Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073321 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073321
Unique NameTCONS_00073321
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1287

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073321 ID=TCONS_00073321|Name=TCONS_00073321|organism=Clytia hemisphaerica|type=transcript|length=1287bp
CCTCCAATATTGTCACCAGATAGTCTTTTCAAAAGGACACCCATCATTTT
TGGTGTGTTCCATGTCATTCCGTACATTGTTGGAATCTCCTCAAGTCGTC
CATAACCTTGCACGGAATTACTAGCGTACAAGAGTGGTTTCAAtaattga
agattttcatcgtcaagaaattcttcaaaagttttaTCAACTCTCTCTTT
GTCCTGTATGAGTGAATAGTATACATGAATGACAAcaataaaagttaaat
ttccTGTTTGAGCTTTTGTTGCTGTTGCTTTGTGTTGAAAATATGCAGTT
CAGTTGCCGACAGTTTCAAGATAAAAGCCTAAAACAATTTCATAGCCCAC
GCAAGAATTAACCTTTTGATATTCTGTTGTTCAAAAGGAGAGACCTCATT
CAACTGCTAAATCGAAATAGAGTAATCTAAGGGAACTAAGTACGAGTATT
TACCTTTGGTTCGACCAGCTCTGGCAGATGTTCACCATCATAGACACCAA
ACAGTTCACGATGAATTCTTATATAGCCTGAGATGGCATCAAAAAAACCT
TTCTTAATGACAGTTATATTTGTAGTCTTCAGGTGCTGGATGGCGTAACg
aaaaatatagcttttataGTCTGCAGGCTCTTTCCCATCAAGCCATATTG
ATGCAGGTGGGAAATGAACTAAATCGCCGGGTGCATANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACgaaaaatatagc
ttttataGTCTGCAGGCTCTTTCCCATCAAGCCATATTGATGCAGGTGGG
AAATGAACTAAATCGCCGGGTGCATATTCATTCACTAAGGAGATTATATT
ATCTTCATAATCAGGCTGTAAATAGACAGTGCCCATCTCATGAGGAGCCC
CACGTCTTTCTATTGTCCATGATTTACCACCAAAATCGTTCGATCTTTCA
AGGATCGTTACATCAGTAAATTTCAACTTCTTTAACAATAGTGCCATGTG
AATACCGGATGGTCCAGCTCCTATAATGGCTATCCGGTCATTGAGTGATT
TCGGTCCTGGTATCTTGAAATTCAATTTACGTTGAGCGTTCGATAATTTA
TGCAATGCGCAAAATAACGCCAGCAAAGTTATTGttgtcaatttcatttt
ttcttgattttgtcACTAAAATCCAAATAAAAGTAGTGGTCAAAGAATTT
AGAAGAAAACTGTTTTTACTTCGGGTTTTTCCTTCTT
Run BLAST on NCBI

transcript from alignment at scaffold_9:303680..305093-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073321 ID=TCONS_00073321|Name=TCONS_00073321|organism=Clytia hemisphaerica|type=transcript|length=1414bp|location=Sequence derived from alignment at scaffold_9:303680..305093- (Clytia hemisphaerica)
CCTCCAATATTGTCACCAGATAGTCTTTTCAAAAGGACACCCATCATTTT TGGTGTGTTCCATGTCATTCCGTACATTGTTGGAATCTCCTCAAGTCGTC CATAACCTTGCACGGAATTACTAGCGTACAAGAGTGGTTTCAATAATTGA AGATTTTCATCGTCAAGAAATTCTTCAAAAGTTTTATCAACTCTCTCTTT GTCCTGTATGAGTGAATAGTATACATGAATGACAACAATAAAAGTTAAAT TTCCTGTTTGAGCTTTTGTTGCTGTTGCTTTGTGTTGAAAATATGCAGTT CAGTTGCCGACAGTTTCAAGATAAAAGCCTAAAACAATTTCATAGCCCAC GCAAGAATTAACCTTTTGATATTCTGTTGTTCAAAAGGAGAGACCTCATT CAACTGCTAAATCGAAATAGAGTAATCTAAGGGAACTAAGTACGAGTATT TACCTTTGGTTCGACCAGCTCTGGCAGATGTTCACCATCATAGACACCAA ACAGTTCACGATGAATTCTTATATAGCCTGAGATGGCATCAAAAAAACCT TTCTTAATGACAGTTATATTTGTAGTCTTCAGGTGCTGGATGGCGTAACG