteinTCONS_00073390-proteinClytia hemisphaericapolypeptide
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_91supercontigscaffold_91:255692..269355 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
26.739 25.1121 9.26993 7.23605 22.3166 17.078 21.7237 23.727 20.4284 22.0613 15.4717 14.869 15.2538 16.7235 19.6014 21.4245 24.5407 25.6672 11.2956 13.6608 14.6527 16.964 30.5918 27.3887 25.4355 24.9539 7.60359 6.03296 18.142 21.176
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
Vocabulary: Biological Process
GO:0009058biosynthetic process
Vocabulary: Molecular Function
GO:0016779nucleotidyltransferase activity
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0009058 biosynthetic process
molecular_function GO:0016779 nucleotidyltransferase activity
BLAST of TCONS_00073390 vs. Swiss-Prot (Human)
Match: EI2BG (Translation initiation factor eIF-2B subunit gamma OS=Homo sapiens GN=EIF2B3 PE=1 SV=1)

HSP 1 Score: 273.092 bits (697), Expect = 2.676e-85
Identity = 152/420 (36.19%), Postives = 241/420 (57.38%), Query Frame = 1
            +E Q V++A G GS++  LT +IPK LLPVGNKP+IWYP+  LE+ GF++ +V+    +   + +AL    +   K  ++CI DD D+GTA+++  I  K KTD+LV+S D++TD+ALH +VD +R YDA+L  +M K  D    V   K  KK+      V  RD + +D    RLLF++NEADL++E +    S+L+K+P+++  + LVDAHLY +K +++ +L +     S++S+ IP+++ KQFS    Q  Q +           +K +  + DI+SF   A    L      W+  +G+  +D     ++CY ++  +  C RV+TL  Y   NRQ+ K+   L P    +     +V   K  +G D +IG     G   +IK+S++G SC+I   V ITN ++MN VT+ +G
The following BLAST results are available for this feature:
BLAST of TCONS_00073390 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
EI2BG2.676e-8536.19Translation initiation factor eIF-2B subunit gamma... [more]
back to top