Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073524 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073524
Unique NameTCONS_00073524
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1296

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073524 ID=TCONS_00073524|Name=TCONS_00073524|organism=Clytia hemisphaerica|type=transcript|length=1296bp
GTTCGATGTCCATAAAAAGATGGATTATGGAGGTATTCCCTGCATTCAAC
TTTTTGGAGATTGAACCTTCATCTTATCAATCATGCTCCGACTTATCTTT
AGTCTAACACTTCTAATCATTGCAGTTCacgCTTGCTCTGACAAAAACAC
AAAGTGTCCAAAATGGAAGGACGACCCAAGAGATTTGTGCAATACACATG
aatacgtcatcaaaaattgcaaGAAGTCTTGCGGCAGGTGCGAAGCTACC
TGCGCTGACAAAAACGCAAAATGTCCTAAATGGAAGGACGACCGAAGAGA
TTTGTGTAATACACATGAATACGTCATCCAAAATTGCAAGAAGTCTTGTG
GCAGATGTGGAGGCTCTGGTGGTGGTTCAGGCGGAGGCtctggtggtggt
ggtggttcAGGCGGATCCACCGGTGGATCGGAAGGAAAATGTGGCGTTTC
ACGGGCGGCCCAAAGTCGAATTGTTGGAGGGACCACAGCCAGAGCTGGTG
CTTGGCCGTGGCAAGTTTCTTTGCAAATTTATAACCAACACTTTTGCGGT
GGAAGTATCTTGACATCAACCTGGATTTTGACTGCGGCACATTGCGTCGA
TGACAAGACAGAACGACCAAATCAAGTCTACGTTATCGCTGGTgctcaaa
acataaaaattaccGAATCAAGTCAACAGAGGATAAGAGCAAGGAGAATT
ATAATGCATCCATCGTTTCGCAGGGATGAAAATAACACACCTATTAGCGA
TATCGCCCTTATCCAACTTTCATCAAAACTGAACATGAATGATCGCGTCG
TAAGAGCATGTTTACCGCAACAAGGAGTCTACCCAACAATTGGAAAAAGG
TGTTACATCACAGGCTGGGGTGATCTGTCTTTCGAAGGTTCAAGTCCTGC
TCGATTACAACAAGCTAAATTGCCGGTGATCAGATCAGATGGTGAAACTG
TGGATGTTGGATATAATAGCCCAAGAGAAGGTGTATCCAATGCATGCCAA
GGTGATTCTGGTGGTCCCCTGAGTTGTCAACGTGATGATGGTACATGGCA
AGTTGAAGGTGCTGCAAGCTATGTTCTAAATAGATGTCAATACCTTAGTG
CGTATGCGCCACTCAATAAATATTTGAGTTGGGTCAAAAGATATGTGCCT
GGCTTGTAAATATTGTTATGCAGGTGGCATTTCTgttttggactcaaaac
accATGTGGATTTGGAAATTGTCTGTTatcacccagctggcacataaagT
TTTTTCGACGTCTATCTAATGTTCGCAACGTCCATAACGATAGaag
Run BLAST on NCBI

transcript from alignment at scaffold_94:139957..150033+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073524 ID=TCONS_00073524|Name=TCONS_00073524|organism=Clytia hemisphaerica|type=transcript|length=10077bp|location=Sequence derived from alignment at scaffold_94:139957..150033+ (Clytia hemisphaerica)
GTTCGATGTCCATAAAAAGATGGATTATGGAGGTATTCCCTGCATTCAAC TTTTTGGAGATTGAACCTTCATCTTATCAATCATGCTCCGACTTATCTTT AGTCTAACACTTCTAATCATTGCAGTTCGTaagtttattttatattcaCA ATTAACCTAAAGTCtatctcaatataatctgcagtggagacaaaaaggct gtaactttagAGATGGTATTCAAATTAGATAAGATAGCGGGTTTGTTTTt gctcattgaaaagataatcgaTGAATAAAGCAGaagttttatcaaaattg aaaaaagaagatgaaaactGAAGAGGGGGGGGCCGAACGGGGTTtgtgat ttccgaaataccgaataattttgccaaaatttcccaaattccgtaaaaaa attcttgcaattccgataccaatttttttgggtatttttcctcgttttga caaattttttatcaaatttgatttttcatgtatgaattccggaAAAGgaa gataaaaactttataacaaaaaaaagttttatagcaaaaattcatggatt