Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_045471 (gene) - C. hemisphaerica

Overview
NameXLOC_045471
Unique NameXLOC_045471
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at scaffold_9:17891..39404+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_045471 ID=XLOC_045471|Name=XLOC_045471|organism=Clytia hemisphaerica|type=gene|length=21514bp|location=Sequence derived from alignment at scaffold_9:17891..39404+ (Clytia hemisphaerica)
GAATAATTAGCAAGAAGGAAATGTTGGAATAATTATCGAGGTCAAGCAGA GGACAAACCATGTAGGCTGTGTGGGTGGAAGCTCggaataagagaaaaaa atactgAAATCTGAAAATCATACAGTATTCCCCTTTTCTACACACATTCT ACGGACAAATCACCAAAGACATAAATAAGCAAAGAGAATCAATACAGGAG CCATGATTATGGGTGAGTATTTTTCATCTTATTTTCTTATGATTCTTTCA AAAGCTTAAATTCACCAATACCTTTTTACTCACGTCTTGGATAACCTGGA TAACCTGGTAACACCCCgatgtcacagacccggtggaccccggtggaaaa ataggccaaaaaatcgtccccggtggaaaaaatatcctacaactTCAACT CCACTGGGAAATTGccctatgattttatccccattgaaaactgaatgtaa aaaattgcactccgaaaccatccccactggaattttcgagctggaaacaa tagattttctatccccatttgcattttgatagaaattttcatccccactg agggaaaaagttctaccgggacattgagacaggggtgtctggTAATTGCA GACATTGCAATGGTTCACCCCACATGGTTCCACACATGTCACGAAAATTT GAAGCAAAAATAcattattacacgaatattactgggcaagtattcaacgg ccttgaaatttggacGATCCGAAATTAACACGAAAATTCTTGTGATATGT CAGATCTTGCAAGGTCGTACCAAGATCTTGCCAAGAAAATCTAAGATCTT AGATAATAAAGGATCTTACAAGATAATACAAGAATATTTTCCAAGATTGC AAAAGGGAAAACATATTGTAAAGTACGAACTTAGAATATCTTCTCAATCT tgataaaatctctaaaattttgCATAATAAAGGATCGTATAACATTCGGT TGAAGAATCGTCCCAAATTGGAGGAATTAAATCCTGCTGGAATTTGACTT GGAGAATTCCAAAATTTAGAGCGTTCTAaaataaacaagacgacttgaag tcgaaaatttcgcctaaagttTAAGCTGCATGGGAAAAGcaagaagtaga gatggaagctaatctgaaatgtACTTTACAAttagccttgatgaaacaat tttataagaacaacgaggctcaaaatcgctaaaaaaaataaccaatttaa gaacaatggttgtttaattcttaagaactaaCAACCCAAGggtatcaccg tctatcaagatttatttatttgatttttataaagtaaatgcttataagaa caataaatatgctcatattgtgtgacatcccttgtttactttgtaagaac taactAAAATTCTAattgtttttaattgtttcatTCATCTTTTGAGACTT CATTTTATGTCTCAACAGATACggttttctagaaaaaaaaagttttctat tCATTTGCAATTTGTTTTAGATGAGGAAGGAGTGTTTGTAGATatgttga taaaaaaattttttaaacggaTTTTTAATTCCTGCTCAAgggaaattttt cttaaaacgaAGCGCTTTCTCCTCCTCCTTTTCCAGTGCGCGGTTTTTTA CCGCCATTATACGCCCATGTACAATATTTCCACCACGCACCACACCGCCC GTTTTTCATGTAAACAGTAGGGTGTTCTTTGTCCAAGACGGAAGACTCTT CAAGACACGTCGAGGAAATATGCGTACGGTGCTATATactccttgccgat cgggaaacgtcgcccggctcggaagcgtattgttgatcggaccatactgc tttctaaccgtcaaaacaaagatggagTCAAAAAATAGACAAGAACTtgt tgctctttcgctatttttctttggcttTTATGCTTTCATGAGTTGAAATG GgtcatgatttttgtacgattgtcacaaggaatggtccATGATGAACTTA TTATTcttttctggatttgatgtctCGTTTACATTTTGTTGGTttagaat ttcaatttcaatgagAGATACAATGAAAATCTCTTTTGTTATTGGAAAAA CAAGacattttgtcaactttcacaacaaactaacttcaattttgcctgta