Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_045636 (gene) - C. hemisphaerica

Overview
NameXLOC_045636
Unique NameXLOC_045636
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at scaffold_94:139957..150033+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_045636 ID=XLOC_045636|Name=XLOC_045636|organism=Clytia hemisphaerica|type=gene|length=10077bp|location=Sequence derived from alignment at scaffold_94:139957..150033+ (Clytia hemisphaerica)
GTTCGATGTCCATAAAAAGATGGATTATGGAGGTATTCCCTGCATTCAAC TTTTTGGAGATTGAACCTTCATCTTATCAATCATGCTCCGACTTATCTTT AGTCTAACACTTCTAATCATTGCAGTTCGTaagtttattttatattcaCA ATTAACCTAAAGTCtatctcaatataatctgcagtggagacaaaaaggct gtaactttagAGATGGTATTCAAATTAGATAAGATAGCGGGTTTGTTTTt gctcattgaaaagataatcgaTGAATAAAGCAGaagttttatcaaaattg aaaaaagaagatgaaaactGAAGAGGGGGGGGCCGAACGGGGTTtgtgat ttccgaaataccgaataattttgccaaaatttcccaaattccgtaaaaaa attcttgcaattccgataccaatttttttgggtatttttcctcgttttga caaattttttatcaaatttgatttttcatgtatgaattccggaAAAGgaa gataaaaactttataacaaaaaaaagttttatagcaaaaattcatggatt tccgataccgaaacaatttcagaattccgaaataccgaaggaattttgcc cgatttccgaaattccgaagaaaaaaggtaCGCCCCACCTTATTTGGTCA GAATCCTTTGGAAGCATTATATTGACTGCATTGATNAGGTACGATTTCCG CACGTTTctgcaattccgaaataccgtacgccccctaAAGAAGGCAAAAG TAAACTAGGGTATAATAAGGTACCGCTTAGGGAAAGAAAGTTCTTCCAAG GTGAACTGATGTAGAAGAGAAATTTCGAAAACAAttctttttatcattat taacatttttttttttctaaagacgCTTGCTCTGACAAAAACACAAAGTG TCCAAAATGGAAGGACGACCCAAGAGATTTGTGCAATACACATGaatacg tcatcaaaaattgcaaGAAGTCTTGCGGCAGGTGCGAAGGtaagttttaa aattcattaCAGGACTTTAATCGGAATAATTTTCAATATCGTGAGCCAAA AAAAGAACCGCAAAATTTTGTGGATTCATTTTTACGGATcagcattttga aaaattttaattgcattttaattgcattttaattgcatttttaTTGCTGC TCAATCGAAAACTCCTAAaatctattcacgataagtgtgcactcattttt cttttacctataacttttgaaggaattctttaatctttatgaatttggta tcattggaaagttattattagtgagtggaacgatttgaaataaaaaatct tttaaataattctaaaaatgaagatgaaaatgagaagaaaaaaatgaaga tcttgtagaaaagtgcaataactatcattttcacagaagtgaatccttaa tcatcgaacgtcatcactgtgaaaaagattctcaaaaataatcattcagt caaaagatatcaaacaaaggttgcatcaaggatttattatacactggata tacaagtaacagatttttgccgatttctcgtgtactagctatgtccgcag taatgatattattgttcactcttcttccctcattaaatgatttttcgaag catttttattgcatttcttatcgaaaatcactcatccaactcccaaaaga gacttaaaactttcctgtgagagtcagattcttccacttaattgctaatt acaagtcgttatgacgtttcaagctgtttAAAAGATGCANNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NtaaaagatgcaaaagacgtgttgtgtataagaaattttatGTTGACACC GGGAagtttcaaacttcaacctcaaaaaaaccaccttgccaccacgtgcc tcccaaggattttcataccacagtggagccaagacactcaagtcttatgt atatTAATTTCAgttcttctggggacagtcttggaaagatatttccaatt gaaaatttcgtgtcattataagcattttgtctgaatttctggtctaatga tgtttttctcacattagattttaCAGATGTATCCTGCTTGGTATGCTAGC cctactttcaaacttttttatgcaaatgtacaaaaagaaagagctagaga acttttttaaaataagactgataaacatttttttaaatcagacatctccg