Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001942 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001942
Unique NameTCONS_00001942
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2462

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001942 ID=TCONS_00001942|Name=TCONS_00001942|organism=Clytia hemisphaerica|type=transcript|length=2462bp
ATAAATAATAGAAAAGTAATAGAGAGTACAAACTGTGGTTAATATTGCAT
TCAAAACTGCTCGGTTAATATTGCACCATGACTGTCTTTCCATCAATGGG
TGGTCGTGATGTGGAAGATCGGAATTTCTTAACATTCACCATGCCTTCGA
ACATGCAATTAGAAGACAAAGGAGAGTTTAGCACGTGGTGTGAGAGGATG
ATCTTCATCTTCGAAGATTTAAAATGGCTTCTTGCACTCCCTGTCAATGA
ATTCTGGAATCAGGTCCTACATGATACAACCTTGACATCGAGTCTTGAAT
CGTTTCTTCAAAATTCACCGAGATTTTATGATTTGAAGAATATCCCAGAG
ACATGTAAGACAGCATTGGGTCGAGTCAGCAAATTATACCTTTTGGTCAT
TCAGCGGATGAGTTTACATGATGAAGATCAGAACCAACCGATGCCAACTG
AAGTATTCGGTGATATGATTTACGAGAATTACATTTTCGATGCTGCCAAA
TTGATAGACATTTGCGCCATCTTTCAACGGCCAAACAATGATGAGATGCA
AACGTTACTGGGTACTATTATGGAAAATGTTTTCGCATGCCAACCTAACT
ACTACAATGACTTATCAAGCGCTTTTGAAAGTATCATAGTGACCATTTCT
AACATGGAAGAGAGGCTGCAACCACCAAAAGGAGGCAAACCTGTCAATGG
AAGAGAAGCAGTAGACATGTTGATGTTTTTATATGACATGACTTGCTCAC
TATCTgcatttttgaatgttttcccTAAAGCTTCTTCATTGCTCTTTCGT
ACTGATCTCATTTCAAGATTGGCGACTATTTACGAGACAATGGTGCCCAT
GTTGATGAAATTAATTGAaatcaatcaaaagaaattcaaataTGTTTGCG
CATGTGTACAAAAAGAACTTCTTCAAATTGTCACCTTTTCCATCAAAAAC
GGTTTTGTTGCAAGAACTAAAGATTTgtctaaagatgaaaatgaagaaaa
aacagCATCATATATTTCGATCATGGATTCGTTGTCTCAGTACAAACGGT
ACTGCATGACCAGTAATGTTAGTGAAGACTTGGAACAAATCAAGAAACTG
GATGTCATTGATATCTCCAATTTACAATATTTGAGTAACATGGCAGGTGT
CGTCGTCCACGAAACTGATACTGATGACACTTTGAAGCAACTTCGTGAAT
TACTGCCCAACAAATCCGAAGAATTCATTCGTAACTGCATGTCTCAGTAT
GGTTCCAACGTTGAGGTCATTCTCAATAACGTGATGGAAGGTAACATTGT
CGACGAGACGCTCCAAAAACCTGTCAAGAAGAAACCACAAAAACTAATTC
CTGATAAGGAGTTTCTTGAAGACAATAAAGAACACGTGGAACGTGTTAAA
CTATCATTCTATAACCAATCAGAGGAAGGCAATGATTATGATGACTATGG
TGCTAATTATGTTAATTATGATAATGTATACGATGACGAGTATGACGATA
CGTATGACTCACAAGACGTCGGCGCCGCTGACACGGATAACGTAGATGAA
TTGTATAAAAGGAAATTCACGGTACCTCGTGTTCTTCAACAAATGAATCG
AAAATCAAGAAGAGGAGAACAAGAAGATGACGAAGAAGAGAGTGAAGAAA
GTGACGAAGAAGGGAGTGAAAATGATAACGAAGATGGTGgcgaacaacaa
caacaacaacaacaacaacaacagaatcAATACAAGGGTAATAACAATAG
