Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000140 (gene) - C. hemisphaerica

Overview
NameXLOC_000140
Unique NameXLOC_000140
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:2456748..2467092-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000140 ID=XLOC_000140|Name=XLOC_000140|organism=Clytia hemisphaerica|type=gene|length=10345bp|location=Sequence derived from alignment at sc0000001:2456748..2467092- (Clytia hemisphaerica)
CTAATTTGAGCTCTGATACTCACGGTAATCTATTCAAGCTGCTCACTACA CTTTCTTATTCCCTTGCTATTTGTCCTATTTTTTTCTGATTTTGATCGAC AGGTAGGTCCATTCAGCATGTTGCTTGTTTTTATTATTTCAGAAATTGTA TAAAAAACCTGTCAAGTAAAATATGACAGAAAGGTTATCTTCTCCAAAAG CAAGAGAGATTCAAAATATAAACATACATACAAAGACTTTATCATCAAAT CTTTTCAAATTACGTGAAAATGACTCATTGTGTGACGTGACCCTCATTTC TGATGGAATTGAAATCAGAGCGCACCGTGTGGTGCTGGCAGCATGTAGTG AATACTTTCATGCTATGTTTACAAGTGGAATGAGCGAAACTGGCAAAGAC GAGGTAAAACCCTTTATTTGTTGCATCTCAATAATGTGAACCCAAGGCTG ATTTTTGCTTTGAAAATCTCAGTATTAAAAATTCTTGAGTCAATTTTTCA TTCCATGGAAATTTTATTCATCCTGATCATTACCTAGCTCTAAACCTTTT TCATTAATGATCATTTCGATTGATTCTAATTTTAGCAAGCTGAATAGGAT ATTCTATAAGTCAGCCGATTAGAAAGATTGCATCACATTAGTATTATTCT ATAATAATGTCAAGTTTTGTGCCATTACAAAAAAAAACATTTTCGAGCAC TTTTGAAAAGTATTTGGACTGAAAATTGCTCTCAATTTTGACAAAAAATA AATGGAGCCAAAATTTATAATTTTAAAATTGAACATGTTTTTTCAAGGTC CCATTGAAAGGAGTGGATACAAAATCACTAACAGTGCTGGTCAATTATGC ATACACCGGAGTAATCTTCATCGACGAAGTCAACGTACAAACTATTTTGG AAACTGCCGATCTTCTACAATTTCAAACAGCAAAATCATTATGTTGTGAC TTCATTAAGGAACAATTGAGTACTGAAAACTGTCTGGATATCTTCCAGTT TGCAGATGTATTCCATTGTGATGACGTTTTGTCTTTATCTCAAGGTCTTT TTAACAAAAACTGGAAGAAGATTGTGNATGATGTTTTGTCTTTATCTCAA GGTCTTTTTAACAAGAACTGGAAGAAGATTGTGGAATCTGAGAGTTTCTC TTCCATCAATTATCACACTTTTGTTAAACTGATATCTGATGATTGTTTGA ATATTCACCAAGAAGGAGAGGTATGAAATAATTTTCTTTATTTCTCAACA TTAAAAAGACCTCCTTTGAGACCTCGTAGGCCATGCCCAAAATAGGTAAT CATTAGAACACGAACCACGAACGTTTTATTTTTGTTTTTGAGAACTTTTA TACAAAAAACTCTTTTGTTTGCCACAAAACATATATTTTAGACTTTCGAC ATTCTGCTGAAAATTATATTTTGAATTTATTGGAAAAATATGCAACGTTT ATACATACTACTCTATCACTAACCCTGATATCCTGGCTTTAAACTTCTTT TTTGATGTTTCTGGTTTACCGCCTGGTCTTCTCAAAGCTTTTTAGATTCA AATATCAGAAGGTAGCATATATGTAAACTTTACCAATTCAAATATTGCGC TGAGCTAAAAAAAAATTTAACCCTGGGTTATTAAGCATCTAGGTAGACCA AGCTGTAAATAGCAGAAACATCAAAATAAGAAAATAATTTACAGCTTTGA