Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_001010 (gene) - C. hemisphaerica

Overview
NameXLOC_001010
Unique NameXLOC_001010
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000012:854410..872272-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_001010 ID=XLOC_001010|Name=XLOC_001010|organism=Clytia hemisphaerica|type=gene|length=17863bp|location=Sequence derived from alignment at sc0000012:854410..872272- (Clytia hemisphaerica)
AAAAGGAGAGAGAATAGAGACACAATAACAACTTTCGAGAAAGGGCAAGG ACAGGTCATTAATCATTCAATGATGACATTATAAAAGACAGTGCTAATTT TTTACCTCTTGCAACAAACAAACTGACTTTGATTTTCATTTTTCATTAAT GGCAGCAGACTGTCGGCATTTTGTGGCTGTCTGATTTTTCCGTTTTACAC AACGTCGACATTTTGCTTTTTTGAGGGAAATTGGACTGGAATCTTGATTT TGCAGCAACTTCTCAAAAGACATTAGCTCCAGGTTAGATAAAATTTTATT TATTTACTCATTTATTTTCTTCAGACTTTTCAAAACAATTAGGGCTTGGA GAGCAGGAAAGCACAATGTCATCAAAGCAATTCTTGGCAAAGTTGGCGCT TAGCGGCGGAAAGAAACGGTTGACAAAATTAATCGTCCTATCAATTCCAA AGATCTAAAACGTTTTACATATTTAAATATAGTTTTGAACAACCTAAATA AGGTATTTTTTTATCACTTTCCAATAAATCAAAATTTATTACTGATAAAA TGGGTGATTTTATTCATGATTATCAATAAAAGGTATCGAATGCGTTCTTT CAAAAAATCTACAATTATATTAGGTCTCTAGAACCTATGATAGATATGTC TGTAGGAACTCAGGTGTCAGGGTTTCTAGAATAACAAGGAAAGATGTGTA CATGATGCTCGGTCGATTTCTTTCTTGTTTTCAATACAATTAAACATTGG GATTTCCGTTGACGATTGTCAGGCTTTTCCTTTTGGAGTTACTGTTACCT AGCATCAAACCATTTGGATAAATGTTCAAATCTTCTCTGTTGTAAGTTTT TTTGGGTGAATTTGGGTAAAAGTTTAACTCTGCTAACTTACAAAAGAATT TCCTTTTCAATTTCTACTAAATTGGGTAACCTTTTACAACCCTGGGTCAC ATACCCGATGGGACCGCCGCCCTAAAATTTCGTCCCTCTGGTGGTAAAAA ATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAATTTTGATGAAGAAGAA AATGAAGACTTTTGCGAGGAAGAGTATTTCAACTTTGAAGAGCTTAGTTT CGGCGAAGAAAAAACATTTTGAACATTTTTTTGCAGTAGATGGTGTATTT TTTACCGAACAATAAAAATTTTTGCGGAAAAATTTTGTAAATACTTCTTT GTCTCGAAATCTTCGAAATAGTGGTTTTTCATCAATTTTTAACTGGATTT TGCTTAAAAAAACAGTCATAACTTTTGACACTTCTTTTTAGAAAAATTTT CCGCAAAATTTAAAATAGTTCAATTCTTTGTGGACAGTATAAAGACATTT TGAAACAAAAAGGTTAATTACCCATTAAAACTTAGCACTTTTTATAAAAG AAGGCGATGCAACATATTATTAACGTCTTTTTAAAGTTCATAACGTCATT TCTGCAATTAAATTCTTAAATACTCTGAAGGGATTTGATTAAAAAGCAAT TTATAAAGGTAATTCTTTGTTGAAAGTGTTAAAGAACCTAAAACATAACT TTTATGTTCAAATACTAAAATCAATTTTCCGACTATGGTCAGAGCCCTTA AGTTTCGCGAATTCGCAAAAATCGCGAAATGCGAATAAAAAGATAAAGGA TTGTTAATTTTGAAATAACTATGTAGCAAGGTGAAGACTTTTAGCAAATA AATCAAATTACATGTTCGTTAAAATCAGCCCACTTAATTGATAATGCAGT