AAGAGGAGAATGGAAAGGTGGTGAAGTTTCAAATAATCGTGGTGGTGGCG
CACGGGGAGGGCGTGGAGGTCAAGGCGGAAACAAACGAGGCGGTGGACGC
GGAGGAAATAAAGGAAACAAGCAACAAAATAATGATAAATCGCAAGGAGG
ACAAAAAGAAGGAAGTAATCCTTCACAACGTGGTGGCCAACGTGGCGGGA
GAGGAGGTCGTGGTGGGCGTGGAAGAGGCGGGAAACGTAATCATCGAGCC
TTGGCTGATAAAAAGATGTCGAAGggaatgttttgaaatcatcACCCATC
GTCACTTATTATTGGAAAGCTAGTTATTATGAACAGAAATACTTGCTTGC
ATCAAATCTCTTCGATTAACATTAAGTCCAATAGATTCAGGTTACTATCT
TGAAATATTATCTTGAAAAATAACACTTTACGTACTAAGTATACATACAT
TAACATTATATTTTCCATTACCGTCTTTGTAAAACAAACCAATAGATTTC
GGAGATTaagataaaaattataaaaaacgaaTCCTGGAAATTCCTTTTAA
AACGAGAaacggaaaattttggaaagtgCATCCCTTTTAACTGCAAAACT
ATACAAATTTGACGATTTATAAAAGGTATTTTGAACTATTCTGATTCTAA
ATTTTGGCTCCTTGATGTTTTACAAACGGTCTTCCATAAGAATTCTTTTG
TATGTTCTTTAC
Run BLAST on NCBI

transcript from alignment at sc0000012:581544..589063-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001942 ID=TCONS_00001942|Name=TCONS_00001942|organism=Clytia hemisphaerica|type=transcript|length=7520bp|location=Sequence derived from alignment at sc0000012:581544..589063- (Clytia hemisphaerica)
ATAAATAATAGAAAAGTAATAGAGAGTACAAACTGTGGTTAATATTGCAT TCAAAACTGCTCGGTTAATATTGCACCATGACTGTCTTTCCATCAATGGT AAGATTTTTGGGTTTATGGTTTTATGTCGTGAACATATGTGAACATTGTG AACATTTTAGAAATATTCATAGGCTTAAAGTTCAAAAAGTAAAGAACCTT CGAAGGCTTACAAAAATTTGGATGTTCTTCATAAAAAACATGTATTATTG TGTTTGTTAAATAACGCCCTGAAAATCATTTTATCCCATCATTTTCCAGG GTGGTCGTGATGTGGAAGATCGGAATTTCTTAACATTCACCATGCCTTCG AACATGCAATTAGAAGACAAAGGAGAGTTTAGCACGTGGTGTGAGAGGAT GATCTTCATCTTCGAAGATTTAAAATGGCTTCTTGCACTCCCTGTCAATG AATTCTGGAATCAGGTTAGTCTTTCGGAATAGAAATTCTAATTTCATTAA TAATCTACATAACGATTTTTAGGTCTAATACCATTTCAACAGCCTTGTGG TCTGGATGAAATATTTCATCCAAAAAGGCTACTTTTCCTTGATTTTCTAT CCTTCTTGTTTCCTTTCTATTCTCCACATTATTACTTTTAGAGAACTAAT TTTGGCAATCATCACCAAAATCAAAATAATTGTTGCCTCACCAAAGTACT CCCCAAAATAAACTTTTTTGATTTAGTTGTAATATTTGAAATTTAATTCC TAATTTTTGCGAAAATGCTCATATTTTAGGCAAAAAAAGTTATTCGCCAA AATTAGTGCAAAACAAAAAAATGTCCTACAAACGTTTAAATAAAGTTTCA TTCAGCAAGAGTATTCGCACATATTTTGCGACTTATTTAAATTCTATTCT TCTTCAGGTCCTACATGATACAACCTTGACATCGAGTCTTGAATCGTTTC TTCAAAATTCACCGAGGTATAAAGAAGCTCTCGTTTACTAATAGATAAAC ACCATAGAAGTACTGTAGTGTAGATTTCCTTATATTTTGACAAACGTTTA TTGGAGTTTCATGCTATATTATGGGAATCCCAAAGATTTTATTTAGATAT