TATCCAGGCTGTTCTATCTCCATACTTTTGTTTTGTTGAATGATATCTTG ACTTAAAAGTATTTATTCCTTCATGTTTAGGTCATTACTATGATTTCAAA ATGGATTGAAGCTGACGAGATAAACCGCAAAGAGAAATTATTTTCACTTT TCCAATACGTCAGATGGCCATACGTTGATCCAATCAAACTGCAAGAAATC AAGAACCAACGCTTAATTGTTAACAATCGACTCTCACTACCAGAGATTGA TAATGTGTTCTCTGCAACTGAAGATTACAGCGATGTTGACAAGGTGGATT AAAGTGGATTAAATTTCGCGTGGCTTTTTTTTTTCCGAGAATCGAGAGTC CAAAATTTTAGCCTCTGCCTCTTTTTCATCCAATTTCTTTTATTTTCTCT AAGAGTTATTGGCCAAAATTAGGTTTTTTAATTTTTGGCGAGGACTAATT TTCGCAAAAATGGCCAAAATTTGTGAAGATTGCAAAAATTAATCCACGCA AAATGTAAGTTACTTGAATCTTTATTTGATTTAGGTTTTCACAGCATTTT CTTCGCTTGATTTTATCCGAAGGCATAGTGGGAACAAGGAGGGGAGGTTT TAGATATGATAGAGGACCCCGTCAACAAATTTCAAATGAATTCCAGGTGC TAAAACTTCGGATCCCTCTATATTTTAAGAAATCAAGAAACTGTGTTGGT TATGCAATTTACCTAATATTCTAATTCGAAAAAAGTACTATATTATCACA AAAAAATGGCCAAAATTCGCAAAAGTCCACGCAAAATTTAATATAGCTGA GTTCGTTGAATCTTTATTGGATTCAGGGTTTTCGCCGCTTTTTCTCTCGA AGATCGAATTAGAGAGAGTTAATATGGATGTACTAATTTAAAACTTTGAC TCATTAACTTTATTCTAGGTGGTTACTCTACATTCAGAAGATTGCAGCAT CACACCTTCCCTTAGTATGAGACATTCCTATGCATCATGGCTGTATGTGC TGGGTGGTGAACAATCATTCTTAATGGGAATGAAATCTACAGAAATTTTC GAAATGAATACATCGACGTGGAGTTACGGTTTCTCATTGAACAGACCAAG GACTTCTTTTGCTGCTGTAGCACATGGTGATAAATTGTGAGTTTCTTTCC GTCTACTCTAGATCTAGTGGTAACCTCGTCCCTGTGTACTCCAGGCTTTA TTTGCGTTACTGATGGACGCCAGAGAATAATATTATCTAGCGCCATCATT AAGCATAAAAAAGCTGATTGATAATACGCAGGGAACGAGGTTGCTAGACT AGTAATTTTAAATATTCCTAGACTGGAGTCGTATATAATCCATGCAAATC AGTAATATGGATATGATAATAGGATAATTGTTACAGGATAATATCAGTTT GTATAGACAATATGCCTCTTTCATTATTTTTTGCCTATTTTGTTATCTAA AATCTTTAGTTGGACTGGTTGAAAAAGGGCAAGTAAAACAAACTTTTGTT CCCACTTTGAAGCAAATGGATTTTAACATTGTCTGATTTCAAAAAGTGAG ACTTCTGAGTGAGATATTATCCTTCCATTATGTTCTTCATTTTTTTTCGA AACTGTAGGTATGTTATCGGTGGCATGTGTCTGGGTGAGAAATTAAGAAG CGTCGAAAGATATTTAGAAAAAGAAGGCCGTTGGAAGCGTTTGGCCTCGT TGAAAAATTGTAAAGGTAAAGATAATTTATTCACCCAGTGCTCAAATCTT TGTTGGATGAATGTCTCTCCTAAAAGGAAATTTCAATATACGCCCATCGA CAAAAATTCTTAAACGCCAGGGGCGCTTATTCGAAGAAGTAAGGTGTGAT TTTGATAAGCATTATTAGTAAAAATATGTATTATGCATGCTATTTTTATT GTTTTTGAAGGTTTAAATGTTGGGAAATTTTGTAAACTGAGGCTCGAGTT TTTTCTAATATTTGAGCATGGATATAGTGATAAGAATTGTGTTCATCCAA TCAAGTTTTTGATTAAAAAAAATAGGAATTTCATTTTTTTAATCCGTCTA CTGAGTCATCTAGACTGGGAGCACTTAAAAAAATTATTTGATTTTAAGTA GCCTGGAATTATTAGGATTATTACTAGAATTAATTATGATTTTAGAGACT