tatttacCTAAATTGTaacaaggcaagtgactgtgaataaatctgaccac gTTATACCTGTAAAATTACAtacttgcgacatcaaaaaaatttgaattca cTTTATGGTAATGCGCACTCAGCAATGGCTGAATGGTCAGATGGTTGGTG ATGAACTATATGATAAGCtttgagctaaaaatttaaacatggagcaaaat cgactggttaatgattgaattttccTTGGTGTTTTTATCTTCAATATCAA TAATGAATTGATTGGTTAGTGACAGTTAAGTGAAAACTCTTTGTGGGGAA AAAATTCTGTTGCGGTTACAGAActgtaatttcaaactttctaagctgat aaccggaacaccacggccaatatgaagaatgttcactcataaaatgttta ttgtaccgtcaactgctctaacttgggactatatctgacaaaacatggga cgacaattcagccaccatttcacccaccatttcaccgaacctccaaagtc atttgtcatttaatttgagttaatgaacgacgttttaaaaaatacacaat ttctcgttcgcaccgagtaggcttttaaagcaaaaaaaatctgtcttgaa cttggagattttcttccctgTGCTTTTAAAGCGTGGAAAACTTTGGTTGT GGAGATTTTTTTCCACGTGTATTTTAAACCTGGAAttgttgtgaatttgg agattttcttcagtgcgcatttaaaacgtggaaaacttttgttgtgaact tgacattttcttccacatgcatttaaaaaatgaagaaaattttggtgtca attgacaattttttcgagtgatttcctggcatgacaatttttttttcttt ttgacatttttttggaaattatgattgtttACAAGTATGTGACATTgttt gcttttgcagcatgcttttggaaatcataaaatggcttctgttaggggaa ttttttccctgttttgaaagttttttactttttggcatgtatttcaaaaa atataactccaaaagttactttgatttttacctttttaccaatattttat atatgaaagtatacaGTATGCAAAATATCTAATCtccttttgaaaatata aaatttcctttggttttcttactgtaaaatattctcttttttgtcattct ttcatttcagataTTTGCCCTTTGTGGCTAATATTTCTGGCAACAAGTGC TTTAAATAATAATGATATAATTATGCACTATTTCAatggcttttgatgtg ttcaacaacactctactcggtgGGTGCGACACCGGGTGACAGCTAGTATA ATTACTAAAATCCAActaaagtccacctaacgaaaattaaaggtTGTCTA GTCAATTTGGTTACTGCATTGTTAATCTCAGTTGAGTTCAGCTTGAATAT ACTCTGTGATCCGTATGTTTGAACCTTAggaataatcctgtaaatactga CAATTACATAAATGGAATAATGAAGttcttagggacttgtgttgcttgat gttttCTGAGATAAAGCACTttaatcttttgaggacatcaataattattt tatcatttgtaaaggaaatatttatccgcatcttttcAATAACCTTTAAT ACTAATTAATTATATCTACAGTATACTCACTTTTTGTATTTCAAATCAAC AAATGACCGAAATTATATTCCTTTTTAATTTGGGATTCACCTTGATCTGC ATTATTTTTTATAGGGGAGGGGTACTTTTCTATAGTACACATTCTTTTGT TTGGGTTTCAAAAGTACACTTTTTTATGCATACTTAtacgaaatttgcga aaaaataataacatgcTCAGTTCCAAGCTgagaaaatttatcattcaaag tTTTGAATTGAGACTAGCGAgacagaaaagaaaagaaataatgaactaat taattgattaattaattaattaaacggtaataattataattattattCTG ATAACTATGGAAATAAAAGTCGAAAGCGTCTGAGCCTCGATTATGTATAG GCGGCGCTTTTAGACCACGTCGAAGATCCTTTGTATTTTTTCGACGTGGT AGCTCTTTTGTCTTAGATCCGCCAGTGATTATGCTTAGTGTTTCTATTGT TCTATAACAATagatctattgttttcaagtccaAATCTTAGGCTGGATAT GCTTAAAaactttattcttataaaaaggtgtatcaaacctttgaattttt tctttaagcaTGTGCCTAAGCATAATTTGAGgcttgaaatgaaattttgc taaACATATTGCATCAATCTAATTTCcctgtatgcttataaaaaaagaga gtACGCACCACCGTCTCTTCTCTGTGACCCACTGGTCACCCCAGTgaaaa aatcgcttaaaaaagcTCCAGTGAAAATAATGCTCACCCTAGTGAAAAGT AGGATACTTTCTCTCACTCTAGGcgtaaaacaaagaaatataaagaTTTT CATGACCCCACTGAAAAAATAATACCATTTTACCCAACCCAGTGGGTTTG