Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001346 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001346
Unique NameTCONS_00001346
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2189

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001346 ID=TCONS_00001346|Name=TCONS_00001346|organism=Clytia hemisphaerica|type=transcript|length=2189bp
GTGGGCACATAAAGTTGCTGTTCATTTCGGTGGTAATTTTCCCTGTGAGA
TTTGTGGCAAGAAATGTATAACTGGTGCTGAGTTGAGACGTCACATGACA
TCCCATTCGACCGAGCGTCGTTTCGTTTGCCAGTATTGTGGATTAGCCTA
TAAACGATGGTCACACTTGTATCAGCATTTGCGTGTTCACgaagaagaga
aaaatttccGTTGTGATGTTTgtcatttgaatttcaaagtTCAGTCTGAA
TTGAAGGATCATTGTTTTGCTGAGCACTCGGACGGTAAAATGGTCCAGTG
TAGTGTATGTAAACATAAGCTACAAACACCTCTTGCCGTTTATCATCATA
GTATGAAACACACAGGTACTCGTGACTTCATTTGCGAGATTTGTGGCTCG
AATTTCAAACGAAAACAACATCTGGTTACTCACATGAAAACACATTTGAC
GGAAAAGAAAGCAACCGATGGTAGTGAAGAAGTGTATCATTGTCAAGCTT
GCGATGAAAGTTTCACGTTAAAAATGGATCTGAAAGCACATTGCACAGCC
GCACATCCTTTGCTGGGAGACGAGAGCGTAGCTTGTAGAACATGTCAAAA
GAGACTGAAAGTATCACATTCAGTTTATCTACACGGCTTACGTCATTTTG
GTGCACGTGACTTCAAATGTACGTTATGTAACCAGTTCTTTAAAAGGAAA
GCCCATTTATTACGTCATTCATTAGATCGTCATCCAGAACAACCGAGAGA
ACGAAAAAAACGAACAGTCCAAGTCGATGGAATCACATGCGATCTTTGCC
AGAAATCTTTCAAGTACAAGAACGCACTCGTCAAACACATGACAACCCAA
CACGGAATATTACCATCTCAAGACCCAAGTACTGAACTTGGCATTGTCGT
CAAAAAAGGAATCAAACGTCCTCACAAATGTGACGTATGTAGCAAACGTT
TCAAATCCAAAAATGGTCTCGCTAAGCATAAGGTTAATAAACATTCGTTG
GAAAGTGAAAACAGTATTGTGATTCTTGGTGAAGACGGCTCAAAGGATTT
GGAGGAGAAAGGAAACGTTCGCGAAGAAGATGAAGTCGACGATGACGATG
ACGAAGATATCGAAACAGATTCTGAAACTGAAACGCCTCAGATACTGCAA
AACCAAGCTATTGCTGAACCACAATTACTTCAAAACCAATCAGTCGAATT
ATCTTCATCTTCTCGGCAAAAAAGTGAACCCATGGAAGTTGACCAACAAC
AACCAGAGATGGTGGACCATGACGACAATGTGTTACATGAGTTGGATGTT
ACGACAAACAGCGATGATAAGGATGCTACCAATAATTTCCGTGTAGTTCC
TATTGAGCATTTCAATACTTCAACTGGAGCAGGGACTTCCAATGTGGGCT
CATCAGCTGATAACGTACCACACCAAGTAATCACTGTAGACGAAGCTACC
GGTCAAATCATCCTGATGACAACAAATGCACCACCATCCAACCAACAAGA
TGTGAAAGACAACAAAACCGGACCGTCGGATGTGGGTACAAACCAGATTA
TACCTGTCGATGATGCATCCAGAGCCTCACCGATCATCACAGTACGAGAA
TCCGATCAATCAACGAGTGCAGCATTCGAAGGTCAGGCGGTCGATCCTTC
TCAAATCCGGGCACTCACATCGGCAGCCCAACAACAGCAATTAACTACCG
GACAGCTCCAACAAGTACAAATCGGACAGATTTTGAATCAGGATGGAGTC
ACGCTTGCGTCAGTACCAATCCAATCCGTACAAGGAGTAGGTGATGGTCA
GAATATAATCAATTTTTCACAAGGAAGTAATGAACAAATTGTTGTTTTAC
TATCCGCTCTGAACTCTGAGAACATTCAACAAATTCAAtaacatttcaat
ttcatcataatCGTTTAAGACAAAAGGTTTTtctagtttttattttattt
tttgaatacgTATGTTTTAGATATCGATTTCAAACTGAGTTCATTTTCTG
ccattttttaatattgaatgatttttttttctagcCTATAATATGTGCTC
GGAAAAAAAGCGGTACTGATCTGAAAAAAGTAAATTCATCAAATTAGTCC
GTTGTTCAATTTCCAATTTCGAAGTATATCAAGAATAAGTGAACACCTTT
CGTTTATTaaatagatttaaaaattgCGATCAATCTTCC
Run BLAST on NCBI