AAAAATATAGCTTTTATAGTCTGCAGGCTCTTTCCCATCAAGCCATATTG ATGCAGGTGGGAAATGAACTAAATCGCCGGGTGCATANNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGAAAAATATAGC TTTTATAGTCTGCAGGCTCTTTCCCATCAAGCCATATTGATGCAGGTGGG AAATGAACTAAATCGCCGGGTGCATATTCATTCACTAAGGAGATTATATT ATCTTCATAATCAGGCTGTAAATAGACAGTGNTAGTCTGCAGGCTCTTTC CCATCAAGCCATATTGATGCAGGTGGGAAATGAACTAAATCGCCGGGTGC ATACTCATTCACTAAGGAGATTATATTATCTTCATAATCAGGCTGTAAAT AGACAGTGCCCATCTCATGAGGAGCCCCACGTCTTTCTATTGTCCATGAT TTACCACCAAAATCGTTCGATCTTTCAAGGATCGTTACATCAGTAAATTT CAACTTCTTTAACAATAGTGCCATGTGAATACCGGATGGTCCAGCTCCTA TAATGGCTATCCGGTCATTGAGTGATTTCGGTCCTGGTATCTTGAAATTC AATTTACGTTGAGCGTTCGATAATTTATGCAATGCGCAAAATAACGCCAG CAAAGTTATTGTTGTCAATTTCATTTTTTCTTGATTTTGTCACTAAAATC CAAATAAAAGTAGTGGTCAAAGAATTTAGAAGAAAACTGTTTTTACTTCG GGTTTTTCCTTCTT
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045487XLOC_045487Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073321-exon-scaffold_9-1575043694:304180..305093TCONS_00073321-exon-scaffold_9-1575043694:304180..305093Clytia hemisphaericaexon
TCONS_00073321-exon-scaffold_9-1575043694:303680..304052TCONS_00073321-exon-scaffold_9-1575043694:303680..304052Clytia hemisphaericaexon
TCONS_00073321-exon-scaffold_9-1510915933:304180..305093TCONS_00073321-exon-scaffold_9-1510915933:304180..305093Clytia hemisphaericaexon
TCONS_00073321-exon-scaffold_9-1510915933:303680..304052TCONS_00073321-exon-scaffold_9-1510915933:303680..304052Clytia hemisphaericaexon
TCONS_00073321-exon-scaffold_9-1491911889:304180..305093TCONS_00073321-exon-scaffold_9-1491911889:304180..305093Clytia hemisphaericaexon
TCONS_00073321-exon-scaffold_9-1491911889:303680..304052TCONS_00073321-exon-scaffold_9-1491911889:303680..304052Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_9supercontigscaffold_9:303680..305093 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0.0969598 0 0.0559107 0 0.415642 0.551231 3.5855 4.6353 2.91224 1.89171 0.422921 0.804808 0.191257 0.306579 0.179232 0.153927 1.64686 1.98385 0.430167 0.926439 1.00288 3.41096 4.18558 6.68999 0.241529 0 36.0659 19.5418
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
TermDefinition
IPR023753FAD/NAD-binding_dom
Vocabulary: Biological Process
TermDefinition
GO:0055114oxidation-reduction process
Vocabulary: Molecular Function
TermDefinition
GO:0016491oxidoreductase activity
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0055114 oxidation-reduction process
molecular_function GO:0016491 oxidoreductase activity
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073321 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top