agccgccatgacagttgtcctttgcggacaaagctagaacatcaattgtt ttctgaaacaatgaaaatacaatgatcgctctccaccGNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNttcaaaatggtagcctagCTGAAGAAAACATTAAAGCTT AGGCCTTATGCATGCGTGCGCTTAGTGAACTAGTGTGAACAAGGTGTAGT GCTTGGTTACAAAAATGGTGTTTAgcaaaactaaaaatcaaatgGTGCAG TTTGTTGGCTAAACCCTCGGTTTAGCGAACgaagaaaacacagaaaaaag acTGTTGGCTTTGATCGTCTGTTTAGGTAAACTTTTAGATGAATCAATGC GTTCGCTAAACcctctgtttcacttttttgggtttttggctaAATGGTAT GCACCCAAAgatataagctgattgacgtctaaaaatgctgttttctgctg ttttctgctgtttttggggtcaatcacttattaactttgtatcgtaactt tatattgaaaataaatatttttagtgaaattttttcacagtgatgacctc ctaagatcacagaatctctccagtgaaaatgaaagttattatccatatag cggtcattaagtaagccattaaagattcgaacggcgggcggtattgaaag gttctatgactcaaatagtcatacccgcgctgaggaaACAAGGGTGTCGt ccttcagagggctgaaatatcattaaccgccctggttatagggcgataac gtcatttgcggcccgctcggaactttattgaagtcgttgcattgaagcga tgagactaaaccgacgtcagaaaataacactttttggtcatttgcggccc gctcggaactttattgaagtcgttgcattgaagcgatgagactaaaccga cgtcagaaaataacactttttggtcatttgcggcccgctcgcaagggtac tcaaaacttgttgaagtcattgcattgaagcgaaaagacttggctgacgc tagaaaaaaacgtgtgtGTGGATTTaacagaaaataacaacaacgacctc aaactgaacgctattgttatattatagcacttttctacaagatcttcatt tttttcttcttcattttcatctttatttttgtaatttttttaatttgttg aaGCAATGCTTTCATCCATCAAAAGAGTGCTTAACCAACCGAAGTTAGAA GCGTTATATCGTAGTTAAAGTATATaatgaaaatcattttttcaatactg gcagtttcatttttttacaaacaatcctcagttgaaaataaattttttaa aaactagagttccgttgctcttacaaaaaaataacactGCAGGGTCTTCG TAagaaattgacgtcattttagtCCTTGGTGTCGTGAACTTTTAAAGTGA ACTTGTTCACGTGACGGCATTTTGAAATCAGTTCATTCCTGGAAGAATGA CCCCCAAGAATGTACTCCCCCCGTACAACCAGAACGTTGAAACGAAAGTT GCACGAAGGTTTCTGCAACTCATAGATAAGTACTTTCCAAAACACCACAT ACTCAACAAAATATTCAACCGCAACACTGTCAAAGTCAGCTATAGTTGca ccaaaaacatgaaaaatatcataCAGAGTCACAATAAAAACATCCTGGAA GACGAAGCAAACGAGAACGTAGACAACCGAATGTGTAACTGCAGGGTAAA AGCCAACTGTCCCCTGAACAGATCGTGTTTAGTTGAGCGATCAGTATACC AAGCCACATGCGAGGAAGAACCAGATTACGACGAGAAGTTTTACATCGGA CTTGCCGAACCTGCTTTCAAAAAACGTTTTGCAAACCACCGCTACGAAAA AGAGACGGAATTGTCAAAAGAAGTTTGGAGGTTAAAACGAAAAAACCTAT CGCCAAAAATCGCATGGAAAACCATCCGNTTTTTTTGTTCGAAAACTTCC TTACAACATTTTCCTACACTGTTTCATTTAATTAAAGCTACCTGCGCTGA CAAAAACGTAAAGTGTCCTAAATGGAAGGACGACCAAAGAGATTTGTGTA ATACACATGAATACGTCATCCAAAATTGCAAGAAGTCTTGTGGCAGATGT GGAGGCTCAGGTATGTTGTTAAAGTTAACAAAGGAGGAGGGGAGTAACTA GATAACAAATACTTTAAAGCATTTTTACAAGATGTGATAATTTGAAATCC TGTTGTTTTTGACATATGTGTTCtaaatataaattaaatttcttgGCTTT CAAATTAAGGATCTTGCGAAATTTNGAAATGCCGTCACGTGAACAAGTTC Actttaatagttcacgacacaaggactaaaatgacgtcaatttttgacga agaccctgcaatgttatttttttgtgagAGCAACGGAACTctagttttta aaaaatataattttttaaagatttttttatttcaaattgtcccactcact aatatcttaccaatgataccaaatttataaagattaaagaattccttcaa aaNGTTTTgcacttctttttttctttgacattttttgacttATTTTTCAA CTCTAACATTATTCTAAACCGCTGAAAAGATAATCAAAaaagcattttaa