Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_045848 (gene) - C. hemisphaerica

Overview
NameXLOC_045848
Unique NameXLOC_045848
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at scaffold_98:196520..219918-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_045848 ID=XLOC_045848|Name=XLOC_045848|organism=Clytia hemisphaerica|type=gene|length=23399bp|location=Sequence derived from alignment at scaffold_98:196520..219918- (Clytia hemisphaerica)
CGAAAACAACTTTTTCAAAATGGTAGAGCAAAGCTGCGAGGTACAAGCTT CTCCGGCGAGAACGTGACCGAAGGAAAAGATCTTTCCAGATCTTTCCATT AAATGCTGGGTATTTCCAAATATTTACCAGGACAGCAATCTCTCACAATG CCTACATTTATGTAGTCAATACTCCATTCCATTCCAAGTAGCCTTTTCTA TTTAACTATTTCTATTATTTGTATTTGGTTGAGTTTGAGTTACAGGAAGC TTCTCTTTCAGGCCCATTTTCGCAACTATAGACGCTTTCAATTAGTGCCC CGTCAGCACCTTGAACTGACTTCCCAATTCCCCTGACATGGCATGGGTTC AACCAGGCAAAGCTTCATTCACTTACCAAGTGAACCGCTGCAAGTGGGGG AATCGAACCTCGCGTCCTCAGCAGTCGCCTGTGCAGCAACTAAGTCCAAG CCAAGGTCAATGATCACTATATCACGGCGCCTTTAGCAGTAGTTTTTGCG TAATAGACTGCTCTGGGTACAATGTTAGGTTGGATAGTTAAAACCTGGTA AACAGACCTTCTTTTCGCCTTTCCATCCGCCATATTGAATAGACCTTTTT TCAAAGAGGACGTCCTGTTGAATAATTATGTAGTCCAGCCATAAAAACAA TGATAGAGCCATGCATAATTACTGTATCATGCATNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNTGCATATTGTAATAATTATGCATGGTTTTAT CATTGTTTTTCTGCTGGACTACATAATTATTCAACAGGGTGGCCTCTTTG AAAAAAGGTCTATTGTATGCAAAAATGGGCTCTTCCAGTTAAAGTCCGTT ATAGGGGGGTGGACGACAGCGGAATTCCGAGGCAAAATGTTTTTTTGAAA TTCCTGGATTTCCAATACAAAAGCAATTGAAACTCCTGGATTTCCGATAC AAAATCAATTTTTTGGTGGAAAAATCTGGAATTTCTGATACCTTTTTCAA AACTTTGACAAATTACGTGGAATTTCCAAGGGTTGAAATAAAAAATTGAG CAGAATTTCCGAAGCACTTTGAAAAATTGACTGGATTTCCGAGTGCTTTT TTTATCTGAAAATTCCCGTCATCCACCCCCTATATCAAATTTTTTCTGGA AGAGCCCAATTATGGTGGCCGAATTGCCGTGGTGAAATTCCCTTAGAAAG TATGCAAAACATATGCAAAAAGAAAGTATTAATATAAAACTTACCGTGAG TGGTCAATGAATGTGATAAAAAAGTGTGAGTTGTAAAAGTAATTACCTCT ATTATTCTGAATCCGTTGCTTGTGTTTAAAACGTTAACAATTTTGTAATG AAAAATTATGTTTTGTATAAGAAGCAACTAATGTTTTGGTTCAATTGGTT CAGTGTATCAAATCTCTCAGTTTAGTTGACACTTTGGTATCTTTGTTGCG TCACAGCGAAAGGTTTGTTTTTATTTCAGGTTGTATCTTTGAAAGACCCC ATCGGATTTAGGCAGGGCTGTCGGATTTAGGAGCACTCACGGTACATGCA TAATTGGCATTATATTAAAGTGTAATCTTGTAGAAGAAAGATTAAATTTG CTTCTTTTGAAAACTACAAATAATCAAATTCGCTCATCTCTTAGAACAAG CACTTCAAAAAACCATAACATTAGACATAAACTCAAGCTGAAAAATCACC CGCGAAGGTACAAAATTATCCTTATTCGACTGACGCTAAATTATTCTCCT GGGAATAGAACCGTCAGACAATCAAATCAAAACATTGATCTGAACCCTCT GAATGTGTGACGTCATAATCACTGCTTTCAGTTTGCGTGTTTTGAAAGTT TGATGTGTGTACTCCGTCTTGGTCAAATTTTTTAATGGCAGGAAAACAGA ATATGCAATGTCTTTAAGAACAAATTTCTAAAAGGCTTTTGTTGTTCTGT AAATATTTCTTTTTGGATTAAGAAATTCCATCTTTTATTGTTCTAATGAT TATGATATTTCTTTATAAGATGGTTTGTTGTCTTTTTAATCTTTGTGTAA ACTTGCATATGTTTTGCATATTTTCCAACTAAATCCAACCACGGCTTTTT CGTTCCTCTATTTTTGCATACAATTCAAGATGGCGGGTGGAAAGGCGAAA