tccgataccgaaacaatttcagaattccgaaataccgaaggaattttgcc cgatttccgaaattccgaagaaaaaaggtaCGCCCCACCTTATTTGGTCA GAATCCTTTGGAAGCATTATATTGACTGCATTGATNAGGTACGATTTCCG CACGTTTctgcaattccgaaataccgtacgccccctaAAGAAGGCAAAAG TAAACTAGGGTATAATAAGGTACCGCTTAGGGAAAGAAAGTTCTTCCAAG GTGAACTGATGTAGAAGAGAAATTTCGAAAACAAttctttttatcattat taacatttttttttttctaaagacgCTTGCTCTGACAAAAACACAAAGTG TCCAAAATGGAAGGACGACCCAAGAGATTTGTGCAATACACATGaatacg tcatcaaaaattgcaaGAAGTCTTGCGGCAGGTGCGAAGGtaagttttaa aattcattaCAGGACTTTAATCGGAATAATTTTCAATATCGTGAGCCAAA AAAAGAACCGCAAAATTTTGTGGATTCATTTTTACGGATcagcattttga aaaattttaattgcattttaattgcattttaattgcatttttaTTGCTGC TCAATCGAAAACTCCTAAaatctattcacgataagtgtgcactcattttt cttttacctataacttttgaaggaattctttaatctttatgaatttggta tcattggaaagttattattagtgagtggaacgatttgaaataaaaaatct tttaaataattctaaaaatgaagatgaaaatgagaagaaaaaaatgaaga tcttgtagaaaagtgcaataactatcattttcacagaagtgaatccttaa tcatcgaacgtcatcactgtgaaaaagattctcaaaaataatcattcagt caaaagatatcaaacaaaggttgcatcaaggatttattatacactggata tacaagtaacagatttttgccgatttctcgtgtactagctatgtccgcag taatgatattattgttcactcttcttccctcattaaatgatttttcgaag catttttattgcatttcttatcgaaaatcactcatccaactcccaaaaga gacttaaaactttcctgtgagagtcagattcttccacttaattgctaatt acaagtcgttatgacgtttcaagctgtttAAAAGATGCANNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NtaaaagatgcaaaagacgtgttgtgtataagaaattttatGTTGACACC GGGAagtttcaaacttcaacctcaaaaaaaccaccttgccaccacgtgcc tcccaaggattttcataccacagtggagccaagacactcaagtcttatgt atatTAATTTCAgttcttctggggacagtcttggaaagatatttccaatt gaaaatttcgtgtcattataagcattttgtctgaatttctggtctaatga tgtttttctcacattagattttaCAGATGTATCCTGCTTGGTATGCTAGC cctactttcaaacttttttatgcaaatgtacaaaaagaaagagctagaga acttttttaaaataagactgataaacatttttttaaatcagacatctccg agccgccatgacagttgtcctttgcggacaaagctagaacatcaattgtt ttctgaaacaatgaaaatacaatgatcgctctccaccGNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNttcaaaatggtagcctagCTGAAGAAAACATTAAAGCTT AGGCCTTATGCATGCGTGCGCTTAGTGAACTAGTGTGAACAAGGTGTAGT GCTTGGTTACAAAAATGGTGTTTAgcaaaactaaaaatcaaatgGTGCAG TTTGTTGGCTAAACCCTCGGTTTAGCGAACgaagaaaacacagaaaaaag acTGTTGGCTTTGATCGTCTGTTTAGGTAAACTTTTAGATGAATCAATGC GTTCGCTAAACcctctgtttcacttttttgggtttttggctaAATGGTAT GCACCCAAAgatataagctgattgacgtctaaaaatgctgttttctgctg ttttctgctgtttttggggtcaatcacttattaactttgtatcgtaactt tatattgaaaataaatatttttagtgaaattttttcacagtgatgacctc ctaagatcacagaatctctccagtgaaaatgaaagttattatccatatag cggtcattaagtaagccattaaagattcgaacggcgggcggtattgaaag gttctatgactcaaatagtcatacccgcgctgaggaaACAAGGGTGTCGt ccttcagagggctgaaatatcattaaccgccctggttatagggcgataac gtcatttgcggcccgctcggaactttattgaagtcgttgcattgaagcga