AAGTTTGACTTtcgcacatttcaacttttggtacccactgggtcacagag gcAAAGACGGAtgtaaaagtgatttttatctggtgattgaaaaaaatcaa ctttgatataGCTCTAGTGCTTTAACATGATGCAAAGCCActaatggttt taatttaggTATTTNGGGTAGAAAGTTTCGagctttcaacattcaattca tttttgattgactACATTACATTgcaaaaagtctaatttttacatttttt tttattgacaCTGTCGTTATGTATATTATATAGATGTTATGGAGGAAATT TTTAACCGCATcttttgcggctcttgttttttattgattttagacCTGAG GATGATCGTAAGATCgaaatatacacgttttttttattagaacctagttt ataagaacatttaggctgaaattcgtcgaaaatttaagaacatcgtaaga acatgcccggcctcagtttggaaaaaaatgacaagaaactacaatttttt cctcttttcaagcagttttaactgaacttagggatgaattttctaaaatc gagagtcaaatattgtccaaatttNGtcatgaaatcaaaaaaaacaactA TGTCTTtccttttataagcatactgagaCCTGGGGAATCGGTGATAAAAT AAGCATATCAGTGAGCATTGGTCATGGGTTGTGTACTTTGGAagattcat ttttcttttccattttaaaTGAACCTTGGAAAAATTCAGTGAACAGAGAG CTTGCTATATTTGCTTGCTTAATTCGGTGCCAGAAGAAtctacagaaaaa atcaatctCTTTTTTTCGGAAAGATAAGCATAATTTATGATTGATTCCAA AATATAGCTAAGCATAACTGAGCCTGTTTTCCAAAGAAaatatgcttata gaaaaaacatgtattatttCGTAGCCCCTGGTACCTTGATCTACTTAACA AAGATTAAAATCTATCAGCCTGTAAGATCTTACCTAAAATTCTTAAATCC ATGAACCCTTTTGACATGTGAGATCTTGCCTAATCTTGCAAGGTTCTTGA ATGCATGAAACCTTTGACATGTAAGATCTTNAaactcgggaaaggtgtat tgtatGTCAAAGGAAGAAAACTTGTGTAGCAGTCTTTAGCAAGTGTACAT AGCCTCGCAGTTAgtcatgaaattaaaaaaatgtctttccttttataagc atactgagaCCTGGGGAATCGGtgaaaaataagcatatcaGTGAGCATTG GTCATGGGTTGTGTACTTTGGAagattcatttttcttttccattttaaaT GAACCTTGGAAAAATTCAGTGAACAGAGAGCTTGCTATATTTGCTTGCTT AATTCGGTGCCAGAAGAAtctacagaaaaaatcaatctCTTTTTTTCGGA AAGATAAGCATAATTTATGATTGATTCCAAAATATAGCTAAGCATAACTG AGCCTGTTTTCCAAAGAAaatatgcttatagaaaaaacatgtattatttC GTAGCCCCTGGTACCTTGATCTACTTAACAAAGATTAAAATCTATCAGCC TGTAAGATCTTACCTAAAATTCTTAAATCCATGAACCCTTTTGACATGTG AGATCTTGCCTAATCTTGCAAGGTTCTTGAATGCATGAAACCTTTGACAT GTAAGATCTTACCTAATCTTGCAAGGTTCTTGgataatcttttttctttc cgtGTAAGATCCTGTACTACTCTGCAAGATCGTGCACGAATTTTGGCAAG ATTCTTACAAGATCTTGCAAAGATCTTACATAAGATCTTGGAAGTACCTG CAAAATCTTATCAAGATTTTTGACCAGGGTggtctttaaagaaaaaaaga tatgGCAAAACTTTCAGTCTTCCAAAACGACTGCCTCAGAATCATGACTG GGAAACGCAGAATCGACAGAACAAAAATAGTAGATTTAAAGCGTACTCTT GGTGTCAAGATGGATATCCTTGATATGATCAAAAGGAGGAGAATGAACTC GTTTGGTCACTGCATGAAGAGACCCCAATATCAACTATGTGCGCAAGGCT TAGCatgattttaaggaaaaaagtcCCCGTGGACGTCCCCCCAAAAGATG GGGCGATCTAATCCGAGAAGACACAGGGATACCACTTCTTACTGCTGAGC GCCGTGCCCGTGACAGAGAAAAGTGGAAAGAGTTTGTTTCCAAGAAGTGT GCAAAGAACCACGTGGGATTATGCACTCAAGTCAAGTAAGTCAAGTcagc tggttttaattaagagGGTTTCTATTAACATAAAATCTTTCACTTCGTGT TTAAAAactgactagtaatattcgtgtaataggTGTCAATGAGCTGTCTA GTAaaccatgataggcaagaaaaaacaatcctaaaaattgtcaaaataaa atggaagcctaaaaaaattaaatgatcATTCAgaatgtcgattggcaaga taaatacaaaggaatcttcgaaaaattttgTGGAGAGGCCAAagtcaata tattttaaattgtgcccccaattttccaaagtggcgcACCGACCaaccag