TTAGTCTGAACAGTTGCGACTTGACCGTGGGATAAGTTTGGCGGTTCGTA CCGACTATTTGATTAATTATTGAACTATATTTCTAGCAGACACAGAACGT TTTTCAAACGGTCATCTGACGCTTTGCTATCTCACCACTCTCTCTATACT AGATTTTATGATTTGAAGAATATCCCAGAGACATGTAAGACAGCATTGGG TCGAGTCAGCAAATTATACCTTTTGGTCATTCAGCGGATGAGTTTACATG ATGAAGATCAGGTTTGTCGATCGTTTTGAAGATTATCCCTTGAAAATGTT GATAAATTATAATAATATTTCCAATTTCGATTTTCAAGGGGAATTGTCTT TTTATCGAATAAGAGAACATTGAATTAGAGAGCGACAACTGTATTTTATA AAGCTTTAGTTTGTATCATCATTAAATACAAGGATCATTCCTGGACCTGG AACAAACTCATTTATTGTTTTATGAATTTTTTTTGTAAGACCTTTAACGA ATTTCGTGTTTATAGGTAAGTGGCACCTTTGACTAATAATAGAATTTATT GGAGTTCAGGATATTAAAACTCTCATTTTTTCTAACTGTGCACTCTTTTT TGCTACAGTGTGGAATCCATGTTGGTTTAATGTAAGTAATTCCTTTGAGA GTGGTTTCTACACGATAGCAAAGTAGATTGCGAATGGATATATATTTATT TTGTTTGAAATATTCATTTTCTGATTNTAGCAAAGTAGATTGCGAATGGA TATATATTTATTTTGTTTGAAATATTTATTTTCTGATTAGAACCAACCGA TGCCAACTGAAGTATTCGGTGATATGATTTACGAGAATTACATTTTCGAT GCTGCCAAATTGATAGACATTTGCGCCATCTTTCAACGGCCAAACAATGA TGAGATGCAAACGTTCCTGGGTACTANTGATAGACATTTGCGCCATCTTT CAACGGCCAAACAATGATGAGATGCAAACGTTACTGGGTACTATTATGGA AAATGTTTTCGCATGCCAACCTAAGTATGTATTGTTAATTCGGAATCTTT AGATTACGATAGTGGTGGTAGCATGAAGGTAAAGCTTCAAGCTACAACGC GCAAGGTTGTGGTTTCGAACCCTATGTACCGGGTCATATCAAAGATTCCC TAAATTGTACTCGATGTCTCTCTGCTTGATCCACAACAACTAAAGAGAAG ATTAAGTAAGCTGAGAAATCCAAGGAAAGGAGTGGCGTCCTCCCCTACCT CCGGGTAAACAGCTGAAGAGAAACGGGAGCAATTTCGGCCCTCGACTGTG GTCGCGAACAATACAACTTTAAACCGGAACCATTTTGCCCGGTTTCTTTT GCAGTTTCATAGAAAGGTAATAAGAAAGGTAATACTATATATTTTACCAC AACCATATTTCAATTTTATAATTTCAGCTACTACAATGACTTATCAAGCG CTTTTGAAAGTATCATAGTGACCATTTCTAACATGGAAGAGAGGCTGCAA CCACCAAAAGGAGGCAAACCTGTCAATGGAAGAGAAGCAGTAGACATGTT GATGTTTTTATATGACATGACTTGCTCACTATCTGCATTTTTGAATGTTT TCCCTAAAGCTTCTTCATTGCTCTTTCGTACTGATCTCATTTCAAGGTAG GTATTTCCCATATTAGTCATATTGTATCGTACATACTACGCTTCTCTATG AATTGAACATTCACAGCGAACGCAAATTTGTTCGAGTTATGGAGAGTTTG GAGGACAGAGAGTCGTTCGAAGATTTATGAGCTGAAAAAAGACTGAAATA GTGCGTGTTTTCATTTAGATCTCAAGCCAAATGATACCGTTGCAGAATTT TAATTCTGATTTATCTATTCTGTTTCACCTTATAAAAGATTGGCGACTAT TTACGAGACAATGGTGCCCATGTTGATGAAATTAATTGAAATCAATCAAA AGAAATTCAAATATGTTTGCGCATGTGTACAAAAAGAACTTCTTCAAATT GTCACCTTTTCCATCAAAAACGGTTTTGTTGCAAGAACTAAAGATTTGTA AGTCAGAATCTATTTACTTTTCATTTATGTCCACAAAATACAAGTTGTTT