tgagactaaaccgacgtcagaaaataacactttttggtcatttgcggccc gctcggaactttattgaagtcgttgcattgaagcgatgagactaaaccga cgtcagaaaataacactttttggtcatttgcggcccgctcgcaagggtac tcaaaacttgttgaagtcattgcattgaagcgaaaagacttggctgacgc tagaaaaaaacgtgtgtGTGGATTTaacagaaaataacaacaacgacctc aaactgaacgctattgttatattatagcacttttctacaagatcttcatt tttttcttcttcattttcatctttatttttgtaatttttttaatttgttg aaGCAATGCTTTCATCCATCAAAAGAGTGCTTAACCAACCGAAGTTAGAA GCGTTATATCGTAGTTAAAGTATATaatgaaaatcattttttcaatactg gcagtttcatttttttacaaacaatcctcagttgaaaataaattttttaa aaactagagttccgttgctcttacaaaaaaataacactGCAGGGTCTTCG TAagaaattgacgtcattttagtCCTTGGTGTCGTGAACTTTTAAAGTGA ACTTGTTCACGTGACGGCATTTTGAAATCAGTTCATTCCTGGAAGAATGA CCCCCAAGAATGTACTCCCCCCGTACAACCAGAACGTTGAAACGAAAGTT GCACGAAGGTTTCTGCAACTCATAGATAAGTACTTTCCAAAACACCACAT ACTCAACAAAATATTCAACCGCAACACTGTCAAAGTCAGCTATAGTTGca ccaaaaacatgaaaaatatcataCAGAGTCACAATAAAAACATCCTGGAA GACGAAGCAAACGAGAACGTAGACAACCGAATGTGTAACTGCAGGGTAAA AGCCAACTGTCCCCTGAACAGATCGTGTTTAGTTGAGCGATCAGTATACC AAGCCACATGCGAGGAAGAACCAGATTACGACGAGAAGTTTTACATCGGA CTTGCCGAACCTGCTTTCAAAAAACGTTTTGCAAACCACCGCTACGAAAA AGAGACGGAATTGTCAAAAGAAGTTTGGAGGTTAAAACGAAAAAACCTAT CGCCAAAAATCGCATGGAAAACCATCCGNTTTTTTTGTTCGAAAACTTCC TTACAACATTTTCCTACACTGTTTCATTTAATTAAAGCTACCTGCGCTGA CAAAAACGTAAAGTGTCCTAAATGGAAGGACGACCAAAGAGATTTGTGTA ATACACATGAATACGTCATCCAAAATTGCAAGAAGTCTTGTGGCAGATGT GGAGGCTCAGGTATGTTGTTAAAGTTAACAAAGGAGGAGGGGAGTAACTA GATAACAAATACTTTAAAGCATTTTTACAAGATGTGATAATTTGAAATCC TGTTGTTTTTGACATATGTGTTCtaaatataaattaaatttcttgGCTTT CAAATTAAGGATCTTGCGAAATTTNGAAATGCCGTCACGTGAACAAGTTC Actttaatagttcacgacacaaggactaaaatgacgtcaatttttgacga agaccctgcaatgttatttttttgtgagAGCAACGGAACTctagttttta aaaaatataattttttaaagatttttttatttcaaattgtcccactcact aatatcttaccaatgataccaaatttataaagattaaagaattccttcaa aaNGTTTTgcacttctttttttctttgacattttttgacttATTTTTCAA CTCTAACATTATTCTAAACCGCTGAAAAGATAATCAAAaaagcattttaa ttttttaggcAAATAACTTCAAAGATTGGACTTTTTATCCTCTAATTCCA GGAACCTTATTTTTGCTAAACTGGTACTCTTAAGCCTCTGGATATCAGCT ATAAAGCCTTTAGAAGCAATTTCATCTGAGTGAAAgacttttttgttgtt gctatGTTTGCATCTACGGGCCACATTCTAAATAAGAACGTAACTTCCGA TGCAATAAGTTTATGTTATCTAGCTGAAATCTAGCTGAAATCAGGAggct ttacacgtttttttttttttaagaaacacacttttaagaaacatgaggct cagaatgcctaaaaactaagaaacatctaagaaacatgctgaggctgaga atgagaaaatgacatttttaaaacggtttttttagaaccttccaatcttt gcatgaaaagtaggctgattatgtcaaaaaagtttagaaacatgtaaaaa acatttaaggctcaaaaggccgatttcttaagaaacattgagactgcttg gtaaaactagtttcttaaaaaaaacgtgtataatacGTCTGTttagcaaa aattagttcctagCGTCGAAGGATAAAAACCTATTTTTTTTCGTCTTCAA CTTTCATTTtcgaacatttttgaaatctttttgacaGTCTATGCTTCTTA AACTGCTTTTTCATATAACTTAAGCTACCTGCGCTGACAAAAACGCAAAA TGTCCTAAATGGAAGGACGACCGAAGAGATTTGTGTAATACACATGAATA