TGGAACTATCATTAATGATGCATTTTTATAATAATACCTATTACTGATCC ATTAATTCACTGGTTGCTTGATTCACCTTTCGTCATTTCTTTCGATTTCT ATTATTTAACAAAATTAAAACATTCTTTTGAAATTGGACAAGCCACCTGT GATTACACAAGCTGTATATGTTGAGTTCTTTGCTGAAGAAAATGTTTCGA ACATATTATTTCTTGTTTCAAGAGCCTACAATATTTTACTGTAAAATCAA TTTGAACTTTATTTTAACCCTGGGTAAAAAAGCAGCAAAATTTGAGCAAA TTGGGACAAAAAACCGACCCAATGGTATACCTTAAAGGAAGAAATTTTGG CGGAAAGAAAATTTGGCGGATTTGGCGGATTTAGCCAAAATCCGCCAAAT TAAGTTCCCGCCGAAATTTATTTTTTCCTCCATCCGCCAAATTAAATTCT CGCCAAAATTTCTTCCTTTAAGGTAAATCTTTATTTTTTTGTCCATTATA GGGTAAATATGGGTGGACTTTTTCAAAATTACGAATAATTTAGAATTTGA AAATCAGCTTAAAGCTATAGGAAGAAATCGTTTTAGGACTTCAGGATATG GCACGTGTTTTCGTAAAGAATCATTTTCTATTTAAAGTTACCTTACATAC AAGAGGTATGACAATGGAAAAATATTTTTCCTATCAGATTAATTTCATCG TTAAAAATTGCATTCAAAGTTAATGATAACCAGGTAATCGAATTAAAAGA TAAAACTTTTTTCCTATCGGATTTAATTTGCGGCGGGTGTAAAATAGTTT TGTCTACTCAATAAATATTTATTTTAGGCAGGAAAAAGTAAAATTAAGAA CCTTGCAATGAAAGCAGAAGGCTACACCCCTGTCTCAAAGGCCTGGTGGA CATTTTTCCCTCAGTGAATGAAGATTTGTAACAAAAATCCCAATAGAAAT ATAAATTTTATAGTTCCCAGCTAAAAAAATCCAGTGAGAATGGTTTTGAA TTAATTTTCTTTCATTAAATTTCGAATGGGATAATTGTAGGGTATTTTCC AAACGGGGACGAAATTTCAGCAAAATGTTCTAATATTGCGCGGGCTGTAA ACTACTACTTTTCAATGACCAGCTGTACCAGTAGTTGAAGTTTTTTCCAG CTAATTTAAGTAAATTTTGCAAATAGCTAGTGTATATTCAATGAAAAAGC TAAAAATCAAAATGGGGAACGGAAAATCGCTTGTTTGTTATGGATGGAGA TTCCAACCTTTTATGTTTAATAAAATTCATTGGAGGTTTCAGAGCTTTAG TGTCTTTTCCATAGGGGATGAGAGTTTAGTTTAGTTTCCCAAAAGGATTT TTGCTCACCGCGGGGAAAATATTTTGCATGATTAACTTTTCCAGAAACCC CTACAAGGTCTGTGGCTACAAACGAGGTACATATTAAGATACTAAGATCA TGTATTGTCCTGAACCTGAATAAAATCAAACTATAGGCTGAAAATGATGC CATTCTCAATATCCATTTCCACGTTTTGTGATCTACAAACGTAACATTTT TCTAAGTTTGTCCTAGTGTTACACTTTCTGTCTCCTAGCCTACTTTGATG TTATTACGAGAAGACTTATTTATAAGGATGTTTTCCCTCAACCCAATACC TCGTGTAATTATCGACATAAATAATGACAAGTTTAAAGGGACTGGTATCA AGGGTCATTAAGCAAAACATTTTGAATAGTTTTTTAACTTAACGATGCTA TATTGTTCGTTCATTACCACAAATTAGAAACCACCAAAACAGAATAAATG AAGGCCGTTACCATGGTAATACGTTGTAAACAGTTGACGGAATGTTATTC ACTTCAAACAGATAGGACTATGTCGTTATGATTTTAAAATACAAGCTATT TTATTAGAACAAGTAAATTTTGGCTGAGGCTGGGCTGTTCTTAACTTTCA AACTCCTAAATTTTCAGGCTTATATGTTCTTACGATTTTCTTATAACTAT TAAGTAGTCATATGGTGTCTTGATTTAAAAACTGAAAATGGGTTAAAATC TGTTAAATCCAGTACTTAATAATTTTTAAATCTAAAGCTCAGATTGTTCT TAGATTTTGGCTGGCTAGCCTCATGTTCTTATAAAATTGTTCTTGTGAAA AAAGCGCGTAATAAAAAAATAATAATAGCAATAATAAAAAAAACAGATTT