AGGTCTATTGTGCGACGTCGTCATTTTCAACCATGATCAGCCATTTACCT AAGAAATTGTAGAAAGGTTGTAGGTACAGCTACAGGACAGGATGATCTAG TAACACTGCTGTTATGGTTTGCTGAACCATTTCAATTTTTGATTGCAATG TTTCATTTTCCGTTCGATCCCAAATGTGGAAGCATACCCTACTCTAGAGT GGGTCTGATAAAGATTTTGTAGCACTTGAGTCGTGTTTCTGAGTCACTTT TCACCAAGTTTCTTTGTGTCATTTGCTTTAGCTCATATTATATTAGAAAT ATGAGTATATATTCCATTTCAAATCCATGGTTACACCAAGATATTTCGTC TTTTTTGCTATCTCAAGCTGTTGTCCGTGTATCTCGTATTTTGAATCAAT TATATTTCGTTTATTTGTCAGTGAAGCTGGAACTTTGATTTTTGAGGATT ACGATTTTACCAGCTTCACAGGATCGATTCTCAACAACAAAATACATCTT TTGGTCTTTGGGTATGGTTCTGACGTTTTTTCTTCAAAGGATATTGATCA CTTTCCTTTTCCTCTTGAGCGCGCAAGAAAAAAAAGAGTAGCCCGCATTA TTGCGCGGACGAATAAAGATGAGACGGCAACCTTGCACTGAGGGTGCTAC TTAGTTTCCGCCCTATTTTGCGCCCACGATAGAATGGTCCAAATACGGGG GTATTCCAAATGATAAACAATGTTGTTCTAAGTATTTATTTTCTGAGAGA TGCAAATAGTATTATTGAATATTATTAACTTATTTATTTAAGTATTTTTG AGCGCAAATTTAAATACATGTGGTTAAATAGAAAGCAAATGATAGCAGTT CTGTTTATTCCTCAAACCCCTGGAAAAAGTTTTTTTCCTGACTTTTTTAC AAATCTCGGAAAAGAACTCCCATAGGAATTCCAATACACAACCCGATTAG TTAATTTCAGAACAGCTTCAAGAAAGTCATAATGGCAGATAATTTTGAAA GTTTGTTGATGGCTTGTTGATTCTTTAAAGAAAAAAGATAATGTATAGCT TTTTCTAATCCTGGAATATCAAGGTTCCAGCTGCACTGCTTGTTATCCTT AAAATCTTACACTTACACTTAAGGAACACAAGATGGTGCAGTTTGAGGAC ATAGACCTTGTATGTTCATGATAATAATTCATTTGTCTTTGACAAAACTG CTGTTGCCCGAGACAAAATAATCTATCCTGTTTGTATTCACAGGAAAAAT TTTTCGATTTCCACGGTTGGAAATTTCAAGTTTTCTTAGTTGGAAAAAAG ATAAAATCCAATGGAAAACCCAACCTGAAAATGTGGGACATTCTCCAAGG TTGGAAATTTTGCATTTTCCATGGCTTGGAATTTTCGTAAATCCAGGTTG AAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTTTTAAAATTCAGTTGGA AAAAAGCCAAAATCCAAATTTAACAAGGTTGCAATTTTCAAAAATCCAGG TGGAAAAAAGCCAAAATCCAAACCAAACAAGGTTGGAATTTTCGAAAATC TAGGTTGAAAAAAGCCCGAAATACAAGGTGGTTGGAAATTTCGAAAAATC CAGGTGGAAAAAAGCCGAAATACAAGGTTGGAATTTTTGTAAATTCAGTT GGAAAAAAGCCAAAATCCAAGCTAAACAAGGTTGGAAATTTCGAAAATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA CCTATGGGTAATTTACGTTTTCCAAATCAGCTTAAGGTAATCGCTCAAAT TTCCAACCTTCAATTATAAAACCAAAATTTCCAACCCAAAAATATTGGAT TTCCAACCTTGGAAATCGAAAATTTTTTCCTGTGATTGGCTGCCGGGGAA AGTAATTTGACATGGTTTCACCCCCCCTTAGAAATCTGAAGTGAAGGGCA CCTAAGGCCAGGTTAGGGGCTGGGGGCTAATATTTTGCAATTCTTTGAGG TTACTTATTCATTGTGGTGGGGTACCTAGCTGTTTTGACGGAGGCTCTGG GGACTGTGTATATTTTCCAAATTAAATATTTCAAAATGTTTCAAATTATT GAATTTTTTTAGCCCAGCGCCCAGTTCCCCATCCAATTTTGATTCTCGTT TCTTTCCACGTCATCTTTTGCTATATCTTTCAAATGTGATTGTTTTGATT TACAGCCCTCATCTTTATAGCATAATATAATACTGTATAATAACAAAACA CCCAAAAAAATCATTAAGATTTTCGGAATGATAAAAAAAAAAAAATTGTG TCAAATCAAAAAAATTATCGACTGAATGGGGGTACCTAACTCAAAGCAAT TTCTTAAAAGAAAAGTGGACTGAGACCATGATTAAATAGACTGCAGGGAT CTCTTAGGTCTATTTGTTAACAATCTGATTTCTGGTTGCTAACATCTGCA GAAAAATGTCTGGAATTTTGCATAAGTCTTGAAAAACGTCTGGAAAGTTG GGAAATAATTCTGCAAATAGCGTAATTGGCTGGGAAAAGTTTAGAAATGG AGATTCCATTCTGGAAAAATAGTCAAAATATATAGTCTATTTTCAGTCTT