CGTCATCCAAAATTGCAAGAAGTCTTGTGGCAGATGTGGAGGCTCTGGTG GTGGTTCAGGCGGAGGCtctggtggtggtggtggttcAGGCGGATCCACC GGTGGATCGGAAGGAAAATGTGGCGTTTCACGGGCGGCCCAAAGTCGAAT TGTTGGAGGGACCACAGCCAGAGCTGGTGCTTGGCCGTGGCAAGTTTCTT TGCAAATTTATAACCAACACTTTTGCGGTGGAAGTATCTTGACATCAACC TGGGTAAGTATCTTATCCGGACAAGTATCTCAGATATGATTCTAANGCAC TTTTGCGGCGGAAGTATTTTGACATCAACCTGGGTAAGTATCTTATCCGG ACAAGTATTTTGAAATATCTCAGATATGATTCTAAATATAAGTTTTTTAG TTTCTAGccaaattttaaatctttttgttcctatgaaaattttctatacc ttaaaggaagaaattttagcaggaatttaatttggcggatggccggaaaa gttttttagagggaatttaatttggcggacggacgcaaaaactaaatttg ccgggaatttaatttggcgtttgctgaaaaatttatccttaaaatggtgt aaaaacggtaaaaataatgcaaaaacactttaaaaaaatttaatttggcg ggaatttaatttggcggattctggccgAATCcgccaaatctgccaaattt tctttccgccaaaatttcttcctttaagtaGCATTTTCTTTGTATGTAAT TTGAtatatttcgatttgggaggagTTTAGTTTCTTTCAGTCTATATTCT CTGCCTTATTGGTACCAATATTTGAGCTTTTGAATCCTGAAATCGTACGA GTAAGTTGATTATTTCTGACTATAATCGAAACCGACAAATAGAGCATAAC AGTAAAGATGTAGACCATTTCATTCTCAGATTTTGACTGCGGCACATTGC GTCGATGACAAGACAGAACGACCAAATCAAGTCTACGTTATCGCTGGTgc tcaaaacataaaaattaccGAATCAAGTCAACAGAGGATAAGAGCAAGGA GAATTATAATGCATCCATCGTTTCGCAGGGATGAAAATAACACACCTATT AGCGATATCGCCCTTATCCAACTTTCATCAAAACTGAACATGAATGATCG CGTCGTAAGAGCATGTTTACCGCAACAAGGAGTCTACCCAACAATTGGAA AAAGGTGTTACATCACAGGTAAGACGTTTTCAATTCTTGAATAATCATAC TTACTGATAAATATGTTCTTAATCATTTATTGACCCAGCGGCGCGCGCAA TGGGCCTTTGAAACACAACTGGTCGAAAATATTTGACTTTGTCGGGCTCA AACCCTGGTCGGGGCCTATGCGTGCGCAATTATGAATCGACGATTTCAGG CTAAAATCGAACTACCTGACTTTCTATTGTGTGCATGTGTGAGAAGTAAT TAATACCTCCAACTTATatggtcaaatctttctttcttaacTAGTAACAA AAGTTTAAAATAATTAAATCTTTATTACTCGCCCGACTCGAGTctataca ttgaaaaaaaatcgctCCTGTTGTAAGGCGATTCTGCAGCGGAAAAATAT GCCAACAGTGCCAACACTGCTGGGCCTATACGCCGCTTAGGATTTCTTCT GTACATTCAAATGGtcattcttaaattttatttcaaacaatGTTTCAACC TCCTTAGGTTGCATACCTTTTAATactcaaaaccaaaaaaactcaAACCG TTTCGCTAAACtgcaaatggtttgggtttgcTTACAGTTGAAAATTACGC ATGCGCAGTATTATGAAATAGAATTGCGAGAAAGGTCCTTACTCCCTGTG AGTCACACCACTgacctggaccaagcaatatctcccatctttgattggag tttttttggaattggtacccgaggagaagccattgcaatgttaaaaatta acgtctagtgctgctacatcatcaaaagaattcgaggaaaagtagaccta gcgctctcgatgcatttacaccgctatcgagtagtgccgccattagggta ccaatttNctttcgcgaaaagggccacaATTTGCGAAAATcatgaaagtt tctgctcgcgaaagtttgtacgcctaaagtggtgccgccattagggtacc aattttcaaaaaactccgatcaaagattttgcttggctgggattgagaag cttggtccaggttatataaaggtcagtgatggTCAAAATGGTAGCATAGC TGAAAAAAACATTAAAGCTTAGGGCTGCGTAAACAAGGTGTAGTACTTGG TCAGAATAATGgtttagcaaaacaaaaaattgaatggtGCCGcgtccaat gaagtataagcccgaagggctagaagtcaatctccattggtaggatttga agccaacaaatcctaccaaagttacgcggccttgagcggctcccctgggt tttacacaaatgacagattgaaactaaaatttaccgctaaatttcgaaaa