TAAAGTAGGATTTCAGTGATTTTCTTTCAAATTGGTAATCTAGTCAAATA CTCCTAGTCTCTGAACTTAACGTCGTCAAACATTATCCAAAAACGAGAAG ATTATATTCTATTCTATAGGTTTGCCCACTAAAAAATCTTCCAACCATTC TAGGTGACGTGAAAGCGGCAGTAATAGATGACGTTGTTTATGTAGCTGGT GGATCTAGTGGCGGCGAACCCGCCTGCAAGTAAGAATTTCTCTTATTCTG TTTTGCTCACTTTTCATACTTTGTAAATGGGTCTTTTCATAAATTACTTT GAGTGCAACATCTGTCTCGTTTTGAAAGCATCACTAAGGTTATTTTAAAT CCCTTGAAGATTCAGGTGTAAACTTTTTAAATAGAGTAAACTTCTTTTAA TTCACCTGGGAGATAATTCATCTGGGAATCGATTACCATAGCAACATTTG AATGTGGGGTGAGCGTAAGGTCTCAGCCAACTTTCTCCGATTCGAACCTC TATGCTCTGAATCTCTCTGTAATTCGAACTAAAGCATTGGTCCGCTCAGC TGGAAAGTCGTATAAAAACACTCTCTGTAATTCGAATCTTTTTCCAATTC GTAGAAAATTCTTGGCCCTTGAAGGTCGAAANAATTCGAATTTTTCTCCA ATTTGCAGAAAATTGTTGGTCCTATGAAGATTGATTTTAGAGAGAGTCAA CTGTATAAGTGAAGACCAGGCCCGGCGGAACAACCGTAAGAGTGGGGAGG ATGAAGGCTCAAAATGAGATAAAATTTGCTAGGAATTGAGAAAAAATCTC CTTTGCTTAAAAGTGGGGAAGCTGAAGTCTCCCCAGCCTGAAGACGAATG GGTGCACTTTCTTTTCTTCCTATAGATACGTCGAACGATATGATGAGAGT AATAACCAATGGACGCCAGTAGCCTGTATGAAGTCTAGACGACGAAGGTT TGGCCTCTGCCAGTTCAAAGGCAAACTATACGCTTTCGGTGGATTCCAAG ATAGCCTGGGTGACTTGAAAGCGTGTGAAGTTTATGATCCAGAGGCTAAT ATATGGGAGAGTATTGCGTCTATGAAAACGAATCGTTGTGATCTTGGAGT AGCTGTTTTGTCAGGTAAGCTCAATTTTCTGGCGAGTAAGCTCAAGCTTA ATTGCAAAATTTGTTAAACTTATTCTTTCAAAATACCCAGGGGGGGGGCA CGCAGTTACTACAAGACATGATGTGTAGTAAGTGCTTTTTCAACACTATT TTTCAGGACCACCACCCTTTGCAGTTACTACACCTTGGTAGTAACTGTTT TCAGAAAAGATTTCCAGGTACCACCCCTGTTTTTGAGTGATATCATCAAA AACATGCTCGAAATTACCCTAAATTGCGACTATTTTTCTACCTAAAGCCA TTTTTGCACTAGATTTTCTCTTAATTTACTTGGTTAACAGCTGTTGAGAA CATTTTAATGATAATTAGGGAAAGCATAATTTCAAAGTTGGGTCTGAGAA AAATTTCAAATTTTTTTTCGTCCATNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNCTACACTGTGTAGTAACTGTTTTCATAA CTTCTGAATACAGTACCACCACGGTAGTAAGTGTCATACTGTCTTGTAGT AACTGCGTGCCCCCCCCCCTGAAATACCCTGGATTTAACGGTCAAGATAA AAGGAACTCTTTACTTTCATTTCTGTATGGACCTCTAGATTATTGATATC AAACTAATCCATGTATTGTGTTTACTCCGATAGCTCATTTACTGCTCATA TGAAATCCGCGTATAGTCATTGTGATTTATGATCATGACCATAGAAGTCT TTCATATTTGTTGAAGTTACGTAACTTCCGCTATTATTACTTTCGATTTT CGTCAGGGATCACCTTTTACAGATCCGAACGTTTGCTTCCATAATGGTAA AAAATTACGTAACTTAACCGAACATGAAAAACCTCTAGATACAGATCTTA GAGAGTCAGAAATTTGGATTGTCCCAATTTGAATCACGGGAGGGAATTCA TAATGGTAGATTCTCGATAAAAGACCCTCTAAAAACCACCACGTCAAGTC ATAATGACTGTACACGGATTTGCATACGATCAGTAACTGAGTCCATACTG