CACAAAAAATGCATCCATCTATCTGTCTATCCATCTATCTGTCTATCTAT CTATATCTATATATTGACTTGACAAAGACAAACGTCGAAATATTGTACAC GTGTGTGTGTTTTTTCTGTGAAGCTATCTATATATTTAAGTAGCATTAAA TAAACATGTTTGTGAATGTTCATTATCACTACATAACTACTTTTTTTTAG CACTCAATTAAATTATCATAGATTTTTATGTAGTGATCTACATAAAAATC TATGATGATAATTTAATTAAGTGCTAAAAAATTGGGAGTATCAGCTAAGA TTCCATAGACATTTTGCTAATGAGGATGTCATGTTAAACAATTAAACTGA AATTATTAAATTATTAAGCTAAAATAATGACACATTTTTTATTAATGCAT AATTATTAAAAGCGCGCACTAATTTCTCTAAGCTTAGGGTGGTGCATTCT GTGAGGTTTGCATTCAAAGTAAAAGAAGAGTAGATTGTTTGCTACGATTG AATGAAAAACTTGAGTAGTGTAGTTCAGTAGTTTCAACTACTAAATAGAG ATTGAAATCAAAATATACTAATTAATCATCTGAGAATTAAAACCCATTTA TTTTGATCATTTGACTTTCTTTATAGATATGGAAAATTTGAACATTATTT TTTTATTGGTCATTTTGCTCTTTGATAAGCAAGAATGTGCTCCATCAGAT GTGTATGACGAGGAGCTGTCAATCAAGCAATTACAAAGTGGTCATGTTTA TTCCCAATTTCAATTTGTTACAACATGGAACGTCAATGTGTTTGAGCAAC AAATTCGTAAGTACTCAGGTCACAAATACCTAATTTCCCTGACCCCCTAA TATGTCCCAATCTCATTGAACAACAAACAAAAAGTAATGTTCATTTTAGA CGTTCAGTAATTTTGTTTTTTCAACAATATACAATTAATACCGGGTGGCC CACAAAAGAGTATAAGAGTTTGGAGGGTAACTGTGTCCGAAAAAAATTGA ATTTTAACTAAATTCTTTTTTCGTGGTAAAGAGGAAAGGCAAACTTAAAT GTTGATGTATCATTTTTTAATTTTGGAAAATTAGTTATCGAGATATGGAG GTTTAGTTTAAAGTCAAAAGTCATTATAAAAAACAGTTAAAAAACGTCAA AAAAGACAGTATCAAATTTGTATCAGAACAAACATCTTTCTTTTGATCAT TTGCTATTTCTTTGTCTTAAATGTTTCGTTAAGAAAAAAATAAGTAATAT CGAATTTTGGACAATTCCCAAATCGTCCTTTTGGAAATAAATAAAAAGTA CCAAAAGTAGCAAAAAGAATTTTCAACCTTTGTCATCCTTTTCTGAATCC TTCCGGTAAAAGAAATCAAAATATGCTTCTCACTCGATGTCTCTTTTTAT TTGTTAATTAATTAATTTGATACTGTCTTTTTTGATGTTTTTTGACTTTT GACTTTATACCTCCATATCTCGATAACTACTTTTCCAAAATTAAAAAATG ATACATCAAAATTTAAGTTTACCTTTCCTCTTTACCATGAAAAAATAATT TAGTTAAAATTTAATTTTTTTTCGGACACAGTTACCCTCCAAACTCTAAT ACTTTTTCGTGGGTCACCCGGTACATCTTCTTGAAGTCAATATTGTCATC TGCTTTTTAAGTTCTCTCTAACATTTCAAATTGTTTGAATTTGAAGTTGT TTCTAATTTGATCATGTTGATGTAACTGGGGCCTTATTTGACCTGTCTCT GTTTTCTTTGCAGCTCCACATTACAACTTCTTTCCAAAGTCTTTTGGTGA GATCCTCAGCAAATTTGGCATTGTAGAATTACATTTCTCGATGACACAAG GTCGATGGAGGCACAATAAATGGGGATATCCCTTGGATAGCGCACCGACG GGTGTTGAACTGTGGGTCTGGTTCCACCCCAATCTAAACTCAAGTGTGTA AGTTGTGAAATTTTTTCAATAATGAATAGAACAACGAACCCTTTCACACC CCAGAAATAAAAAATCCACTTGTTTCGAAAAACTCGTCCCTTCTTTAGTG TAAACTATATCAACACAAAATTGAATACAAGATCAAGCAATGAAGGTCTA CATCGTGCCCGTGCAGAAACTGCCGGACCTATATTGACGATGTCAGATTT TTGTAATCACCTTACAAATTTTAAGGTAGTATAGACTTTTTTTTAGCTGT TCTTACTACCCGTTCGTCAACATGAAATAAACTAGCACATACTTATTGTT TCATAGCGTTGATAAAAACTGGTCTGGATTAGTTCACTCACTTTCTGGCC AATTCTGCTCCTCCATCAATTTCATCAGTAAAGCAGAAACTACATCGCCA GAATTTTCGTTCAAACCACTGGGTGTGTGGCCTGAAGATACATTATCACC TCGACAACACCTCAGATATGCCACCATCCCCAGGGAAACAGTGTGCACAG AAAATTTGACACCATGGAAGAAGATGTTGCCTTGTGGTAACAGTGGTGGC GTAAGGCTCTTATTTTGTTTAGTTTCCTTGTTGCTGTTTTGTCTTTGTCC AGTTCCTTTCTTTTCCTCCCTTCAGAATAAGTTTACATATGTTAGAAAAT CAAGTTTTCTCAAATAAGATTTGGTTATGCTTCCCTTATTCCTTTATACT