CGTTTTTTAACATTGATTTGTAGATGGACTGTCTTAAGAACTTTCTCCCC CGCTGGAAGATTTTCCCAAAAGTCATCTCTTAGACAGGTTACGGTAAAAT CGAATCCGCATTTGGAAGTTTCACAGCAATTGCATCCCCATCGCAAACAA AACATTCAAAAACATCCCACCGTTAGTTTTGAGTTGAAAACATAGAATTT ATATCAATTTCCATTGAAGTTTTAATCCCCACTAAATGAGAAATATCCAC CGGGACACTGAGAAAACGATGGCAAATATCATTATATGTCATCTGATATC TGGATTAGTGTCCACTCACGCTAAAGCTTTAAAGAAGCGCTCGATTTACC ATTCAAGAGCAATGGCAGTCGATCTTTGGCGTGCCGCATCCTCAGTCGGG TTCAACTGTACTTGCATGTAAGCCTAAAATATTTCGGTTGGACCCGCGAA TCCCCGAAAATGAGCGCTGGGGGTTCAGGGCTCCCGCTGCAAATTTTGTG ACGCGCTCTGGCGACTCTCTCTCCGACTTTCAAAGCTTAAGCGTTTCGGA AGAAAATTTCCACATCGGTTGCCAATCAAATGACAATGCAAAAAAGTAAA AACTAAGTATCATTATCGTTTACTATTAACCACAAATTTCATACTTTATA TTTTATTGTTTTGTTTCAAGGTCTAAAGATGAAAATGAAGAAAAAACAGC ATCATATATTTCGATCATGGATTCGTTGTCTCAGTACAAACGGTAAGTCA ATAGTCTCTAAGTATGATAATGCGTGCACAAATTTAACTCAGCTTTTGCT TGAAAAAAATAATTTTTGTCTTTCTTCATCAGATTTTTCGCCAGGTACTG CATGACCAGTAATGTTAGTGAAGACTTGGAACAAATCAAGAAACTGGATG TCATTGATATCTCCAATTTACAATATTTGAGTAACATGGCAGGTGTCGTC GTCCACGAAACTGATACTGATGACGTAAGAATCTTTGATCTCGCGCAATA AAGTGTAAATAGCCGTAGTCATTCATCTCCGATGTAGGATTTATAGCTAC TTAATACTTACATATATGTCGCGCGGTCCGCGTAGTTTTCACACAAACGG GGTTGTGATAAAAAAAGATGTCTCATCAATGAAAATACCTTAAAAAGGTG AAATGTTATCAACTTGTTTTGCATCATTGCTTTGCCAAATACATGTCAGG TATTCGACTGTAGTAGACTGGAGGTTGATAGATGTGTTAAAGCAGTTAAG CTCTAGTTTAAACCGTCGAATTTCTGCCTTGCCTGCCTTCTTAGAGTAGG CGAAAAGTGGACAGAAGGTTGGCAGTTAAAATCTTTGCTTGGAAAAGATA AAAGAATTACATTGACGTCAAAAGAGGGCATTGCATTGTCTTTAAACAGC CAAATTTCTGTCTGTTTAACTCACAACTTAACCAGAGTTAACTTTTTACC CTGCATCTTTAGACTTTGAAGCAACTTCGTGAATTACTGCCCAACAAATC CGAAGAATTCATTCGTAACTGCATGTCTCAGTATGGTTCCAACGTTGAGG TCATTCTCAATAACGTGATGGAAGGTAACATTGTCGACGAGACGCTCCAA AAACCTGTCAAGAAGAAACCACAAAAACTAATTCCTGATAAGGAGTTTCT TGAAGACAATAAAGAACACGTGGAACGTGTTAAACTATCATTCTATAACC AATCAGAGGAAGGCAATGATTATGATGACTATGGTGCTAATTATGTTAAT TATGATAATGTATACGATGACGAGTATGACGATACGTATGACTCACAAGA CGTCGGCGCCGCTGACACGGATAACGTAGATGAATTGTATAAAAGGTATA GCATTTTTTTAAATCAGTCCAACGAGCAAGTATCTCAAGGGAATCTCGAG ACTAATTTGTTTGATCTACGGTTGTACTAAACGGTTTTTTTTCCATTTCA TCAAGATATTAACTTTTTGGGAACATTCTTACAGAATTCTTACTTTAGCA TGCAAACCCAGTGTAAATCTACATTATTATCCATATAGCGGTCATTAAGT AAGCCATTAAAGGTTCAATCGGCGGGCGGTATTGAAAGGTTCTGTGATTC