aaatatcaatcgtaaacaaaggaattgctagattcaatctgtcgtcaaaa atgcggcgcatttttcaaggcttcactttttcttgcctgagaaaggttag agattgaactttaGCCCTTCGGGTCTTAAACTCAATGGCCGCGTCTCTGT TGGCTAAACCCTCGGTTTAGCGAACGAAGAAAACACATAAAAAAGACTGT TGACTTTGAAAGTCTGTTTAGGCaaacttttaaatgaatcaaTGCGTTCG CTAAACTCTCTGTTTCACTATTTTGGGTTTTTGGCTAAAACCCTTAGTAG AGGTCTTCATTAGGTTTACAAACGTTCAGTTGAGATCGGTGTTTTGACGT CATATGACATCAATGCAATGACCTCAATCTGATGTGCGAGAGCATTGGTT TCCAGAACCCAGACGTCACATACTGACCATAGTCTAAATTTAGACCATGT TTACTATGTGGCACCGTCTCACGGAACTGGATCTCCAATGCTTCTTGCGC CTTcctatcaaatttattttcctcTCTTTTTAAAGGGGTTTAAGATTAGA CGTTTTATACAGTAAGGTTTCCATAACTTGAACACGCACGAAGAGTTAAA ATCTGtttgaaatattaaaaattgggttaaagaaaatttcttgtAAGGCG CATCATTAACTGACGATGACTGCGTTGAAGTTAATGAAACGTTCAAatta ttagcctatttcataggatttgtGTTTTTTGTACATGATATTTTTCTACG TCACTGAGGTAACTAACCTTTTGTGGCTGAGCACTCTTTTGCTGATTGAG ATTAAaggttttacaaaaagaaaaaacaatggaaaaggAGTTTCTTCTCC ATCCCCTTTGGCAAGGAAATATCTCTTTGGTAAAATTATTACCAGTGTCC TTAAATGTATTACCATTCATTTACAAAAAGGTAGAAGATTATTCAGGGTT ACATAAAGAACGCTGATTGAATCataaactctttttttctttagGCTGGG GTGATCTGTCTTTCGAAGGTTCAAGTCCTGCTCGATTACAACAAGCTAAA TTGCCGGTGATCAGATCAGATGGTGAAACTGTGGATGTTGGATATAATAG CCCAAGAGAAGGTGTATCCAATGCATGCCAAGGTGATTCTGGTGGTCCCC TGAGTTGTCAACGTGATGATGGTACATGGCAAGTTGAAGGTGCTGCAAGC TATGTTCTAAATAGATGTCAATACCTTAGTGCGTATGCGCCACTCAATAA ATATTTGAGTTGGGTCAAAAGATATGTGCCTGGCTTGTAAATATTGTTAT GCAGGTGGCATTTCTgttttggactcaaaacaccATGTGGATTTGGAAAT TGTCTGTTatcacccagctggcacataaagTTTTTTCGACGTCTATCTAA TGTTCGCAACGTCCATAACGATAGaag
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045636XLOC_045636Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073524-exon-scaffold_94-1491911889:139957..140084TCONS_00073524-exon-scaffold_94-1491911889:139957..140084Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1510915933:139957..140084TCONS_00073524-exon-scaffold_94-1510915933:139957..140084Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1575043694:139957..140084TCONS_00073524-exon-scaffold_94-1575043694:139957..140084Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1491911889:140829..140945TCONS_00073524-exon-scaffold_94-1491911889:140829..140945Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1510915933:140829..140945TCONS_00073524-exon-scaffold_94-1510915933:140829..140945Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1575043694:140829..140945TCONS_00073524-exon-scaffold_94-1575043694:140829..140945Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1491911889:146031..146359TCONS_00073524-exon-scaffold_94-1491911889:146031..146359Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1510915933