GTTTATGTATGTATAAACTTGGATCAAAATTTGGTGAGTTTGAATTACTC TTTTTTTTCAGGTGGGACTAGCAAGCTTGTTGAATGCAGTGAAGTTATAT GACTCTTCTTATCATTCGCTAGCTGTTCACCTTAGGTCTGTCTGTCAGGT AAGATTTATTGACATTTGATGCACGCTTTTACAATGTTTTCACAAATGCT GGTCAGTTTCAAGAAAAGCTGTTAGCTAAATGAAAAGATCTGAAACAAGG AAATGAGACAAGAATTGATCTTTACCGATGGACATTAAGAGCCAGTTTTT TTAAGAATGGGGCAGTTTGGGGCAGTTCCAATAGTTTGAAACTTAGATTT TTTTCATTTTTGGATATGTTGTTAAGTACAATGAACTGNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTCA GTTCATTGTACTTAACAACATATCCAAAAATGAAAAAAATCTAAGTTTCA AACTATTGGACCTGCCCCGCTCTTAAAAAAACTGGCTCTTAAGATGTTAC TTACCTTCTAAACTTCTTTCATAAGAACTCTAAGAAACCTTAAAGCATTC GGACCTTTTAAATTTCTCATTTCTAAAACTATTCATGATATGCACCATTG CAATGTCTTCTGAGAACCCAACAGCTGATTGGTTGAAAGTGACGTATTGA CTGATCACAATCAGCTATTCGCGGGTCCGTGATGTAATGTCAGAAGACAT TGCAATGGTGCATATCATGAATACTTGATAATGTTGTTAAATTAGCCCGA CCTTGTTTTCTTATGCTTCTTTCAAACGTGTATGTGAACATTAAGTTATG TCGTACCTTCACAGACTTGATACATTTTATCTCCTATTTCCCACAGGCTG GCGACTGTTCAAAATTAGCATTAGAATATAAACAAAGTGTTGCATCAGTT TTTGATCCACACCACAGAGGCTTTAACGGAGGTTAGTTTTTAAAGCCGTT TTGTTTTAACTTCTGAAACAATAGAATCATTGTTTTAATTGTATGCTTTT TGGTCTCATGTCTTCTTAAGTAAGGAAGTAAGTCTGCGACCGCAGTCGGA GGCGACCCGAAGGCTTCTTCTTCGATAGCTATCTACCCGAAGGTAGGGGA GGGCGCCACTCTTTCTCCTTTGGATTGCTCCACTTACCCTTGATCCTTCT CTTAATTGCTGAGCATCAAGCAGAGCAGCATCAAGTACCATTTTGAGAAT CTTTGGTATGACCCGGCTGGGGATTGAACCCACAATCTTGCGAACCGTAG CCGGATGCTCTACCACTGCACTACGGTTGCCATGTCTTCTTCGAGCACAT AGTAGATTGTCCAATTAGTAGAATGTGTTTGTATAGAATTTGAAAAATGA AACTACTTGGTGTCGCCCAGACACCAAAAATCAAAGTTTTTGAAAAATGA AAAGAAGCAGCCCTAGATATTCACCCAAGGAGCAAGTGTGTGAAGTTTCA GTCCAAACTGACCATTTTAAGTCCAGGCTAGATAAGGTCAACTGAAGTTT ATGTGAAATGTGAAATCACATTGACGGTTCAATATTGCAATCTTTTATTT CAGGATGGAATCTGAGATCGTTATTTGGAGGTGTGATTACCTCAAGATGT CCTTTGGCAAGAAACAGTCAGGTCATCATTCATACAGACAAGGTATTGTA TTTTTCGGCTTAATAAGACTGGACTTCTTGGTTTGCCGTCACCCGACCCT AGATTTTGGAAGTGGGTCGGTCGGTCGGTCGGAAAATTTTTTTATTTTGG TCTTTCATGGAATTTTTGTCGTGGCTGGCTCCGAAAAATCCTTGAACTTT TAGACAGTTCAAGAATTGCTTCCACGAAGGGCCACTATGAACAGAACAAG AACAGTAACAAAAAGGAGAAGGAAAATTGGATAACCAACAGTCCAGCCTA ATTGTTTATTTTTTGTTGGAACCACAAAATTCATTTTCACTGATATAATA ATTATCATATCATGTCTTCATATTTTTGAACTTCTTTTAAAATATCCATA ATATAATTCTATATTTGAGACTTTGTCTCTGGAAGTAGTTATTAAATCAA TATATTCCGCTTCGAAAGAGTTTTCCAAAGATCTTAGTATGGAGGTTTTT AGGATGATTTAGCTTTGTTTTGATTAATGAGAATTGAATTACGATTTCAC GTTCCAATGATACATCATAGAAGGATTTATCTATAAATTACAGAAAAACT TGAACTGCAATGTGTAGAATAAAAATTAAGATATATTTCGAACAGTCACG TCCATCATCAGTTTAAAAAAGTAAAAGCTACAAGCAAAATGTTCAATTTT TTCAAATAGTTGACAAAATCGCAGAAATCATATCCATATGGAAATACATA ACACAAAGGTTAAAGATAAAAGAAATATTCAAGTCATAATATGTAATAGT TATCAGACATTTGCGAGTACAATACAAGAAATATTTTATGAGTTCCGAGA TTTTTTTGCACAATATTTTCCGAGCCTTTAAGCGAGGAAAATATGTAAAA AAATTTGAAACGAGTAAAATCTGTATTGTACACGAGCTTGCGTCTGATAA CTAGTTTATCGGTGACCAAAAAAACTTTTTTTGTTGGAAAAAAGCACAAG