ATTTGCCCTCCTCGGCATTACACTTTTTTTAGTAAGAACAAACTATATAA GGCATAACTAACATAATGCTTCCATGGCCAAAACATTAAGAACAAGTTAA GAACATTTTAAGGCTTCGTAGACTCGAAAACACAGCTAATTTCTTAGGAA AATGGACAAAAATACATAAAAGTGGAGAAAATAAGAACATGTTAAGAACA TGTTTAGGCTTGAAACTGAAAAAGCTAAGAACATTCGAAAGCTTCAAAAA TTTTGGTTGTTCTTAATAAAAAAAAGTGTATTGGTCATATGTTTCGAAAA ATAGGTGTAATCGAAAACTGCTGCACGTTTTTTTATAAGAAACACCCATA TAAGAATGTTGGAAATTGTTGGGCAANTTTTTTATAAGAAACACCCATAT AAGAATGTTCGTTGGGAAATTGTTGGGCAAAGATTAAGAGAATATCTTAA TAATATATATTATGATTTATAAATTGATTTTTGGCTTTCTTCAAGCTTTA TTTAAGCATTTCAAGGTTAATATTTTCAAACAGAATAAATTGAAAAATTG CAAGTTTGTACCTTTCAGAGACCATTACTTGAAAACTAATTTGCCTTAAT CAAATTCTTAGTTGCATTATCAGAGAAACGTATTTAATTCAAAGTAACAC ATTGACAGTTTCTAGGAGGAGGTAACTAAAAAGGAAAAAAAGGGGTAAAA TACTTTAAAAAACCTTAAGTTATACAATAAAAAAATATAGACCAAGAAAA TTAGAATCGAGAAAAATTCGACAAATAAAGAAGAAATAGTTATTTCTTTG TTTTTCAAATTTTATCATTCATGCAGAAAAACCGTCATCCTCTGTCCGAA AAAAAAATCTATTGTTGTTATTCTCTCTTTCAAAGAGTCTTTTCAAGATT TTTGTCTTGCCATCTGAGTCCGCATATATAAGCGACATATTGCATTCGTT TAGTACATATATCTGTACTCACTTGAAGTTTTGTCACTCCTACGATGGCA ATACACCTTTTCGGCCGTAGCCGCCAATTGCCGCGCGAGCTCTTTTTTTC ACATAGAGACAATAGAAAAAGGTGTAAAAAGGATTGGATCGAGTTTAGGG GGATAATTAAATAATAAAGTGGCAAGCGCTTGACTGCGCGACTACGGCCG AAAAGGTGTATACCCTCAGATAGAGAGGCTCTTTGATGATAGTGACAACA TGGAAGTTTGACTTCTGTACGAAGGAATAAAGACCCCTGTCCCGATGCGT ACGATTTTTATTCAGTGGTGATATAATATGGTTAATAAAGGAGCTATAAT TGAGGTATGAGCACGAACCCAGAACATTTTGGAAGTTTTTAGTATTTTTT CCAAGTGGGAAAAGAATCGATTGCATGTTTATCTTATATTTATAGAATTT CTGTAACGCTAGCCAAGCATTAAGAGATTATCTCCGTCTATCACTTTCGC AAATTTAAAAATCCACTTTCCCGTGGAAATAATTGACGTTTTTTGGAATT TTGGTACCCTTGGGGCACAAGGTAATCAAGGTAATTCGTTTTATTTTACA AGGTACCTGTTGACCGCAAAAATTCCAAAATTCGCGAATTGACCGTTGAC AAAATTAGGGGTAAAGGGACCGAATGACGTTACAGATTTGGGAAAAACTT CAAAATGCGATATCTCGAGTTTGAGAAGGAGTTGGGAGGTCGTTGACCCC TCATTGGATCGAGAATACTATGGGGAATAAGATGGGAGGGGTAACAGTGG GTATATAGAAATTTTCAAAAATAAATATATTCAAATTGAGGCATTTTGGG TCCGATGACGTCATCAAAACCTGAAAAATTCGATATCTTGAGTTTGAGAA AGAATTAAGCAATGGTTGACCCCTCATTGGATCGGAAATCATCGAGAGAA TCTTTTGGGTAAATGACAAATTGATTTCAGTGAAGTAAGCAATTTATTGA CCTTTCGATGACGTCATTTAGGGCCCAAAATCGATTGCATGATTATTGAT ATCTATGGGGATTTCTCAAACAGGGCAAAACTATTCGTTGAGTAAATAAG GGCCCGTAAAGGGGTGCCATTTTGTATTTAGCACGAATTTGTGTTCAATA GGCTATTTCACAGTCGAAATGGATCATGGGTAATCAGGACTGATTGCACC CCGATAACGGTTTCCCGTTGTTTAGGGGCAAAAATCTTCAAAATTCTTCA