AGGGAGTAGTNCAGCCAACTTTCTCTAATTCGAACCTCTATGCTCTGAAT CTCTCTGTAATTCGAACTAAAACATTGGTCCGCTCAGCTGGAAAGTCGTA TAAAAACACTCTCCGTAATTCGAATTTTTCTCCAATTTGCAGAAAATTGT TGGTCCTATGAAGATTGATTTTAGAGAGAGTCAACTGTATAAGTGAAGAC CAGGCCCGGCGGAACAACCGTAAGAGTGGGGAGGATGAAGGCTCAAAATG AGATAAAATTTGCTAGGAATTGAGAAAAAAATCTCCTTTGCTTAAAAGTG GGAAAGCTGAAGTCTCCCCAGCCTGAAGACGAATGGGTGCACTTTCTTTT CTTCCTATAGATACGTCGAACGATATGATGAGAGTAATAACCAATGGACA CCAGTAGCCTGTATGAAGTCTAGACGACGAAGGTTTGGCCTCTGCCAGTT CAAAGGCAAACTCTACGCTTTCGGTGGATTCCAAGATAGCCTTGGTGACT TGAAAGCGTGTGAAGTTTATGATCCAGAGGCTAATATATGGGAGAGTATT GCGTCTATGAAAACGAATCGTTGTGATCTTGGAGTAGCTGTTTTGTCAGG TAAGCTCAATTTTCTGGCGAGTAAGTTCAAGCTTAATTGCAAAATATCTA AGATTTGTTAAACTTATTCTTTTAAAATACCCCTGATTTAACGGTCAAGT TAATGCCCTTAATTTTCGCGCACTACCACTGCGTGGAAATTAAAGGGTGC GCGCACTAGGTCGCGCGAAAATTAAAAGGTGCGTGAATTAGCAAATAAAT TAATAAACCCAATTAATCATGATTTTTGATAAAAATATGATATTCATAGT ACAGTGTTTAGCAGACACCATCGAGCAAACAAGATTAGTGTCCGCTAATT AAAGTGTTGTATTTACTCCGATAGTTCATTTACTGCTCATATGAAATCCG CGTATAGTCATTGGGATTTATGATCATAACCATAGAAGTCTTTCATATTT GTTGAAGTTACGTAACTTCCGCTATTATTACTTTCGATTTTCGTCAGGCA TCACCTTTTACAGATTCGAACGTTTGCTTCCATAATGGCAAAAAATTACG TAACTTAACCTAACATGAAAAACCTCTATACAGATCTTTAGATTGTCCCA ATTTGAATCACGGGAGGGAATTCATAATGGTAGATTCTCAATAAAAGACC CTCTAAAAAAACACCACGTCAAGTCACAATGACTGTACACGGATTTGCAT ACGAACAGTAACTACTGAGTCCCTACTGAGACAGTAGTTGTCTGTTTTGT TACTATTTCTTTGGCTATATCTACCCATATACCAGTACGTTGAGTTAAAC ATTTAGGTTACATCTACGTGGCGGGTGGTGTCAACTCTTACACCGGTTCC ATCAACACAGTGGAAAGATACGACCCGTCTTCAGATCAATGGACGTTGTG CCATCCTTTGTCGCAAGCCAGGGGTGGTCACTCCATGGTCAGTTATTTCG GACGGCTAATAGTCATTGGTGGAATGAACAGTTACATGCAAACGTGCCGC GATGCTGAGTGGTATAATGAGGTATTATTAGTTTTTATAAATACTTCCGT TTTCAAAATCCCCTTCTCTCTAAGTGACCTTGTGAGAGTTTACTAGGGGC TGTTAATACGGTTAGCCAATTCTTTGGTTCGTATATAAAAATAGCGTTTT TAAGCAAATAATGAATGCATAAGCAGGAAACTTCGAGTATCGAGAAGAAA TATATTAAACCGTTTCTTTAATCCTTATGTAGAAATAGTGTTTTATGTAT GGGCTCGCATTTTCTTCAAATCAGGTAACTGACCAATGGACGTCACTAGC ATACACTAACGTGCCTCGATTCGGAAGCGTGGCTGTTGTTCTTCCATTCT GTAAACAAGGTTCTGGACCCTCGCCTCCACCGGCCTCAAAAAGCCAGGAC AATGAAGAGGAATGAGAGTATGTATGGAATTTTGACAAAGAAAGGGAGTG ATGCTTTTTCTCCCTTTTTGATTTTTCACTTTAACTTTGAAGAAAAACTG CCCACATACTTTACGGCACTGGGGCATTTTTAAATGACACAGACCAAGAC TTGCCAAGACGACTACACGTTTTTTTATAAGGATATGCCTTAAAATGTTC