ttttttaggcAAATAACTTCAAAGATTGGACTTTTTATCCTCTAATTCCA GGAACCTTATTTTTGCTAAACTGGTACTCTTAAGCCTCTGGATATCAGCT ATAAAGCCTTTAGAAGCAATTTCATCTGAGTGAAAgacttttttgttgtt gctatGTTTGCATCTACGGGCCACATTCTAAATAAGAACGTAACTTCCGA TGCAATAAGTTTATGTTATCTAGCTGAAATCTAGCTGAAATCAGGAggct ttacacgtttttttttttttaagaaacacacttttaagaaacatgaggct cagaatgcctaaaaactaagaaacatctaagaaacatgctgaggctgaga atgagaaaatgacatttttaaaacggtttttttagaaccttccaatcttt gcatgaaaagtaggctgattatgtcaaaaaagtttagaaacatgtaaaaa acatttaaggctcaaaaggccgatttcttaagaaacattgagactgcttg gtaaaactagtttcttaaaaaaaacgtgtataatacGTCTGTttagcaaa aattagttcctagCGTCGAAGGATAAAAACCTATTTTTTTTCGTCTTCAA CTTTCATTTtcgaacatttttgaaatctttttgacaGTCTATGCTTCTTA AACTGCTTTTTCATATAACTTAAGCTACCTGCGCTGACAAAAACGCAAAA TGTCCTAAATGGAAGGACGACCGAAGAGATTTGTGTAATACACATGAATA CGTCATCCAAAATTGCAAGAAGTCTTGTGGCAGATGTGGAGGCTCTGGTG GTGGTTCAGGCGGAGGCtctggtggtggtggtggttcAGGCGGATCCACC GGTGGATCGGAAGGAAAATGTGGCGTTTCACGGGCGGCCCAAAGTCGAAT TGTTGGAGGGACCACAGCCAGAGCTGGTGCTTGGCCGTGGCAAGTTTCTT TGCAAATTTATAACCAACACTTTTGCGGTGGAAGTATCTTGACATCAACC TGGGTAAGTATCTTATCCGGACAAGTATCTCAGATATGATTCTAANGCAC TTTTGCGGCGGAAGTATTTTGACATCAACCTGGGTAAGTATCTTATCCGG ACAAGTATTTTGAAATATCTCAGATATGATTCTAAATATAAGTTTTTTAG TTTCTAGccaaattttaaatctttttgttcctatgaaaattttctatacc ttaaaggaagaaattttagcaggaatttaatttggcggatggccggaaaa gttttttagagggaatttaatttggcggacggacgcaaaaactaaatttg ccgggaatttaatttggcgtttgctgaaaaatttatccttaaaatggtgt aaaaacggtaaaaataatgcaaaaacactttaaaaaaatttaatttggcg ggaatttaatttggcggattctggccgAATCcgccaaatctgccaaattt tctttccgccaaaatttcttcctttaagtaGCATTTTCTTTGTATGTAAT TTGAtatatttcgatttgggaggagTTTAGTTTCTTTCAGTCTATATTCT CTGCCTTATTGGTACCAATATTTGAGCTTTTGAATCCTGAAATCGTACGA GTAAGTTGATTATTTCTGACTATAATCGAAACCGACAAATAGAGCATAAC AGTAAAGATGTAGACCATTTCATTCTCAGATTTTGACTGCGGCACATTGC GTCGATGACAAGACAGAACGACCAAATCAAGTCTACGTTATCGCTGGTgc tcaaaacataaaaattaccGAATCAAGTCAACAGAGGATAAGAGCAAGGA GAATTATAATGCATCCATCGTTTCGCAGGGATGAAAATAACACACCTATT AGCGATATCGCCCTTATCCAACTTTCATCAAAACTGAACATGAATGATCG CGTCGTAAGAGCATGTTTACCGCAACAAGGAGTCTACCCAACAATTGGAA AAAGGTGTTACATCACAGGTAAGACGTTTTCAATTCTTGAATAATCATAC TTACTGATAAATATGTTCTTAATCATTTATTGACCCAGCGGCGCGCGCAA TGGGCCTTTGAAACACAACTGGTCGAAAATATTTGACTTTGTCGGGCTCA AACCCTGGTCGGGGCCTATGCGTGCGCAATTATGAATCGACGATTTCAGG CTAAAATCGAACTACCTGACTTTCTATTGTGTGCATGTGTGAGAAGTAAT TAATACCTCCAACTTATatggtcaaatctttctttcttaacTAGTAACAA AAGTTTAAAATAATTAAATCTTTATTACTCGCCCGACTCGAGTctataca ttgaaaaaaaatcgctCCTGTTGTAAGGCGATTCTGCAGCGGAAAAATAT GCCAACAGTGCCAACACTGCTGGGCCTATACGCCGCTTAGGATTTCTTCT GTACATTCAAATGGtcattcttaaattttatttcaaacaatGTTTCAACC TCCTTAGGTTGCATACCTTTTAATactcaaaaccaaaaaaactcaAACCG TTTCGCTAAACtgcaaatggtttgggtttgcTTACAGTTGAAAATTACGC ATGCGCAGTATTATGAAATAGAATTGCGAGAAAGGTCCTTACTCCCTGTG AGTCACACCACTgacctggaccaagcaatatctcccatctttgattggag