AAACATTCGACCAATAGTAAGTCGTTATTGGCGCGCAGTGGTCCTGATTA CCCATTACGCTTTGCGACTGTGAAGTAGCCTATGGTAAAGTGACTTTTCT TGAGATTGGATATTTCAACACGAAATTGGATATTTTAATACAGATAAGAA GTCAGACATCACGTGGGAAATTTATTCGGAAGTTGTTTAAAAACAGTATC TTGGCAATCTTTAGGAAAGATTTCCATAAATATCTCTCCAGACGTATAAC TTTTAGAAAGTTTTAAAGATTTATCAAGGTTGATATATCTAAAACTTTCC ATCTGTTTCCAAGAAATTTTCCTCCGTGGAGTGGGCTTTTCCAGGAAAAA CCGTACGTATATTTTCCAAGGTTACATTATTTAAAAAATTGTGATAAACA TGTTCATGTCCAGGGGATCGATTTGCCCTTGCGGGTCATGGTCAGAATTT GTCTGATAGAAACCAATTTTTTGTACATTTTCATTAGTTTCAAGTAAACT GATACAGAAGTTTAAAATGAGTCTTAATCCAACAAAATGATAAAGAAAAG AAGAAATAAAGGTACTTGAGGCAATAACAAAGAAAGAGGGGAATTCTATC AATTCCTTAATGATAATGAAGGTTGACTCGAAAGTTGATTTTTCAAAAGA AACCGAACTGTATTAATTATTTCCGTCATCAAAGCATATTGCGTGAAAAA CAAAGGAAAATGTGTAATTTTGTCTTTTTTAGAGTAGATTGACAAAAAGT TTAGATTGCGGCGAGTAAATATTTAGAATATCTTTATAATTATAACGAAC AAAAGGTAATAGGTAATATTGAATACAGTGCATCCTTCTTGACATGGTCA TCAAGAATTTTTAACGACTTCAGTATATTTGCTTTAAAGTCGTATTTTCG CGCCGCACAATGTGTCAACAGTGTTGTGTAGTCTTTGTCACGCCCTGCAC ATGCATGGCATGGAAGAGTTTGTTACTACCTGTTCTCATGTGGTATGTTG GTTATTTTGAAATTTACCGAGAAAGATTTAGCTGTTGGTTTAACTCGTTT AGTACTGTGGGAAACTGAAATTCAACTTCAAATGCAATTTATTTTTTCGG TCCAGTGAAATTATAGGTAGCCGAAAGAATCGTTTATAAATGAAGAAAGT TTAGCTAGGTACTCTAAGGTCTCGAATAGTACGGGGTCCGAATAAAAGGG GGTTCAAAATTGTACCTTCAAAAACCCCAAAATAAGGTAATTGTAAGCTA AGAATAGGCTATTTAGAGCAATACAAAAAGAATTTCTAAAATTAATAAAT GGATGGGGACATTTATTCAGGACCTAAGAGTAGTATTGAAAGAGAACCAT TGAGTGCTAAAATATAGTATTTTGATAGTAAATGTCTGCGTGTCATTTTG TCTTTAATACTCGTGTGTAAATTTGTCAATCTAATTCGAAATGTCAATGC AATAAACAAATTCAAATAAATGTTTACTTTAAAGTACATGACTTAGACTA ATTTTTGCAGCTATATAACCGTGGATCTTGAAAGCTTGACTAGATGTCTT TGCAATTTTTTAGCATCAACGTTTGAACGGTTCTTGCCGGTTCTTGTTAT GTTGAAATTTTTAATAATTTGGATTTTTCTACTAGTGCAGTATGAAGGAG TATTAGAGAGAGTTTATCTTTGGTCAAATACAGAAATATGAGTGATTGAT ACGAGTATGAAGTTAGAATATGGTTAAAAATAATCCAGATTTTTAAGTTG TTAAAAGTTCTACCGTTGACGCTGTGCCGACAAATCGAGATTCTATTCAG CGCGCAATCAACGAAGACAAAAGTAACCATGACGACCATCCAAGATCTTG GATGAAGTTCAAAGTTGATATTTTTATTCCCGTCGTTGAAAACACAACTA AAAAATACATCAATGCTTTTTAAAAAAAGTCAGTGATAGAGAATCACAAC ATAAAGTCTGTCTATTATTTCGATTCAATTAAAGTGACATTTCCATAATT AATAGTTTAGTAATTACTGTTATACATTTGGGGATCATGTAAAAGATTTC TTTCGAAAGAAACTTACTTCAATTACACTTGGAGGTTTCTGGGTAATTCG TAAATAGTAAACTGCATACTGATACAGGCTGCGTTTAGACCAACTGGCAT TTGTAATTTGGCATTTGCTCATGAGGGATTCGATTTTAATAGCTTTCCCA