GCAGTTTTGTAGCAAAGTGACGTTAGATTGCTGCTACCGCTACAATGCAA CAACATCTTTTCGTCAATTTATATTTTTACATGTAAAATACNAGTGACGT TAGATTGCTGCTACCGCTACAATGCAACAACATCTTTTCGTCAATTTATA TTTTTACATATAAAATACAAGATATTATATTGTACTCTTTTTAACCAATC AGATTGCTGATATTTTTTGGATCGCCGATAAATTAATCAAACGCCAAAAA AAAAAAAATTAAGTCATAACATATATACACATAAAAACAATTAATCATTT TCTAATTCAAATACCCATGACTATCATTAAGCAGTAACAATGGAAACAGA ATAAAACCTTGACGAGCAGCTGTTTGCTTTTAAACTCGTCCTTTGTGTTC ATGCTAGGTTTTATCTCCCTAATAAATAGTGCCTCGATTGCCATTTGTCA ATAAATGTCATATCCAATAAATCTATAAATTGTCAAGGGTTTTATTTCTC TATTTCAAGAAGGAATAACGTGTGTCTTTATGAACTTGATTAAGCTCTAG CTACTACTCTCCACTTCCCTTGTGTTCATTATGTTAAAGACCAAACAAGT CAAGATATGGTAAACTTGCCGTATGCAGCAGGATACAAAATCAAAACAAA TGTCACATGTCAAAATAAAAGATCAAAACAAATATGGCTGATTTTGATTG TTTCAATTGTTTTAAAAGTTTGTTTTGGATACGTTTAATTATTCTTTAAT GACATGTGGTTCGTGCAATGTTTACATTTTACTACTTTTATGTCCCTTTA AAGATCAAACAAGTCGAGATATGGTAAACTTGCCAGTAATGAACGACGAC GCATCAACATATTTCTCTCAATGCTCAATTTCGCATCTGGTTTAGCCTGA AAATTCTTCATTGTAAAATCCATCTTGATCATAACACCTCGAAGAGTGGT CATCTTATAACAACTATAAACCTTTTATAAAAAGCATGAGGAGGTTAGGT TCGAGTTTACCAGGAAGGAGTCTTATATATTCGAAGAATTTGGACATCTT TTCCATAGTAAATTCATTACCAGTCCCTTAAAACCCGACCACGCAACTAA AGGTTGATGGGTGTATTATTTTGTAGTCATGGCAATTATGACAAGAGAAC AAAAGGCTTGAATAAAATAAAAGGGAACATCAATGTATCTATCTCATTTC AACCGCTTGGTTGACCTCTTGTCTCCGTTCCCTTAACCTTTCTTCTCGAA AATATTCACTTGTATTTTCCCCAGGAAAGAATAACATTCGAAGTGCTTTT TGTGTGTATATCAAGAAAACAATAACCACATTGTTGATAATGATTGCGAT GCATTGGAAGAGTTCTCTCAGTTGTGGCGATTGAGCATTAACGATAACAA AACTGACACCAAAAACAACAGTGAGTGTGAAAGTAGCATATACTAACACA GTTCCATCGTTGATAACACTTGGTAGATTGCGACCTCTAAATGCTTGGAT AGAACACATCAGTTGGATGATCATGGATGAAGCAATCACAACATTGAAAT GAAATGAATTATCACAAAAATGGAAACTTATCATTGTTTTTGAATCCATA GCTTCAGCACTTGTGATTGGTCTCTTGTGAATTGCTATGCCAACTAATGT ATTGACTGACGTCACCAAAACGATGATTATGAATACTTGGACCATTTTCG AACGTTGAACTTCTTCACTTGTAAGACGAACTTTACTCAAAAAAGCTTGA AGAAGTTTTTGTGATTTGATAAAAACAATACCAATGTTTATTACATAAAG CATGCTGATTGAAATCAATCTGGAGATGCATTTGTAAAAGTTTGGTGTCC CAATAAAAGTAGATGGGACAGTTACAAAGAGAAGTAATATTATTGACATG TGTATTAATGAAACTTTGTAGTCAGATACTGAAACCATAGGTGTTTTTCT CTTGAATATAAACAGGCTTAAAGAAAAACACGTGACCAATATACCAATGA TACTTAAAACCACCAAACAAAGAAATTGCGAGTCCAACAAACTATAATGT ACATTTTGATAAGGGTCTATGCACATGGTACGTTTCCCATCGTCAACATT GAATCTTCCAGTGCATTTCCGACACCTTCCACTACCGGACAGTGATTTGA TTGTATTTTTCGGACACAGAAGACATCTCCAAGCAAAATTATTTCCACTG ATATTACTGTAAACCATGTGATATCCTGCTGGACAAAGAGGTTTCTCGCA GGTGGTGAAATTTCTACTCTTTTTATAAAAATCGTCATCCAAAGTAATAG GCTTTACCCCTTTTAAAAGAAAGCGTCTATTTTTTCCTTCAAATATTAAA TATTCCGTTTTTTTATAGTCTTCATACGTTTTTTGAAGTTCTGAGCGAAT TTCCGCGAGTGAACCGTAGAAATAATTTAAACCATAAATATCGATCCATT CCATGTCATGCAGTTGGTCTGAGAATTTTTTCGCATTCCTAAGAGTACTA AATTTCAAGTAGGTCGGCAAAGATTGGAATAATCTTCTGAAATCTATAGT ATAGCTAATCTCCATAAGATTTGAAAAGAGATTGAGATCAAGCAATAGAA