TTAACTTGTTCTTAGTAATTTGGACATCTAAGCCTTATGTTCTCATATAG CTTGTTCTTAGAAAAAAACGTGTATAACTTTTTAGATTTAGTCGGAACAA TAAGCCACAGCCATCTTCCTGTAACACAATAATGAAGAATGCATAACATG TTCTCTTGACGCGTCTTATCTATTGACTATACAGTCAACTTTTTCTAATT CGAACTTCTATAATTCGAATCTTTCTGTAATTCGAACTAAAACATTGGTC CCCTCAGCTGGAAATTAGTTTTAAATGCTCTCTTTAATTTCTCTAATTCG AATAAAAGTCTAAATAGTCCCTTGAAGATCGAATTAGAGAGAGGCAACTG TAGATTTAGTCCTTTAGGGATCATACAAATGTTGTTTAGCGTTAACTGAT TAAGGGTTTTCATGGTAATAAAAGAAATAAACTTAATAAGGGTGTATGAT TTTATTCATTTTTGTCGGCTGAAAAAAATTAATGATTTGATATGTATTTG ATTGATAATTTATGAAAATTATTATTGACAAGGAATCATAACAATGTCAT TAATAATTTAACAAAAAATATCATTCTTTGGATTGATATGTTTTCACACA TTTCAAACTCTGTTGCAACCCGAACACTCAGGGGGTGGAAGTTACACTAC AAAAAATAACAATACAGTGGAGTCTCCATAACTCAAACACTCACGGGGAA CACAAATTTGTTCAAGTTAAGGAAATTTCGAGTTATAGAGTAAGGTTTAT AAGGCATTGTTAACTGAAGGGACCTGAAAACTTGCTCGAGTTAAGGAAAA TTTCGAGTTATAGAGGTTCGAGTTAAAGAGACTCACTGTATAAACCCTTT TTAAAGAGATTTTGAGGGGAATCTGTCTTTCAAACTCTTCAAATTGTACA TACATTTTATTATAAGTTTTTATTTATATAGTTTATTATTTGTTACTGTT GTGCACAGGAAATTATGAACATTGTGTTTTCGGCAATTTAGACAAAAATA GTTTTTTATATTAAGCAATATTATGGAAAAATTGAATTTTTATGACTCGG AGAAAGCAGCGCATGTTTTTTAATAATTCTACCTCTATATCAGGCTTGCA TTATGCTTAGCATTCTATTGTTCTTAAACAAAAGATCCAATGTTTAGGTA CCAAAAGCTGAGCCTATGTATCTACTTATAGAAAAAAACATGCAGCCCTC TGCTGTACTAAGTTGTACTGTATTTATGATTAAGGTTTTTGATTTTAAGT ATCGGAACTAGTAGGACCCGAATTTCCAGAGGCAAATTACATTCCTAACT GAAATATAACCACTGACCTTTACGAACCCTCTGAAAGTCATACCAGTTTT AAAAGTTTGTTCCAAAGATATTGTCAGTCTGTAATTTTTTGCATATTACT ATCGAAGGGGAAAAGACTTTCGGACTACTTAGGACTATTGTTTCGGCTCT AAATACAGAAAGAGTTTCATGGTTCGAAAAAGAAAGCTTGTAACCTTAGT TTATTGACACTTTTTACCGTTTATTTATGAATTTTTTTTCAGTTTTTTGA ATTTTTAGTTGCTGCTTATATATAAATATTATAGTATTGGACATTTTATA AAAAGTGAAATTTGATTTTTATTGATTGTATTTTTACTTAAAGTCGCGAA TTTAATGAAATAGCCTGTTAATATTATCGATCAGTGTAAAAAATG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000259TCONS_00000259Clytia hemisphaericatranscript
TCONS_00000258TCONS_00000258Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00000259-proteinTCONS_00000259-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2456748..2467092 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.97 1.99 1 0.94 14.13 10.14 6.96 7.7 5.72 6.27 6.3 4.82 7.44 7.06 4.15 4.18 5.46 6.09 6.01 6.72 6.91 6.52 3.12 4.21 8.62 8.19 7.17 6.18 4.97 4.53