TTGTATTTTCTGTCATGGCATTTAAGGAATCGTCTTTACNTTCAGCATTT TTTGAGCATTTTGATCTAATTTCTTAAGAAATTGCATGTTTTTAAGTCTC CAAAGCCTTAGTATGTTCTTAGAATGTTCTTAAATTTTTAGGCTCGAAGC CTCATGTTCTTATATAGTTTGTTCTTATAAAAAAAAAACGTGTACAGTGA TTAGGTTGGCACTTTCGCGATAAAATTTCTATTATTGGTCTTCAGAGGTC AATATATTCTTTGAAAACTTGACCTCTGATACTCAGGGTATAAAAGTTCT AGTTTGGAGGAAGATTAATATATTGCCCTCTTTATAAGCCTTTGTGAGGT GCGGAAAATTATGAAAGTAAATTGTCCTCAATTTAAAAATTAGATTTATA ACTCCATGCTTCCTTTGCACCGCAAATATGATTTTTGATATTTTGGTATA AGATTAGAAATATTTCTAATTCCTTCAACGCCTACACTGATTTTCCTGCA GTTGATAGTGTTGAGGCATAAGTTCATTAAGCCTTACAGGTACCGACCTC CTTTTATTTACCGGTCATTTTTTTGTTATTAATCTTCCTTTGATTACATG CTCAAATTCTTCTCTAGGTTGAAGTTAAGGAAACTAAAAAATTTTTGACG TCAAGCTAATTTTCGAGAAATTTGGACACATCTCTTGTAAGNAATGCCAG AAAAGGGGATTCCTTTGCTCAAAATGGCATTTCAAATGCCAACGAAATGC CAACACGCTGGCATCATTAGGCATTTGATAAACCGAACAATTACGCGGAA CAATAGAATTCAAAAGAATACTGCAAGCAATTACAAATGCCAGGCTGGTC TAAACGCAGCCACAGTCTGACATTACAATAAGGTAATCTTTGCTCTTCAT TTTTGATTCTNACTTATGCTATTTTCGATTCTTATGGTCTTTGGTTCTTA TAATAGATTAAGATCAAAATTGTGGACAAATTGGCATATTGTCCAAATTA AAGTCACGATAAATCATTTTCAGAATTCAAAACAAGTAAAAGGGAATATG GTTTGAGGGTTTTAGAGGAAGTATCATTCCAATACCATTAAATTATCGAA GCTCTGGTACCAAGTGAAAGTACTAATATATTTCTTAGGGTATCACAGCC GTAGCATTGCAAAAAGTGCTACGAAAACTGATATTGACTTTTATGACGTC ACATTGTTAACGATATCCTTTTTTGTATAATGTTAATCATTTCTAATCAG GTGCATCCTGTAAAACAAAAGAGTAGAGTTTTCATTTTACCTCGTTTTAA TGCGCAAATGGTAAACTTCATCACTCGTTAAAAGTGGAGTAGAACTTTGA ATAATTTGTAAAATTTTATAAATACTTCTTTTGTTGTCGATTCTTTCAAG TTTTAAGTTTTTCAAAATGGGGTAGTGAAAAACGAATTTATCAAAAAAAC AGGAACATATAGCCACTTTGAGCAAAAATTAGAAAAACGTTGGAAATGAT TTGGGGCACGTACCAACAAAGGAAGAAATATAAGGAAAATCACAGTTTAA AAAGAACAAAAGCATATAGGAACAGCAGTAATAAGTATACCATAATTAGT GTATAAATGTAAATATTTCAGATGATTAGAAAATTTCAGAAGATTTTGAA GAATGTGGTGTGATGAATAAATGACCTTCATGTTTTGAAAGACTGAAAAA AATCTATTATTTTTGGATACACTGGTAATTAACGCATGTCATTAAAGCTA CATTTCTATTGTTAACTGAAATTTTAATGGTGTAATTAATACTTGCAATT AAAAATGGACAATAATTACAGAGCAATTACGTGAAAAAAAAAGGTTTTGG AACAGTTTCTTAATTTTTCTGTTTGTTGTGGAGTGGAACGGATGGCCGTT TGAATATGTTTTTCTTTTAAAGTTTGAGTTTTTCATTAAGTTTTTGGCAA GTAAGTGCACTTTTCATCAGGTAAATCTTCATTTTTGAGGAAAGATAAAA TGTTGATCAATTGATGATACATTTCAGAATCATTTGTAAAGTTGCCGTCT TCGGAATTATGACGTTTTTGAAGATTTCCAAGTTAAAAGTATTGTGATTT CTTTTTTTCTGTGATAATATTACTAAATCTTTTTCACAGTTTTTAAGAAA GCTTGGCATTATTCTTTCATTGTTATCATACTTTTATCGGAAATATTAGA