tttctaaacttttaccaaTTCATTTGCCttggcataatgaggaaggaaat atttaatgaaTAAGAGTAGATATATATTTGATaaatggaaaagggaaaaa caggccccaccatggttgggtctctactagaaaaattttgaagatcgact gccaagataccctaaatcactaaataaaaatagacaaatttgacacttgc tagagtgaaaagaaccttaaagaaacaatgtgtaatgcgagcaaagcgag cgaaaaaattgatgttttatgatgtcaatattgttgtcagcaaattggtc ttaGGATGCAGTTAGATTTCTATTTAATAATGCTACAGTATATTGTGCAC AAAAAAACTTACCAAGTAACTCTATTGCGAGCGAAgtgagcgaaaaaaat tgcatgtAATTTAGAATCATCCCAGTAAAATTAGTCtcgggcgcaattta aggcgcatatAAGGTATGAGTTTTTGAGATTGGGGCGTTTTAAAAAATCT CTACGTTGAGGCtagtttgaaatgttttcgatgAATCTCGGGACTATTAt tcccaaatcaccctccaaaccatgttattactagtacaaatttgCTTCTT AGGTGAGTTACGCCTGAACGTAGTGAGGGCTATTTGTTTTCGATGAATCT CGGGACTATTAttcccaaatcaccctccaaaccatgttattactagtaca aattttCTTCTGATGGATTCTTAGGTGAGTTACGTAAAAATTTGGAGTTC AAGTGTAAACATACCCTCTTAATAATCATGTAAATCACTAATGAAGCTAT TACTCAAAAAAGCAATTAGCAGCTAGAAAATATCTATTTGAAAATTATGG AAAAGCACTCTTAATTACGTTATGAGATGGTTGCTTGATTGCTTGATTTA TGTTGATACCTTTAACCCCGCGTGACACGTccttcttttgtaaaaaaatc tctagtttaaactttaaaggcttatatatCCGGATTTGGAAGGAGTAAGA AGCTCATTCATAGTTCGTTGgatagagtctcttctttcttttaggcGCTG GGCAGACCTGCCTGAATGACAGAAAGGTTTGCTACATGACAGAATCAAGT AAggcagggccaaatttggaggttcatggatcactcgttgaccaaacatg gtcaaaaaacggtctaaatctaaaaaaagtggatttttgtcaaattgttg catttttttgactttttggcttaaaatctcgcaggaaagactcacttttg attttttttttttgcttgaccatgaagcccaatccaattcctacgagtta gaccaaaaatgacgatttctattCAAACTgagcattacaggagggcttcc cCTCCTATATAgcagcccatgtctgatatactCGTCAttggcagttaaag ggttaaaggggacacgagaagttgtTTTCGCGTTGgtacaatgcaacatg ctctatcccaccaacacaagtgtctcatggtttctttttttgtttcatgg gacaaaaaaatgagagaaatacCAAAATATACGTGGAATTTGTACCTGat tcaaatcaattttgctccattgtcccagcgACCAAAGTCAGATTTcaatt ttattggtagaaagaaaaatggggtggagatacgagaaagcgtttcaggt tggtgggatggagaaTGTTGCagtgcaccaacgcgaaaaaagacttctcg tgtccccaagccttcaGAGCCTtataaagtatttattttcaaactcagTA CATGACGTCTCATGAGAAATTTTAGAGGGTGCTATTTAGAAGGGGTAtta atttgcttgtttttcaaacatgaagaagaagaaagcaGTGTTCAAAACAA ATTGAgaaagaaataaattttttgaaaaaaaattgggtatgGTTGTGGGG TACCCCTTTTTTGCNgtgcaccaacgcgaaaaaagacttctcgtgtcccc aagcctttagagCCTGTATAAAGTATTATTTTCAAACTCAGTACATGACG TGAAAAAAAGTTGGgttaggttgtggggtaccccTTTTTTGCCAAATATT TAGCCTAGTGTTATAATTTGTGAAAGTACAATGTTAGAACATTTTAACTG TCATTTAAAGAAATCAGGTTTAAATTTGCTCCGTACCTTTAGTTACTGTA gtcctttttttaaaaaagtactAAAATCTACTTCTGTTTACTGAGTGCGG TCGCTATCTTATCTTCCTTGCTCTcacactttgaaaaattacagaccaga ccaTTTTTTTATGGATTCCATTTCCAAATATATTCTGTACCTTACCGAAT ATTTTTGGAATCCCAACTTTCTAGCAGagactcaaaatgaaaatgggAAC AACATTAACAATCATAAGATCAAAGGATAATTTACGCATACCTACGCATT GTTTTCATAAGAACagccaaagtttttgaagccttgggatgttcttaagt ttttgagttttaaggctaaaaatgttcttaacatgttcttattctcGCCA