AATTATGAATAGCCAAATATTCTGCATTTTCAATAAATTTTCCACCCAAT CGCCAAGTTTGAAATATGGTGTACATATGAGTTATAGGGAAAAATGGTAA TTCTTCCTGAAATACAGCATAGACTTTGTTTAGAAAGATGGCTTGATCAG AGCTTGATCCGAAAAATATAACGAAAGGTTTTTGATCAGATTGGAGCATG TCTTTCACGAACGCTGTTTCATTGTTTACCTCCTGCCGAGCATCAATTTC GTAAATCTCCAGACAGATTTTTTGGTTTTGCAAATTTTCAACTGTTTTTC TGTAGTATGAACGATAGGGAAAATCATTTGTTGTTAAAAAGACGATGGTC AATTTTTCCCAACCTGCAAGCTCAATATATTGCGATGTTTCTGAAACCAA ACTGTTCACTGGGTTAAAAATGGATCCATCTTCTTCGATTCTGTGGTCTA TATCATACACTGGAGTTTGCTTGAAAATATTTTTCACGAAATTCGTCATT TCAAGTGAAGTGTACATGAAAAATGCAACGATTGAAGACTCTGTGAAGTT TTGTCCATTTTGTTGAATCTTGAATTGTTCATCAAGGACAAGATTTTGAA CAATTTCTGTCAACAAGGTGAAGTTACCACAAACATCATATTCCTTATAT TTCAATTCACCATTTATATCACAATCCGCCGAACAACCTTTAACAAAAGC GTATAATGTTTCGTTGATAAGTTTTTTATTGAAAACACTCATTATTCCTG CGTCAATATTAAGTCGAGTTCTGTTAACATTTCCAGTGCAGTTGGAGTAT ACCCCTATTTGGTGAAACGTGTAACATTCCAACTCCTCAACATGGAGTAA GATTGCCAGATGGATGAATACATTTCTCCATTTCATTTTTAAGAGACTTT GAGTAACTGAAGTTGACCAGAGCTTACAGAATATGTTGCTATGTTTTCAC TAACCAAACCCTTCTTCGCAAACAAAACGAGCCACAGATTGCCTTTTTAA TTTGAGAAAAACTTTCTATCAAGCTTTTATCGCTGGTAGGAGGCCAAAAA CAATAAAACCAATCTCCATATAAAAGAATCTTCAATAATTATTTTAATTT CAAACTAAGAAACTATCTTTTTTTCCTTGGTAAAAATAATATCCCCCATA CCTTGTTTAAGAATAATTGTACTGATTCGGAACATTAGACATCCAAAACA TTAAAATTAATCAATCTCTTTTCGCAATTAAAATATATAACCTATTTTGA TATTTTTTAATTAAAATTGATGTTCTAATTTCTTGGCGTAATTCTTAAAG GATTATCTTTTCTTATTGTGTTAAAGAAAAACCGGAGAAAAAGAAAATGT TTCAATATCGCACATTTGATAGCATATCCATTATTCCCTTATGCACATGG TAAACCTCCGAAGGCGCCCGGTGAGGGCGGTATTGACCTTGAAGTGTCGT TGGAGTGTGAAAAGTGGACCCTGTCAGATATGAATATTTGCTAAATTTGG AACCCTGTCAGAACGAAAAATTGAAAATCTGAAAATCTTTCAAAATAGCC AAACTCGACCCTGTCAGAAAAATTCCTTAGAAATTAGTAAATTTGGGAAT CTGTCATATCATAGGCTCACTTTTGCCTGAGAGTAAAAAGTTTTCAAACG ATCCAGTATTTTCGAATTTATTTTTCTTTTATTTTCGTTCGTTCATTCGT TCGTTCGTTATGAAAATTTTAAAACTTGAACAGAATGGTTAATTATAAAA GTGTTAGCTGTCGTAGCATGAAGTTAGAGCATCCAACTTAGAGAATCCCT ACTGGGTCATATCAACTATTCCAAATATGGTACTTGATGCTCAATTGAAG AGATGGATCAAGCGAAATTTGAATATGATCCAAAGAAAGAAGTAGTACCA TTCCCTATCTTCAGATAGACAGCCAGAGAAAAGGGAGCCTGTGGGCCACC TTCGACTGTTGTCGCAAACTTAAGTATTGAGGTTCTGCATGCGGCTTTTC AGATCAAATTTGGCTGATTGCGCATGTGCAAAATCAATTCACAAAAACCT TTATTTACTTTTTTTTTCATTTTAACAGATTGACGGTTTGAATCCGAATC ATTTCGAAAAGAAAATTATTTTGGTCAGTGGGAAAGACGTTGAATATGCA GTATTTGATCTTACTAAGAAAGGTAGGTCAATCTTCATCATTTTAGCCCG GAAGGGTTGGCCAATTGACGGTATTTGCAGCGAAAAATTTGCTTACTAAA ATTTGGTGAAATTCATATCAAACCTTTACAGTGCATTTTTTTCTCAATTT TTCAATCCTTGCTCTTTCTTAGATTTATTTAGATTTTCAACCTTACAGTG CATTTATAAAAAAGTCCACCCTTACAATGTAATTCTGCTATCTTGAGAAA AATCAATAAAAACATCCCTTTAGCCGCCGTACATAGCCGTCGACCAATTT GGTAAACTGCTTCCCCGGGGTTTTCGGAGCATATATAGGTTTTCGAATTA TGCTTGAACGAAACGATTCATACTACCTGAAAAATTTTTGGAGTAATTTT GATTAAAACGTATTTATTATCAAACTAGTTGGTAGATGAGATTTTAATAT AATAACGAAGAAATCCCATAGAATCACACCTAGATCAGGCTTTCGTTTAA