TTTCCTATAAGATGAAACATTTTCTGCTATAATGTTTCATGGTATATTCT TTTGATTTCACTCTTGTTTTCTTCATTTTAATGATGTTTTAATTATTGAA GTTTCTTCTTGAATGATGTGATTGAATTGTAGTTTAATTTGACAGGCAGA GACAATTTCAAAGGATTAATACTGAAATTTCGATGACACTGTATGCTATT AAATGAAGATCAATTTCTAAATTAAAAAAGGACTGATATTATTTTGGGAA ATGGCAATCATCTGTTGTACTATAATTAGAATATAAAAGATATATTTGTC TCAACAAGGGCTTGTTATAATTATCGTGTTTGTCACAATAAAGTTACAGT ATTATACTAAAATTATATGACTAAAGAGGGTACCGATACTTTTGTCTTTG AGAGCTTTTTATCTTCTTCATAGGGCTGTAAGATAATGTCTTGACCATTA GTAGTATTTTGACATCAGTGTGATAAATATCTAAATCTCAGTGTTCAAAA GTTTTTACGAGTCAGCAGTTGTAGACCAATAAATCTATTTACTTTATCAT TATTTGAGATAGAATTTCCAATCGGAAGGGATCAGCAAATAACTCGAGTT TACAACTCTTCTCACCTTCTCTCTCATCGACCCTTGGGAAGTCATAATAA AACATGCTATTTGTAATTCGCACCTCAACTTTATTGGATATGTCTTGAAA TAGAAATGACAGTCAATTGTAAAAGAAAGAAATTTTCTTTTTGATTTACA ATAGGAATATTTGGAATTTTTCAATCGTCTGGTGATTGTTTTATATCTGA AATTGAAGATTATGGCTTTACTCAGAAACGGTTTCGTAAGTGTGACACTA ATTTGAAGTAACTCATATTTGTATTCAAATGTAAGCTATTTGTTAGTCAT CGAGTCTTTGTGATGTGTTTGTAATACACAACACTAGTAATTTCAATGGA AATAATTGACAAGTGTTTCTTTTTTGCTGTAAAGTTGAAAATAGCAGATT TTATCATTTCAACTATTTTTAAAAATAGTAAATGTTACCATAGAATCTAA GTAAGTCGGAAACTCTAAGAACAAAAGAAATTGAAAAACAGGAAATGCAT AATAGCCTCTTACAATTACTTGATCACAACAGAATAGAAATGAGTGTTCA AAAGTTACAACAGAAGTGCTAGAAACAAAGAAATAATTAGAATAGAAATG CCACAATGAGAAAATTTTAATCACCCCTGATTTTAAAGTTCCACTAAAAC CTTAGGTTTGGGATAAATAAAGCATCAAACTAAAATACCATGAATATGAA CGGATTAGAATTTCACACTTTATTCAAAGACTTGCTAATTCGTTTCAAAT GAATCAATCTATCATTTCAGTGCTTAAAGTAGTCAAGAACTCCACAAGAT CAAAGGAAGTCTTTAAAATGTTTTTTTTTTCGTGTACAAAAATAGCATAT CTTTAATTGGTCTTTTGTTTTGATCAGTTATCTTGGAATATCACGTTATT ACTACCTTGTTCAAAACGCAACATTTTTTATGTACAACTTTTTATAAGAA TTAAATGATTTTCTTTCGTAATATCTGCAAGTTAGTTGATTTAGTCTTCA AATATCTTGCACATAAAGTTTAAAGTCTACTTGAATAAAGAACAACGTCA CAACGTGAAAATTAATCACATTTTTCGCTTAATCCGGTTGAAAATTGTTA CGCTAGGCAACCTNAAGAACAACGTCACAACGTGAAAATTGATCACATTT TTCGCTTAATCCGGTTGAAAATTGTTACGCTAGGCAACCTGAATTTCAAG TTTAAGGAAAATAAAAAGAAGTCTTTACGACGATGCTTTAGAAACAAAAA AAGAACAAGTATCTCTTAACCTGCCTACATCATTTCAAGGTTGCTGATTG GCTGGTTGATTCTCTTTCTTAATTAGAAGGAGACAAATAGAATGGCTGTA ATCCGCTTCTAATTACTTTTTATTATCTTTTGTATTGACGCAAGAATAAT TGAATGAGCTGAACTTTTTCTTTACTAATTGCTCTAATGAATTATAACTA AAATAATATTTCTTTTTACAATAAATGGATAAACTTTTTTTTTGTTGTAT GAGGGTCCCAAACAATTTACTGATTAAGGGACATACAGCACTTTTTAAAT ACTGCCATATGAACAGGACGGATTTTGAAAGTCCGTAAGGAAATGTAAAT GTTAAAAAATGCGACGCGTGAAGACTTTGAGCGCGATTATAGGAGCATTT