transcript from alignment at sc0000010:505963..508214+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001346 ID=TCONS_00001346|Name=TCONS_00001346|organism=Clytia hemisphaerica|type=transcript|length=2252bp|location=Sequence derived from alignment at sc0000010:505963..508214+ (Clytia hemisphaerica)
GTGGGCACATAAAGTTGCTGTTCATTTCGGTGGTAATTTTCCCTGTGAGA TTTGTGGCAAGAAATGTATAACTGGTGCTGAGTTGAGACGTCACATGACA TCCCATTCGACCGAGCGTCGTTTCGTTTGCCAGTATTGTGGATTAGCCTA TAAACGATGGTCACACTTGTATCAGCATTTGCGTGTTCACgaagaagaga aaaatttccGTTGTGATGTTTgtcatttgaatttcaaagtTCAGTCTGAA TTGAAGGATCATTGTTTTGCTGAGCACTCGGACGGTAAAATGGTCCAGTG TAGTGTATGTAAACATAAGCTACAAACACCTCTTGCCGTTTATCATCATA GTATGAAACACACAGGTACTCGTGACTTCATTTGCGAGATTTGTGGCTCG AATTTCAAACGAAAACAACATCTGGTTACTCACATGAAAACACATTTGAC GGAAAAGAAAGCAACCGATGGTAGTGAAGAAGTGTATCATTGTCAAGCTT GCGATGAAAGTTTCACGTTAAAAATGGATCTGAAAGCACATTGCACAGCC GCACATCCTTTGCTGGGAGACGAGAGCGTAGCTTGTAGAACATGTCAAAA GAGACTGAAAGTATCACATTCAGTTTATCTACACGGCTTACGTCATTTTG GTGCACGTGACTTCAAATGTACGTTATGTAACCAGTTCTTTAAAAGGAAA GCCCATTTATTACGTCATTCATTAGATCGTCATCCAGAACAACCGAGAGA ACGAAAAAAACGAACAGTCCAAGTCGATGGAATCACATGCGATCTTTGCC AGAAATCTTTCAAGTACAAGAACGCACTCGTCAAACACATGACAACCNCA TGCGATCTTTGCCAGAAATCTTTCAAGTACAAGAACGCACTCGTCAAACA CATGACAACCCAACACGGAATATTACCATCTCAAGACCCAAGTACTGAAC TTGGCATTGTCGTCAAAAAAGGAATCAAACGTCCTCACAAATGTGACGTA TGTAGCAAACGTTTCAAATCCAAAAATGGTCTCGCTAAGCATAAGGTTAA TAAACATTCGTTGGAAAGTGAAAACAGTATTGTGATTCTTGGTGAAGACG GCTCAAAGGATTTGGAGGAGAAAGGAAACGTTCGCGAAGAAGATGAAGTC GACGATGACGATGACGAAGATATCGAAACAGATTCTGAAACTGAAACGCC TCAGATACTGCAAAACCAAGCTATTGCTGAACCACAATTACTTCAAAACC AATCAGTCGAATTATCTTCATCTTCTCGGCAAAAAAGTGAACCCATGGAA GTTGACCAACAACAACCAGAGATGGTGGACCATGACGACAATGTGTTACA TGAGTTGGATGTTACGACAAACAGCGATGATAAGGATGCTACCAATAATT TCCGTGTAGTTCCTATTGAGCATTTCAATACTTCAACTGGAGCAGGGACT TCCAATGTGGGCTCATCAGCTGATAACGTACCACACCAAGTAATCACTGT AGACGAAGCTACCGGTCAAATCATCCTGATGACAACAAATGCACCACCAT CCAACCAACAAGATGTGAAAGACAACAAAACCGGACCGTCGGATGTGGGT ACAAACCAGATTATACCTGTCGATGATGCATCCAGAGCCTCACCGATCAT CACAGTACGAGAATCCGATCAATCAACGAGTGCAGCATTCGAAGGTCAGG CGGTCGATCCTTCTCAAATCCGGGCACTCACATCGGCAGCCCAACAACAG CAATTAACTACCGGACAGCTCCAACAAGTACAAATCGGACAGATTTTGAA TCAGGATGGAGTCACGCTTGCGTCAGTACCAATCCAATCCGTACAAGGAG TAGGTGATGGTCAGAATATAATCAATTTTTCACAAGGAAGTAATGAACAA ATTGTTGTTTTACTATCCGCTCTGAACTCTGAGAACATTCAACAAATTCA AtaacatttcaatttcatcataatCGTTTAAGACAAAAGGTTTTtctagt ttttattttattttttgaatacgTATGTTTTAGATATCGATTTCAAACTG AGTTCATTTTCTGccattttttaatattgaatgatttttttttctagcCT ATAATATGTGCTCGGAAAAAAAGCGGTACTGATCTGAAAAAAGTAAATTC ATCAAATTAGTCCGTTGTTCAATTTCCAATTTCGAAGTATATCAAGAATA AGTGAACACCTTTCGTTTATTaaatagatttaaaaattgCGATCAATCTT CC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000726XLOC_000726Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001346-exon-sc0000010-1491911889:505963..506748TCONS_00001346-exon-sc0000010-1491911889:505963..506748Clytia hemisphaericaexon