ATTCTTTCTTTTCTTTTTCAGACTTGGTTAAGTTCCCTTTTGATGTTCAA GTGAAGATGAAAAATCGAGCAACAGGTTTTCGTTCTTCCCATTTATCATT TTTGTTTCATTAGAAGGTACTTGTCGTCGCTACTTTCATGGAGTACTCAT GGTCCGAATAATAGTAGAGGGGTCCGAATAAAAGGAGGGGGTCCAAAATC TTTTCAAAATATAAAGGGGGGGGGGGGGTCCGAAATTGTACCTCCAAAAA CCCCTCAAAATAATGTAATTACAATCCAAACAAATATTGTTGGATCGCAT GTCGATTGACCAAAGCAAGTGATAAAAATTTGCTCACAACCTGCAATCAG TTAAAAAAGAGGTCTTTTAATCTTTTCGTTATACTTTAACTTTAATTTAA TTATCATTTTCTCATTTTACTTTCAGTGACGGATTTGAAATCTTCTTATA TTTTGGTCCACAAATACACAACTGGTTGGTTTACTCTTTTAATTCATGTT ATTCATATATTCTACCGCTGTTTTATCAGCCGGAACATTAAAAACCATGT GGTATCTTCCCGGACTATTCTCTTCCTCGCTACGTATACTGTTGGTGCTC TGTAATTCGAAGTTCAACTATTCAATACGCTCCATTATTCGATAAAATTG AACAATAAACTCACATTCACGACGCTCTACCATTCGATACGTCCTGTTAT TCGATCAAAATCTAATTCCCCTTGAATATTGAAAGTCGATTTAGAGCGCG TCAGATGTACTATATCACTGTTACTTTCTTTGTATATTTACGTCACTTAA AGGATAAGTCTCTTTAACTCGAACCTCTATAACTTGTATGTCTCCTTAAG TCAAAAAAAGTTCTCCCGTTTTTTCACTTAACAATTCCTTATAAACTTCT TACTTTATAACTCGAAATTTCCATAATTCGAGCAGATTTGTGTTCCCCGT GCCTGTTTGAGTTATGGAAACTCAATTGTAAAAGTGTCGAAAAAACTACT CTCGGATACCTAAATAGTCGGGGGGTTTGGAATAAAAATGTCCTGGGTGG AAAATGTTCGAAAAGGAGGCTAATACTGCAAAATTAGGGCAAAAGAGGGA ACTTTCAAAATGTTTTTCCAAAAATCAATAAGTGGGGGCGGGGGGTTGTA ATAAGAATGTCCTGGCTGGGAAATTTTTGAAAAATTAATTAGCCCCCCCC CCCCGGTTATTAAGTACGTGAGAGTAAAAGAAGTAGCATTATTTCGTAAT TTCTGTCTCCCTTCTCACATACAGGTTACGGTGAGGAGTATGGTGGAAGT ACTTGCATTGTACGGAACACGCATGCGCACAAAAACATCACCCTTTCCTA CCTTGACGTCATCCCATATTTCGCGCGTGTTTATCTGCACACGTTGAAAT TACAAGTTAATGGTGTTCAAATAAAACCAGGTAACTATTTGTTTTGTTTT GTTTTGGATAATTTGATATCGCTTGCTTACACATAAAATTTTACTTTACA AGCTTGGCAGGCATGTGGAGCAAGATTGGTTAGAAACAAGGTAAGAAAAA ACAATATTACACCGGCCTGATATAAAACATGTGTCTGATATGAAATGGGG ACATTTATGTAACACTAAAATCTTTAAGGTCTAGTTTAGACGATCTGCTC TATCCTCGTTTCTGTTCTGACGAACGCTGTCAGAGAAATGCGACTCTAAT GTCTATTGTTTTGTTTTGAAGTTAATATGATGATTTTTCTCTTATACCCG AATTGTCGTTATTCTCTATTTAGCTTAAATTAATTGCATAAATGCAAGAA ACAACTTCACTGTACTCATGACTCAAGCAAGCTTGGCATTGTTTAATAGC GTACAGTTAATGCCTCCCCGTTTTATATGGAAAGACAGATGTGTTAATTT ATTTTTACAGTAGTGCATTATTCGGGATTTATCAGCAAGGGTTGGTTTTC CTCGTATGGGGCTCATATGTTAAGACTTTAAAGGTAATACAATAGGGGTC TTACCCCTCAAAAAGACAAGATGAGGACAATTTGGTTCGTTTTTCTGTAG ACAATTTGAAGTACACACCATGCTATCATCGAGAACGACCAGCAAAGTTG GAATTTCTTTTTACCATACCTCCACAAAGTGACGTCACCATTTCCATCCA GTTTGAGAAGATCTTTCAAGATTGGATGCAGCACCCACCGGATTCTCATC ATGGTTTCTACATGTCATCTTCAGTCATCAGTGGCATAGTTCCTTTTCAT GAAGAGCTTGTAGAAACCATCCCTTCACTACATCATTCTATGTTTCGAGA AAGGTATCAACTATTTTTTTTTAAAGATATATCTTAAGCCTTTCAAACCC AAGTGACGTGTATCTACGTTCAAAATCGGCTAATATACCAAGTGTCTGAT ATAAGTCTTTATCCCTTGATTTGAAAGGGAAATGATTTTTGAAAGAGCAT AAAAAATATCTTTCCAACTGTACTTAAACCAAGCTCTCAGACTTCAAGCT ATTTATGCCAGCTTTAAGTCTTGGATTTAAAAAAATGTTACGCGCCGGAT AGGCAATAAATGAATGCACAGAAGAAGCTAAAACTTAAGGAATAGACCAG CGGCCGAGGTAGTGAATTGTGTCACTTCGTAGGGCACCCCTTAGATCAGG