ttctttgaccatttttacccattttcctaagaattcGGATGTTTTTGACT CCATAaagccttataatgttcttaacttgttcttaagattttggcagtcg aagccttatgttcttatatcgTTTGGTATATAGAGTCTAAGTTCAAGTTC AAACAATCTCTGAGGATGTGTTAAGTTAAATCTTTGAATATCTTCTACAT CATAAATGAATAAtcagaatattttttcaaaattttaccccctggctcCA TGaggattaaaagaaaaatatttttttactctGGTCTGTGAAATACANTC CATGAggattaaaagaaaaagaattttttactCTGGTCTGTGAAATACCC GGCTATCCCACAACCTCACcaaattggctaccctgcttttcaGACAAACT CTGAAGTAGTTTAGCCATCGCGGCTAGCCATCGGGCGTAGACATACTAGC GTGAATagctctgaaaatttgaaaattagatttttgaaaatgaaaaggaa acAGATAATGGATGTTCAATTTCAAAACGCTTTCAAAAGCGTGTTTCTCG GCGATCGAAGAAAGACGAGAAACGAGTTTCTCAACGGTTTCGCAGGCTAG CGCCTAATGCTGCTTTATATATCTTACGCACGCAGATTGGGACAAGCTGC GCGCATgcgttgaaaatatatttaaaatggTACCTTTCGATTCTGATAAT CCTCGCATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNATatcgatgttttataagaaacacttcttataaatatcgatgttt tataagaaacattttttataagaatatcgatcttcccagttagggtcagg gttgaaGTCCGAAATAATGGCATAATTAGCGCTAATTATGCTattaatga tgtaatctttactaTACGAGATTTTACATTGACCGCACTCATAATATAGA TTGTTGCAGGATTTATTCACTCTGATTTTATGTCTTTTTATTGATTGATC AATGAGGTTACCATTGAAGCGTAATTAAAAAATAAGTATTATAGGGAACg tgcatggcgttctaaatctagaaTTCAGAACGCCATGGGAACGTGTTTTA CAATTACATGTAATTAGAAAGGAATTCTGACTTATTTGAAcatatttcga aattttacatAACGTTTCCACAGCTATTAGAGAAGAGAGAATTTACACTG CCGGTTTTAAGACAaaagagcaagtacgtcggaaacatgcaaAGGAGTGC AAAAGCTTTATGATTGATCTGATTATTTAGATATTTAACAGAATGATATT TGGAACTACTTTTATCCTGTTTATGTTGAAGTTGTGGtatgataaaattt tatgagATATTTGTTTGTTGTTGCTGCAAATTTTGTCTGATATTAGTTTT TCATGGTTTCAAAGCACAATTTCAATTGAAAACTTGGTTAATAGAAATTG AAGTGAATAAAGACAACTTTTGACAAAGAAAACATGTTTTTTGAAACCTC ACATCGACAAACCCGGCTTCAGTGCCCCGGTTGAGCTTTTTCACTTAGTA TGGGAATGAAAACTTCAATCTAAATTCCAATGGAAATAAAAGATCTATCA CAtgttttttgttataagaacaaactatatataagGCTTAGATagccaaa aatattaagaacaagttaagaacattttaaagctttgcggaCCCTAAAAC ACCCGATCTCTTGGGAAATTCGACaaattcttaacttgttcttaacattt tgtacATCGAAGTCTTATcttcttatatggtttgttcttataaaaaaaac ctgtaTCGAAAATGCTCCAAATTAGCCAAAATTTGTGTAGAATCACACTA GAAACTGACCCAAAGTaattttagggtttttttttgttaattttttcaaa tctgtcttttaaaggtgttttgaTAATAATCGTATTATAAAATGAAGGAG CATAATAAATCGGAAGATGAAATCCTTGCNCTgtcttttaaaggtgtttt gaTAATAATCGTATTATAAAATGAAGGAGCATAATAAATCGGAAGATGAA ATCCTTGCTTCATGGTTGGTCAAACGCAGAAGAACAACAATCCTTGGTGT GATGCAAAGATCACTCTTCGCATTTGAATATTCTGCTGTTGCTGTGTCAG CACTTTATTACTATCGATACACATTGAAAGTACACGATGCAAAATTGTTT TACTCTTTTAGCATGGCTGTCATGTTTCTGTCTGCTGCTGCGTCTGCCAT GTTTATTGGACGATATATGGATCAGACACGGCATTTAAGACGTATTGCAT TAACAACAGCGATGTTCTCAGTAATTGGAAACGTCTTTTATACGATACCG TATTCAAGATACTTTCCGATTATTGCTCGCACTTTGTGCGGAGTTTCTGA CGGAATCCAACCAGCAATGGCAGGTAATCAAATTTCTTCCAACAAACAAA ATGATGTAGTCAAAAGTTATTTAGTACCTAAAGAAAGTTAGATTAGACCT TAAGAGGAAATCCAATAACGAAAGGATGTTGTGTGGGTATCGTGAAAGTC