tttttttggaattggtacccgaggagaagccattgcaatgttaaaaatta acgtctagtgctgctacatcatcaaaagaattcgaggaaaagtagaccta gcgctctcgatgcatttacaccgctatcgagtagtgccgccattagggta ccaatttNctttcgcgaaaagggccacaATTTGCGAAAATcatgaaagtt tctgctcgcgaaagtttgtacgcctaaagtggtgccgccattagggtacc aattttcaaaaaactccgatcaaagattttgcttggctgggattgagaag cttggtccaggttatataaaggtcagtgatggTCAAAATGGTAGCATAGC TGAAAAAAACATTAAAGCTTAGGGCTGCGTAAACAAGGTGTAGTACTTGG TCAGAATAATGgtttagcaaaacaaaaaattgaatggtGCCGcgtccaat gaagtataagcccgaagggctagaagtcaatctccattggtaggatttga agccaacaaatcctaccaaagttacgcggccttgagcggctcccctgggt tttacacaaatgacagattgaaactaaaatttaccgctaaatttcgaaaa aaatatcaatcgtaaacaaaggaattgctagattcaatctgtcgtcaaaa atgcggcgcatttttcaaggcttcactttttcttgcctgagaaaggttag agattgaactttaGCCCTTCGGGTCTTAAACTCAATGGCCGCGTCTCTGT TGGCTAAACCCTCGGTTTAGCGAACGAAGAAAACACATAAAAAAGACTGT TGACTTTGAAAGTCTGTTTAGGCaaacttttaaatgaatcaaTGCGTTCG CTAAACTCTCTGTTTCACTATTTTGGGTTTTTGGCTAAAACCCTTAGTAG AGGTCTTCATTAGGTTTACAAACGTTCAGTTGAGATCGGTGTTTTGACGT CATATGACATCAATGCAATGACCTCAATCTGATGTGCGAGAGCATTGGTT TCCAGAACCCAGACGTCACATACTGACCATAGTCTAAATTTAGACCATGT TTACTATGTGGCACCGTCTCACGGAACTGGATCTCCAATGCTTCTTGCGC CTTcctatcaaatttattttcctcTCTTTTTAAAGGGGTTTAAGATTAGA CGTTTTATACAGTAAGGTTTCCATAACTTGAACACGCACGAAGAGTTAAA ATCTGtttgaaatattaaaaattgggttaaagaaaatttcttgtAAGGCG CATCATTAACTGACGATGACTGCGTTGAAGTTAATGAAACGTTCAAatta ttagcctatttcataggatttgtGTTTTTTGTACATGATATTTTTCTACG TCACTGAGGTAACTAACCTTTTGTGGCTGAGCACTCTTTTGCTGATTGAG ATTAAaggttttacaaaaagaaaaaacaatggaaaaggAGTTTCTTCTCC ATCCCCTTTGGCAAGGAAATATCTCTTTGGTAAAATTATTACCAGTGTCC TTAAATGTATTACCATTCATTTACAAAAAGGTAGAAGATTATTCAGGGTT ACATAAAGAACGCTGATTGAATCataaactctttttttctttagGCTGGG GTGATCTGTCTTTCGAAGGTTCAAGTCCTGCTCGATTACAACAAGCTAAA TTGCCGGTGATCAGATCAGATGGTGAAACTGTGGATGTTGGATATAATAG CCCAAGAGAAGGTGTATCCAATGCATGCCAAGGTGATTCTGGTGGTCCCC TGAGTTGTCAACGTGATGATGGTACATGGCAAGTTGAAGGTGCTGCAAGC TATGTTCTAAATAGATGTCAATACCTTAGTGCGTATGCGCCACTCAATAA ATATTTGAGTTGGGTCAAAAGATATGTGCCTGGCTTGTAAATATTGTTAT GCAGGTGGCATTTCTgttttggactcaaaacaccATGTGGATTTGGAAAT TGTCTGTTatcacccagctggcacataaagTTTTTTCGACGTCTATCTAA TGTTCGCAACGTCCATAACGATAGaag
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00073524TCONS_00073524Clytia hemisphaericatranscript
TCONS_00073525TCONS_00073525Clytia hemisphaericatranscript
TCONS_00073526TCONS_00073526Clytia hemisphaericatranscript
TCONS_00073527TCONS_00073527Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00073525-proteinTCONS_00073525-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_94supercontigscaffold_94:139957..150033 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.34 0.37 0 0.22 0.55 0.11 0.43 0.18 1.82 0.28 2.6 13.7 8.12 19.24 2.38 1.33 0.61 1.82 7.31 20.41 0.04 0.1 0.1 0.14 0.72 0.26 1.66 0.89 0.15 0