:146031..146359TCONS_00073524-exon-scaffold_94-1510915933:146031..146359Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1575043694:146031..146359TCONS_00073524-exon-scaffold_94-1575043694:146031..146359Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1491911889:147036..147324TCONS_00073524-exon-scaffold_94-1491911889:147036..147324Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1510915933:147036..147324TCONS_00073524-exon-scaffold_94-1510915933:147036..147324Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1575043694:147036..147324TCONS_00073524-exon-scaffold_94-1575043694:147036..147324Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1491911889:149601..150033TCONS_00073524-exon-scaffold_94-1491911889:149601..150033Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1510915933:149601..150033TCONS_00073524-exon-scaffold_94-1510915933:149601..150033Clytia hemisphaericaexon
TCONS_00073524-exon-scaffold_94-1575043694:149601..150033TCONS_00073524-exon-scaffold_94-1575043694:149601..150033Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_94supercontigscaffold_94:139957..150033 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0 0 0 0 0 0 0 0 2.44362 0 0.97836 0 0.226705 0 0 1.10145e-07 0 0 0 0 0 0 0 0 0 0 0
Blast
BLAST of TCONS_00073524 vs. Swiss-Prot (Human)
Match: CEL2A (Chymotrypsin-like elastase family member 2A OS=Homo sapiens GN=CELA2A PE=1 SV=1)

HSP 1 Score: 142.124 bits (357), Expect = 1.790e-38
Identity = 89/249 (35.74%), Postives = 134/249 (53.82%), Query Frame = 2
Query:  464 SRIVGGTTARAGAWPWQVSLQIYNQ----HFCGGSILTSTWILTAAHCVDD-KTERPNQVYVIAGAQNIKITESSQQXXXXXXXXMHPSFRRDENNTPIS---DIALIQLSSKLNMNDRVVRACLPQQGVYPTIGKRCYITGWGDLSFEGSSPARLQQAKLPVIRSDGETVDVGYNSP---------REGVSNACQGDSGGPLSCQRDDGTWQVEGAASYVLNR-CQYL---SAYAPLNKYLSWVKRYV 1147
            +R+VGG  AR  +WPWQVSLQ  +     H CGGS++ ++W+LTAAHC+   +T R     V  G  N+ + ES    +   +I++H    +D N+  IS   DIAL++L++ +++ D++  ACLP  G        CY+TGWG L   G+ P  LQQ +L V+     +    + S           +GV ++C GDSGGPL+CQ  DG WQV G  S+     C Y    S +  ++ Y+ W+   +
Sbjct:   27 TRVVGGEEARPNSWPWQVSLQYSSNGKWYHTCGGSLIANSWVLTAAHCISSSRTYR-----VGLGRHNLYVAESGSLAVSVSKIVVH----KDWNSNQISKGNDIALLKLANPVSLTDKIQLACLPPAGTILPNNYPCYVTGWGRLQTNGAVPDVLQQGRLLVVDYATCSSSAWWGSSVKTSMICAGGDGVISSCNGDSGGPLNCQASDGRWQVHGIVSFGSRLGCNYYHKPSVFTRVSNYIDWINSVI 266          
The following BLAST results are available for this feature:
BLAST of TCONS_00073524 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
CEL2A1.790e-3835.74Chymotrypsin-like elastase family member 2A OS=Hom... [more]
back to top