ATTATTGTACCTTCTCATGCACCGTGGTAGCAAATTTTCCTCCCAAAGCA GCTCAAGCCCTGGTTTTAGAATTCATAACGGCCCAAGACCTTAATATTAG CTTTAAAGGTTCCAAATAACAAATAGGACAATTTCATTACAAGATCACGG TTCGTAAataccatagtccgtataaccccggtctggaagccttttgtttc tttccattgtttcttaattgaacttgcgttgagaaattagtttgttttgt tcactttttgatcatgtgattaaNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNtgtgattaaatcttaaaccaatccca agaggaatatttggtaacgtgatcaaaaactgagcaaatcgatttttatc ttttgataataacaaaggaaaaactaacaaaaagttaaaacaataagctt ccagaccagggttttttataaggactatgTAAATACTCACTGTGAAAGCA AATGTCAGTCCTATTCAAGTGAGAACAAAAGGTAGCCATGACAGCAAGCT AGTCCAGTCTTTGAGACTAACAAAGTAGATGTGTTTGAATTTCCTTGGTG GAATCAAGTAGCGCAAAAAGtctgttttgtaaaaaaaatatatagaatgt attttttgactttcaACTTATTTCTATCTGGTCGATATAGTAATAAATTC TCTCCATCTCAATTGTATTAAAATGTGGTTTCAAGTAATTGCCAAAATAT ATGAAATGTTGAGAGTGCGTGCGacgaaataataaaaaaatcaaatgttc ATTATTGTGTATAATTATCGCAATGATAcaactagtgtatatgtataaga attgcgaagcgattcaggcaagtcactcgattcgcaagttgcaagcaaaa tatttatagggtcagTAGAATCGTAAATACAAACCCTAGATACAACTGCT CAGGTCCAGGAAGACTGTGCCCCTTTAGAGATTTACTCAAACACTCCAGG CGTACAACAAACTTACAACGTTTACTTCtacgaatttgaggaaaattata caaattgTTTCACAAATCGTTGGAAAATCAGCAATTTCAAATGAATNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNTCTCTACTACCAAGATCCAATCATCTAAGGAA TGGTTCTCCCACCATCATAATACAGTTTATTTTCCAGCTTTGAACCTCTT TTTGCAACGAAGCAACAACTCCGTCGAGGCTGCTGTCCTGTTGACGgaac aataaaaattccatcttccTTCTTCCTCCAGctgctttcttcgtttcttt tcatcaagcaccGTTTCTTTTCAAAGCACCAACGTCTCTTTTCAAAACAA CAATGATTTTATTTTTCAAAGacagagtcaacattcgaattcagagtcaa cattcgaatttggaaaagttcgaaaatcttttcccgagtcaatgcaacga cttcttggAAAAAGAGCGtttgaacgcttccagcccgcgctgattttcca atctcttttttaaatttcctaatttaaacatTAGGGAGATAATCGAAACA GAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNTCAAGGCAAGATTATCTCCGCAACATTTTA GATCTGGTATACATCCTCTACACTAAAAACCAATTGTTCCAAATTTACGG AAGCGACGGATAGAAATGTACGAGAAAGTGCCGCCTGATGGATCGAAATG ATGTTTTCGGTACCGTAGAAAGCGCACATCAATTTTTCCTTGGCGCTCCc ctggtatatagaatttaaaggtacatgcacacgatagcaaaactgcttcg ctcatgtatattcgcttcgcaaaaatatTAAACATATAAGGCTTCTTATC CTAGAAGTTCAAGGAATGGTCTAGTGTTCCATTCACTTCATAGTCCTACA AGAATAACCGATAGCGAAGCGCTACAATAGCCCCTGCGGGCaattatcat atttttccaaaaaaatataaatcttgaaaattgggtaaaaattgcaatgt tTCTCTGACCTGTTTGTGAACTAATAGAACTTATTACTTAAAAACGCTAG CTGAACGTTGAATTGAAGCTTAGTTGCGGAGAGGAGATCATTCGTCACAA GCCCCAGGGCATCATATTATTGACCGACATGTATAATCAGCCTCGTATCC ATATATCCCAGGCTTAATATTTACGTTTTACGTTGACGCACGAGAGGTTA TATTATCTCCCGCTCTCAGTAAAACGTCAgcaaaatccgctgggagttaa tcaccatggtaataatTTCAATTAATTACCCGATGCACAACAATTGTACA ATTTTCGAATTTCAAAaggaggcaagtgatgttcgtaacgtaatttatga aaaggtctatagtgATAGAATCAGTATATTTCTACTGTACGATGTAAACG GGGCTTTATGAATTAACGTAATCTAAATTAGCAAAAGAAGAATAGATTAT