Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073508 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073508
Unique NameTCONS_00073508
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length548

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073508 ID=TCONS_00073508|Name=TCONS_00073508|organism=Clytia hemisphaerica|type=transcript|length=548bp
GTTCAAAGCGAATCATTTGTAATCAAGTGTGTCATCGAACAGTGGCTCGT
ACAGGAGACATCCTTTCACAAAGTATGGCTAAAGTCCATCGGTGCCAACA
TTCTCATCTCTTCCTTTTATCCTCATTACGTTCGGTCGTCATCGAGAAAT
GCCATGACACTACAATCGTCCTTGGGAGCGTCGACACCCTCGTTGTCGTT
ATAGCTTGTGAAAAAATCCGAATTTTTGCACCGTGTAAACGTATCCTTAT
AATGTAAGTATACCGTTGGCCCTTTTACGCCGGTCCTTTTAAACCAATAT
TCCTGAACCTGTTTAATTAGGTAGATCATTTATATTGATGCTTAGACTGC
GAAAGGTTTTATTGGTCGAAACATTAGTTCCAAAAGTGACGACTTAAGTA
CCacagcgaccgtagtacagtggtagagcatccggctacggttcgcaagg
ttgtgtgttcaacccccagccgggtcataccaaagattcccaaaatggta
cttgatacctctctgcttgatgctcagcaattaagagaaggatcaagg
Run BLAST on NCBI

transcript from alignment at scaffold_93:179955..180502-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073508 ID=TCONS_00073508|Name=TCONS_00073508|organism=Clytia hemisphaerica|type=transcript|length=548bp|location=Sequence derived from alignment at scaffold_93:179955..180502- (Clytia hemisphaerica)
GTTCAAAGCGAATCATTTGTAATCAAGTGTGTCATCGAACAGTGGCTCGT ACAGGAGACATCCTTTCACAAAGTATGGCTAAAGTCCATCGGTGCCAACA TTCTCATCTCTTCCTTTTATCCTCATTACGTTCGGTCGTCATCGAGAAAT GCCATGACACTACAATCGTCCTTGGGAGCGTCGACACCCTCGTTGTCGTT ATAGCTTGTGAAAAAATCCGAATTTTTGCACCGTGTAAACGTATCCTTAT AATGTAAGTATACCGTTGGCCCTTTTACGCCGGTCCTTTTAAACCAATAT TCCTGAACCTGTTTAATTAGGTAGATCATTTATATTGATGCTTAGACTGC GAAAGGTTTTATTGGTCGAAACATTAGTTCCAAAAGTGACGACTTAAGTA CCACAGCGACCGTAGTACAGTGGTAGAGCATCCGGCTACGGTTCGCAAGG TTGTGTGTTCAACCCCCAGCCGGGTCATACCAAAGATTCCCAAAATGGTA CTTGATACCTCTCTGCTTGATGCTCAGCAATTAAGAGAAGGATCAAGG
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045622XLOC_045622Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073508-exon-scaffold_93-1575043694:179955..180502TCONS_00073508-exon-scaffold_93-1575043694:179955..180502Clytia hemisphaericaexon
TCONS_00073508-exon-scaffold_93-1510915933:179955..180502TCONS_00073508-exon-scaffold_93-1510915933:179955..180502Clytia hemisphaericaexon
TCONS_00073508-exon-scaffold_93-1491911889:179955..180502TCONS_00073508-exon-scaffold_93-1491911889:179955..180502Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_93supercontigscaffold_93:179955..180502 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.429849 0.0680689 2.26117 2.04653 0.731509 1.25672 0.167085 0.993273 1.03891 2.13856 0.600499 1.87635 1.37963 0.871849 1.07671 1.27275 1.91328 1.38372 2.37445 1.40472 0.929964 0 0.677817 1.1796 0.935833 0.616338 0.407494 1.75088 0.423066 1.55911
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073508 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top