GCAAATTTATGATATTATACACCTAATAGGCTGTAGAATTGACAAAAAAA TTTGCCCTTCGAATCTCCTGCAGTTTTCGAGTGAATCGAATTTTAGTTAA TCGATAGAACTTATCAAGGGTCCCCCTTTACTAACGGTTTTTTCGAAGGC TGAACATCAAATATCTGAGGCTACCAACGGATTCAGCGTGAAAAGTAGAT GAAGAAAATGGGGTTATTTGTTAAGTTTCGACCACCTGGTGCCGAGAAAT GACATTTTTAAGGCAATTAGTCTATTAGGAGCATAATATCAAAAATTTGC CCTGATCTAAGGGGTGCCCTACGGAAACCATTTTTAAGGCCTTTTCTGAA TCTCGGACGCTGGTCTATAACATTCCGATGACCATATAACTTTGGGTTCA TTTTTTTTTCTGCTAATTTCCTTTGAAATTGCACGCTTTATAAGAATAAT TTCTATAAGAGTATCAGGGTTGGATTTCAGAGTTAGAACAATAGGCCTAT TGTTTAGAACAATAGAAAAATAAAAATAATGCTCACCCTCAGCCAAAGTA CACTATTCTTATAAAAAAAGCGTGTATCAAGTTTAGGAGGGAGTAAATTC ACATTTGTTCAACCTAACTCTTATTTTTCATAGATTTGGTACGACCAGTG ATGAAATGGTTTTCCGACGTATTTATTCCGAACCTTTACTCCTTCGGATA CCGTTACCCGATTTTAGTATGCCCTACAACGTCATTTGTCTGACGTGTAC CGTCATTGCAATCGGGTTCGGATCTATTTATAATTTAACAACACGGACTT TTCAAGTTGAAGAGGTCAAGGAAAAACGAACTTTAAAAGAGAAAATTTTA GGGTTGTTCCGGAAAACAGAAACGCTGGAAAATGAAGAAGAAGAGAATTC CGATGGATAGTAAGTTTCTTTATTTTACATAAATCATTTTTACCATGCGC ATATTTTTTATCCTCTTTTGTATATAATTAGGTATCTTTTTCATAATTAC TTTAAAACATTACATAAGATGTATTCTTAAAATCCAATTGTTGATAATGT TTCCTTTAATGTTTTCAAGGGAAATCCAAATTTGTATTTTTCGGACGTTT TGTTTCAAATTTCGGACGTTTTGCCTATATTTTTGATCATCGAGTGATGG AAAGCAACGAACGATGGTGCTATGAATCGCTCTTTGATTTGTTGCTTAGC ATCCTTCCCATCATACTCCACGATATCTGAATCTGTCCCCGTAATTCTGT TGAAGTCATGTGACCAAATTTGATTGACGTTTGAGAAGCTTGTCGAGGTG TGTTCGAAGAATCCACGACGGAATTTCCCGATGACGTCTTGGCTGTGCTT CCAACCGATATTTCCGACAAGAATGGTTCGCTTTACACGCCGACACATCA AGTTAGAGTAGATGTATGTAAGAACTTTTTCGAAGTCCTTTCCAGCTTGC TCACCTTCCTTTAGATTCCCGTTCAAGAAGAAGACAGCGCCCGGTTGATT TTTACACTCATCCTTGTTTTCTTCACTGTCCTCAACATCGCCCAACATTT TGAACAATCCTTCAAACCCTTTACCTATTTCAGATGGAAAATCTCTCTTT TTTCGGTTTTCAAGATTGCCGTGCATCTTTAGTTGTGTCCATGAGACTTG TCCGAATTTTGTCCGATTTACTCCAGTGAAAACCTCTTCATCATCCACCT GTTCAAATCGATCGCCTTTGTAAAGGATCGGGTTACAAATGACGTCATCA GCACCCTTCATACATAGACTGTCGATCCCAGACTCCTCGTAGTTAGTTGC CAACAGATCGTTTGCTTGTCGCAGTTCTCTGTATTCTCCTTTTGTAATGT TTTGGATAGCAATGATCTGGTCAATGAAAAAAAAATCACAAATCACAAAG CGACTCTTCCATTTCATGCTATTGTGATAACAACTGAAGTCTAACGAGG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00073829TCONS_00073829Clytia hemisphaericatranscript
TCONS_00073828TCONS_00073828Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00073829-proteinTCONS_00073829-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_98supercontigscaffold_98:196520..219918 -
Orthologs
The following orthologs are found for this feature:
Ortholog NameDescriptionOrganism
PIGTGPI transamidase component PIG-T isoform 1 precursor Homo Sapiens
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
14.62 13.85 4.37 3.15 12.23 9.39 9 8.95 8.17 8.57 8.61 6.27 6.02 6.34 6.87 8.22 14.2 12.07 4.65 5.44 6.98 6.62 25.08 21.87 8.53 9.28 10.37 11.63 17.13 16.96