TAATGGAATTGATTGAAAACAGCTTGagttattttgaaaagtttaattGC ACCTGCATTCTTTGTAGTTTGTATTTAATGAGAACGACCAAAATTTTCCT CGATATTGTTAACGCTCTCCAATTTAAATATTTAGCAATTATCTGTTTCT TTAATAAGAGTCTACTGATGAAATAGTTAATTGAAAACAGCTTGAGCTAT TCTAATTCCTTTTAAAATAACCTCAGAAACCGTCGAATTCATGCATTTTA TTACTAATGATGAGTTATTTGTTTTGTCTCTGTCCTCAGGTCAGGTTATC ATACTTTCACATAATTAGTGCAGTTACTTTATTTGTAatttatttaaagg ttttgttttgattgaaaggtctgatgatgatgatgatgtagtaaaaacaa gtgcgacaagattagaaaaaggttttgaaaaaatgaaaatacattagata aaaaaatattcCTCAATTCAAACTTAAGGgacttttactgatactcttta gaattcttttatatttataataaatacagttgacgctctctaattcgacg ttctaccattcgatgaaatttaaagtccccgtcaacaagaaactcttcta aacgacgctcccttattcgatgagctcccttattcgatgaaaatccaatt ccccttgaagatcgaattggagagcgtcaactgtagatcgttttctatct tataatcaaaacattcgatcgtaaatttgctcgaaatcaactttgctatt tttttgttttcaaaatcaatagaatgtggggtcacatctcgaaacaactt tcgatctttcacttgtttgctagtctgaatcgcagacctctacaaaaccc caggtagtataggtctgtttaatgatctaccaaccgctttccggttcgca aaggaaatcttggcgagttaataatttgattgacattgatgtgcgcgcga aaacgatcgtttcgaacgttttcaatgcaatgtttacattcgaaattcga atcccagaccagaaaaacaaaacagaaaaaagaaaaaaacaatctgatgc gcgcattatgtacagtctatagatttatttttgacttttgcttttataag atatctggtctgtaaatttatcaaaacttttccatcagctcttctagtag ggggaaatttgttcgtttttttaaggttgctcgatttttttagtcaaagc acttgttatacatttttggaaagccaatgggtaggggaatcaaaataagt tgggtgccaatttttttcggacgctttggtgtgattttcggacaaatgcg acggtctcgggcaaaaatcatagggtgaaaaatttgtcataattgtcttt atgtgcatgttttgagtgtatttttaagcaatctagagctcaaattttca aaatttcccccttcgggccaaaccatggtttggccctcgcggtgtcacta aacttcagccccccccaatatgaaaatacttcctacggcactggttGTTC AATATGCTATCTGTATGATAGCAGGCTTTAATTCAAAGTttggcgaggcc aatttaatatATTGGTTTatgggccaagctacccaaaaaaagaAGGTCGC TCGGTcggcaaaaaaataaaagtataaATGGCAGCAAAatctacatcttg acaaaaatgcgaaataaaaagacacaaaaagctctCATGGATTAAATGAA AAACTGGAcacaaaattctcaaaaccttggaaaaactactaaaatcttga aaatttggcagtctgtaaagcaatgaagaaaaaaaagtacTGCCAAAATC AATCTTATTTTTATtcggatttttttaatttcagggtcggtcaggcccgt aaaacaactaatcgaATTATTCTCGCCTATCTAACCTTAATTCTCAGTCG AATTGagcataatttttattttctttattttcaaaaaatattttagtacc CAAAGAGTTaaagcgacaacaaaagaaatctacTAACCCAAAAAATATCT CTCTTAAGGGCAAGACCAGGTCTATATGAcaagccgtttttccattgttt tcaagaaactgTTTTTCCATCGCTTAACATTCCTCTGGCGAAGCTCGGGT GAAACGTGTAATCATTTCGTGATCACATGATAACAAGtgaaattcgaaaa ttgcactcgtcatttttttgttttaaattttcctaTTCCTATCGGACTTG GAAATGTAAAGGCACAGTCCGGCTATATTTAAGGGTCCTCTATGAATTTT GCACTGACAACGCATGATAGATTCCATTTGTCCAAACTACTATACCGGTC TCAGACTCATCCCTTGAAACAAAGGCTTTAAACGACGAAAAGATCCATTa cgtttaaaaaataatttgtatAAATGATTTTGTGAGTTTGTTTCGTTTGT GTTCTGAATTGTTACGGACAAAAGGATTGATAATGGATTCTCTCCTACAG ATGTAAACCCACCCCTAGTGAAATTCGAAAATCGCACTCGTAATTTTTTA