TTGAATGATATTGTGCTTTCCTGCTCTCAACAAGAAGATTCCACTACTAC TACAAGGTAAGTTCCTCATGTTCTTCTTCAACCTTAATCCTACATCTTCC GAAAGTCATTTATTCTTCTTAGATAAAGCATTTTCTTTTCCTGAATGATG AGTTTTTACCGAAAAATGAAGATTTTTTATATTAAAGTAAAACGATTTTA TTGATTGCCCAAGCTCGCCCTTCAGTTCCTTTTATACATACACAATTCTA ATATACTTATTTCAAGGTTCTAAATTATTTCTATCAAGCCAATTTATAAT TCTGAATAAAAAGTCCAAAAATGTAATTTATAGACGGAGACTCCGTTTTA TTGATAGAGCAAAAACATTTTGTTTATTTGTAAACGACTCAGTTAGTACT TCTGTCTACAAAATGTTCAAGAGAGACCAACACTTTAGATTTTTTCCCTT CATTTAGCAGCGAATACTTAAACTTAATCTTCAAATTCAACATTGAGATT CAAATAATGAAGTAATGACGAAATAGGGAAGGGACTTGAATTAAAAAACG TACTTTATTTCATGATCCAGTTTGTTGTTTTTCTCCTTCTTTCTTGTTTA CCCTAACTAAGTTTACTCAACTTATTTAGGATCTCATAGTAGGAAAACTT AGATATTGAGCGAGGGCAATCATCAATCATTACAACACAAAAGAGACCAA ATTTAGTGGGAACTCATCACTCAGGAAAACAAAACTTGTGTGATTTAAAT AGAGCTAAACAAATATTTTAGGTTTATATTACCCTTGCCTTTCAACTTAT AGATCCTTAAACATGAATGTTAAAAATAACTTCTTTTTTTCTTTCTAGGT TATTGCTGGTGTCATTATTAGGTAAAACNCAAGGTAAGTTCCTCATGTTC TTCTTCAACCTTAATCCTACATCTTCCGAAAGTCATTTATTCTTCTTAGA TAAAGCATTTTCTTTTCCTGAATGATGAGTTTTTACCGAAAAATGAAGAT TTTTTATATTAAAGTAAAACGATTTTATTGATTGCCCAAGCTCGCCCTTC AGTTCCTTTTATACATACACAATTCTAATATACTTATTTCAAGGTTCTAA ATTATTTCTATCAAGCCAATTTATAATTCTGAATAAAAAGTCCAAAAATG TAATTTATAGACGGAGACTCCGTTTTATTGATAGAGCAAAAACATTTTGT TTATTTGTAAACGACTCAGTTAGTACTTCTGTCTACAAAATGTTCAAGAG AGACCAACACTTTAGATTTTTTCCCTTCATTTAGCAGCGAATACTTAAAC TTAATCTTCAAATTCAACATTGAGATTCAAATAATGAAGTAATGACGAAA TAGGGAAGGGACTTGAATTAAAAAACGTACTTTATTTCATGATCCAGTTT GTTGTTTTTCTCCTTCTTTCTTGTTTACCCTAACTAAGTTTACTCAACTT ATTTAGGATCTCATAGTAGGAAAACTTAGATATTGAGCGAGGGCAATCAT CAATCATTACAACACAAAAGAGACCAAATTTAGTGGGAACTCATCACTCA GGAAAACAAAACTTGTGTGATTTAAATAGAGCTAAACAAATATTTTAGGT TTATATTACCCTTGCCTTTCAACTTATAGACCCTTAAACATGAATGTTAA AAATAACTTCTTTTTTTCTTTCTAGGTTATTGCTGGTGTCATTATTAGGT AAAAGGAGTACTGAAGAGTCGTGACAGATTTTACTACAGAAATGTTAGAC AACGTGGACGGCAACTTTACATTCCCTCATGACATGACATGTGAAGAGAT GTTCCCAGACTTTACACCAGACGTATTTGATTATTTCTGCTCCGTTACAA CAGACACTACTCAAACACAAAACGATACAACATTGGAATTTTTCGAACAA GTTTGTTGTGTTGATCGCACGCCAGTTTCGGTTCAGGACGATAGCTCTAT GCGTAAAACGCTATACATGATTTGTCATTCACAGAATTTGACAGTGGATG TTGAAAATAACATTTGTAGAGAATTTGAACCATATTACATGCCCCCGGAA CCGTTTACGATAACACCAGCAACGTATGTAATAATGTCACTTCTGACACC GATTGGTTTAATGGCAAACTTATTGATTATAATGACAGTGTTGCGAGCTA AGAAACTCAGAACAACTACTGGGTTCTTCATTTGTCACCTCGCCATCGCC