TCONS_00001346-exon-sc0000010-1510915933:505963..506748TCONS_00001346-exon-sc0000010-1510915933:505963..506748Clytia hemisphaericaexon
TCONS_00001346-exon-sc0000010-1575043694:505963..506748TCONS_00001346-exon-sc0000010-1575043694:505963..506748Clytia hemisphaericaexon
TCONS_00001346-exon-sc0000010-1491911889:506812..508214TCONS_00001346-exon-sc0000010-1491911889:506812..508214Clytia hemisphaericaexon
TCONS_00001346-exon-sc0000010-1510915933:506812..508214TCONS_00001346-exon-sc0000010-1510915933:506812..508214Clytia hemisphaericaexon
TCONS_00001346-exon-sc0000010-1575043694:506812..508214TCONS_00001346-exon-sc0000010-1575043694:506812..508214Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000010supercontigsc0000010:505963..508214 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
9.31706 9.80497 4.50776 3.61995 0.00577759 0.161674 4.82362e-07 1.77036e-05 0.313456 0 2.69387 8.13094e-07 0 0 2.42044 0 1.85039 1.2312e-08 1.49484 0.0906143 1.08526 2.12712 5.96346 4.20145 1.067e-09 0 0.000396749 2.41719 5.29628 3.76781
Blast
BLAST of TCONS_00001346 vs. Swiss-Prot (Human)
Match: ZFP90 (Zinc finger protein 90 homolog OS=Homo sapiens GN=ZFP90 PE=1 SV=2)

HSP 1 Score: 137.887 bits (346), Expect = 8.886e-34
Identity = 101/362 (27.90%), Postives = 150/362 (41.44%), Query Frame = 2
Query:   38 FPCEICGKKCITGAELRRHMTSHSTERRFVCQYCGLAYKRWSHLYQHLRVHEEEKNFRCDVCHLNFKVQSELKDHCFAEHSDGKMVQCSVCKHKLQTPLAVYHHSMKHTGTRDFICEICGSNFKRKQHLVTHMKTH--------------------LTEKKATDGSEEVYHCQACDESFTLKMDLKAHC---TAAHPL-------------LGDESVACRTCQKRLKVSHSVYLHGLRHFGARDFKCTLCNQFFKRKAHLLRHSLDRHPEQPRERKKRTVQVDGITCDLCQKSFKYKNALVKHMTTQHGILPSQDPSTELGIVVKKGI-----------KRPHKCDVCSKRFKSKNGLAKHK 982
            F C +CGK     + L +H  +H+ E+ + C  CG A++R S L QH R+H  EK +RC++C  +F+  + L  H    HS  K  QC  C        ++  H   HTG + F C ICG  F +   L  HM+ H                    LT+ ++T    + YHC  C E F+   D   H    TA +P               G++   C  C K  K S S   H   H G + ++C  C + F R++ L +H      E+P E            C  C K+F   ++L++H  T  G  P +    E G   +K             ++P+ C  C K F   + L KH+
Sbjct:  282 FECNVCGKAFRHSSSLGQHENAHTGEKPYQCSLCGKAFQRSSSLVQHQRIHTGEKPYRCNLCGRSFRHGTSLTQH-EVTHSGEKPFQCKECGKAFSRCSSLVQHERTHTGEKPFECSICGRAFGQSPSLYKHMRIHKRGKPYQSSNYSIDFKHSTSLTQDESTLTEVKSYHCNDCGEDFSHITDFTDHQRIHTAENPYDCEQAFSQQAISHPGEKPYQCNVCGKAFKRSTSFIEHHRIHTGEKPYECNECGEAFSRRSSLTQHERTHTGEKPYE------------CIDCGKAFSQSSSLIQHERTHTGEKPYE--CNECGRAFRKKTNLHDHQRIHTGEKPYSCKECGKNFSRSSALTKHQ 628          
The following BLAST results are available for this feature:
BLAST of TCONS_00001346 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
ZFP908.886e-3427.90Zinc finger protein 90 homolog OS=Homo sapiens GN=... [more]
back to top