GCTTCTTAACTTTCCTTCCGTCTTTTCAGActcggaaaaataaaaattca ctCGGGCAATTATTTTCTAATTGGACTTTGGCGCCGTAGGAAGAAATTTC ATAATTTGGGAGCAGAGGTTAATTGGGAGCACGAGGGTCAACCATATTTG GCCCAaggcaaaagttttgaaaatttaagatcAAGATGCTGAaaaatgca ctcaaaataaAAGGTCATTATgataaattcaaagaaaaacatcctccatt ttacaaaaaaaaaacatccctCAAAAAattagtgggggggggggggggNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNaaaaacaatctgatgcgcgcattatgt acagtctatagatttatttttgacttttgctttaataagatatctggtct gtaaatttatcaaaacttttccatcagctcttctagtagggggaaatttg ttcgtttttttgaggtcgctcgatttttttagtcaaagcacttgttatac atttttggaaagctaaggaaCATCCCTCAAGAAATTAGTGGGAGGGGGGA GGTAAAGTCCCTCTTGCCCCCTCCCCcggttgctacggcactgcactCGT TATCGTGTGATTGCATCTATTACTAATCAATCTTCCtccattaaatttca aaacagaacAAATAACAATGGACAATGATTCGATTATTAAATGACAAAGG AATTTACTAGGGGAACGTATTATCAGAAAATTGGTATCACGAGGCAGCAT ATTCAAAAGCTTTCAACTTAAAGACACAACAGCACAATACTtttgttttg tcatttttcaggTGAATTCGCACGAGTTTACACAAAGGAAGAATTTGCTA AAGTGCTATCCATCTATCAAATATCAGCTTCTGTCATATACGCCCTTGCA CCCTGTACACCCGTCCTTTTCAATGGCGTTCATTTCTACATTGGACCAAT AGAAATCAACCAATATAACTGCATCAGTCTGGTTTTAATCATTTTAGTCC TGGTTTACACGTTGCTCGTTTACATTAATGTTACTGATCTGACCAAAGAA GATGGTTATCATATTTTTGTAGCTAAGTATAAGAATGACATTAACGAGGA TGATGTTTCTCCGTCCGGCAAGAAGTCTGATTGGACGTTAATGGATACTC TCACCAACGCCAATCTCCTTGTGTTGATTTTCACGGATGGATTCATCAGT TACATTGATTCTATGATGGAAGTGATGAACAACATGATCGGTTTGTATAA TTTCGGATGGAACATCAATCGAATCAGTGTTTTAACTGGTATTGCAGCAA TCATCTTCAGCGCTGCAAATTTCATCTTTCAACAACGAGTTTTAAAAAGT CGTTTAACTTTTTATCTGTTGTTTAttgtatgttttttatttgCAATGAT GGAACTTTCTCTTGCAACTATCTCAATTAATATACCTCTCAATGTGGACG CAATTAAATTCACTTTATTTACTTCTTGTATTGGATTGAATATTTTGTTT GGGTTTGGATCAGGTGTTTATTCAAAATGGTTGATTTTTTCATTGGTACC AGCAGATTCAAAGAGCTTTATAGAATCACAACGATACGTTGTTGCCAAGT CGTTTATGTGTTGCGGATATTTCACCGCTTTTCTAATGTACCAGGAAAGT TTTTATGGGTTCACGATACTTTCGTGTATTTGCTTTGCTATCGTCACATT CTTGCTTCTGTGGAGATGCAAGTTTACAAACGAATAAAGATTAAAACAGA ATTGTTATAATTTGACTTTAAAGGCaaaattattttgcaaaatgtaaATG TGAGTAAGTGGGGCTCAGATCTGAGTAAAATGATGATGAACACTTTGGCT CTCGCTcgtctacaatcagtgccatttaacatattggcaatttttggtta ttttaccGTTTCTT
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00073288TCONS_00073288Clytia hemisphaericatranscript
TCONS_00073289TCONS_00073289Clytia hemisphaericatranscript
TCONS_00073290TCONS_00073290Clytia hemisphaericatranscript
TCONS_00073291TCONS_00073291Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00073291-proteinTCONS_00073291-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_9supercontigscaffold_9:17891..39404 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.07 0.68 0.25 0.13 1.96 1.16 1.42 1.72 1.3 1.77 0.74 0.62 8.02 7.5 3.97 3.53 0.62 1.49 3.65 1.75 0.12 0.35 0.19 0.35 0.03 0 0 0 0.11 0