GATCTGTTATGTATCTTATCTATGATGGCATACGTGATAGCCCATTCACA AATTGAACTGAAACAAAATTTTAATATTTTGATGATATTCTCATCATTAG ATGTTTTTATCGGTTCAGCTTCATTGCTACACGTGACAGCTGCTAGTGTG GAAAGAGCCATAGCTGTTGCAAAACCCATGGTGTACCCGTTGATATTGTG CAAAGAACGAGCCAAGAAGGTGATTCTACTTATATGGGTTTATTGCATCG TTTTATTTATCGCTTGTGTTGCTAGAGTATTCGTCAAACCAATTATCTAC AATTCAATCATATTTTACATAGCAGTTTGTTTAAGCTTCGGTGTACCGTG CATATTGGTATTAATTTCTTATCTGAACATCTCAATCAGAGCCTTACGGA ATTTACAGATGGAGAAAAGAATTGAACGATCATTAATTATTGTTTCCATG CTGAATGATACTCAAAGGAGAGCGCCGAGATATCATCATCAGATACGCGA ATTAAAGCTAGCTNGCTTGTGTTGCTAGAGTATTCGTTAAACCAATTATC TACAATTCAATCATATTTTACATAGCAGTTTGTTTAAGCTTCGGTGTACC GTGCATATTGGTATTAATTTCTTATCTGAACATCTCAATCAGAGCCTTAC GGAATTTACAGATGGAGAAAAGAATTGAACGATCATTAATTATTGTTTCC ATGCTGAATGATACTCAAAGGAGAGCGCCGAGATATCATCATCAGATACG CGAATTAAAGCTGGCTCTCAATTTGACCATTATGACAGCACCGTTTGTTT TCGGTTGGGGATATTTCATGATCTGTAATGTTTATGAGGAAGTAACAAAG ACTACATTGGATGGATTAAAAAATTGGTTCCTCAACATGTTACCTTATCT TATCTCATGTTTAAACCCAATCACATATCTACTATTCACAAAGACTTTAC GAAAGGAAGCTATTAAATTGGTACTGAAACCATTCAGTAAGTTCCGCTCA CTACACCATCGACGCTTCTCATCGACATCGCTCATTTTTACCTCACGTAA TAGTAGCAGACACTCAGACTCGTCCGACGCTCGTATGATGCAAAGGGAGG TCTAAGCTTAAGCTAGATCCCATCATAACGATTAAGCTTTTGACTACTAA AGCTTTATCCGATGGTAGGAGGGATTGTATTGAGTGTATTGACAAAAGAA GAAGCAACAGGTCATAGCAGGGACACTAATTAAGTAGATAATAAAAACAA TTATAATTCTTGTAAACATTCAGAAGTAATGGAACAAACACATTAAAACG GAATTAAAAATGACAAATATTTCAAATCCAAAGGGACGTAAATTTGAAAT AGGAACACGAACCAAAATTTAGAATGTAAAATATTTTTTTTCAACGTATA TAAAAAGATTTAGAGCAATATAGCTACGGGAGATGTAAATAGAAAACATG TTTAAAACGACCATTTATCTTTGTAAAATATTATTATCCGTGTAAATTTT TGGCTGATAGTATAGAAAAATATCATATTTATTTGAGAATTAAAAGAAAA CAACAAGAAAAGC
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001960TCONS_00001960Clytia hemisphaericatranscript
TCONS_00001959TCONS_00001959Clytia hemisphaericatranscript
TCONS_00001958TCONS_00001958Clytia hemisphaericatranscript
TCONS_00001957TCONS_00001957Clytia hemisphaericatranscript
TCONS_00001956TCONS_00001956Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001958-proteinTCONS_00001958-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:854410..872272 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0.02 0 1.03 0.67 0.65 0.66 1.27 0.99 0.38 3.08 7.85 8.23 1.6 2.38 0.42 0.1 7.76 9.55 0.1 0.11 0.02 0.02 0.05 0.07 0 0.05 0.08 0.02