AAATTGTCATACCCGCGCTGAGGAAACTAAAGCGCCAGGCTTCAGAGGTC TAAAATATCATTAACGGCCCGGGTATAGGGCTATAACATCATTTGCGGCC CGCTCGGAATTGGATTGAAGTCGTTGCATTGAAGCGAAGAGACTAAACTA ACGTCAGAAAAAAACACTTTTTGGTCATTTGCGGCCCGCTCGGAATTGGA TTGAAGTCGTTGCATTGAAGCGAAGAGACTAAACTAACGTCAGAAAAAAA CACTTTTTGGTCATTTGCGGCCCGCTCGCAAGGTGCTAAAAATTTGTTGA AGACATTGCATTGAAGCGAAAAAAAATCGGTTGACGCTAGAAAAAAATGT TGTTTGAATGTCCGATATGGATAATAATAGTAATAGTGTTAAGTTTTCGT TCGTTGATGTCATTAATTCTGCCCTTGCAATTTGATTATTAGCCCTCTAG TGCCATTTGCGCCCTCCGCTTCGCGTTGGGCCCAAATGACACTATCGGGC GAATAATCAAACTACGCGAGCAGAAAATAACAACAACGACCTCAAATTGA ACGCTTTTGTTATATTTAATTTATACGTCAACCAAGAATTTGGCATTTTT GTAATACTTCTTAGCATTGCTGGGGAATTGCCAATTTACAGCTTAAAGCA CCTTTAGTTGGCTTAGTCCAAAACATCGTAAGAGATTGAGTACAAAAATA TAACGGTCGTAATGTAAAGGTTAAGCATTCGGCTATAGGGCGCAAAGTCA TTGGTTCAATGCTGGTAGAATAATTGGAAAAGCAACCAATGGTTTTTGAT GCTTCTGCAAGGGTAAGCAGAACGATCTAGGGTGTGAAAGAGTGGCGCCT TCGAGTAGCTAGTTATCAAGAAAATGGCTTCGGACATCGCCGACTGCTGT CGCAAGTCTTACTTAAAATGATACGTTAATATTCTTTTCTCTTCATTAAT GACATCAGGAAATTCACGGTACCTCGTGTTCTTCAACAAATGAATCGAAA ATCAAGAAGAGGAGAACAAGAAGATGACGAAGAAGAGAGTGAAGAAAGTG ACGAAGAAGGGAGTGAAAATGATAACGAAGATGGTGGCGAACAACAACAA CAACAACAACAACAACAACAGAATCAATACAAGGTTTGTCTTACTTTACC GGGTGGTCCAAAAAAAAGTTTCCATGAATTTCAAATTTTGACGTAGAGTG CTCTAATTGTGCTATCGACTTTAATGGGTAGAACTGGACTTTTACACCTA TCAACCTATCTTACATCACAAGGGAAACGGGTTTAAGTTTATCATGGTTC TTCTTGCAAAAATGTTTTAATGGTGGTCCAGAAATCGATACTTGGTTCTT TCGTACCTTTCTTTAATGTACGAACGCCGGTGCTATTGGCTAATTTAGAA GTTTGCCGAATCTAATACAGTGTTTAAAATTAAAACTATTTCGTCCTGTT ACTATCATTCATTTACATACAATTAATTTATGTATTTTTTTCAGGGTAAT AACAATAGAAGAGGAGAATGGAAAGGTGGTGAAGTTTCAAATAATCGTGG TGGTGGCGCACGGGGAGGGCGTGGAGGTCAAGGCGGAAACAAACGAGGCG GTGGACGCGGAGGAAATAAAGGAAACAAGCAACAAAATAATGATAAATCG CAAGGAGGACAAAAAGAAGGAAGTAATCCTTCACAACGTGGTGGCCAACG TGGCGGGAGAGGAGGTCGTGGTGGGCGTGGAAGAGGCGGGAAACGTAATC ATCGAGCCTTGGCTGATAAAAAGATGTCGAAGGGAATGTTTTGAAATCAT CACCCATCGTCACTTATTATTGGAAAGCTAGTTATTATGAACAGAAATAC TTGCTTGCATCAAATCTCTTCGATTAACATTAAGTCCAATAGATTCAGGT TACTATCTTGAAATATTATCTTGAAAAATAACACTTTACGTACTAAGTAT ACATACATTAACATTATATTTTCCATTACCGTCTTTGTAAAACAAACCAA TAGATTTCGGAGATTAAGATAAAAATTATAAAAAACGAATCCTGGAAATT CCTTTTAAAACGAGAAACGGAAAATTTTGGAAAGTGCATCCCTTTTAACT GCAAAACTATACAAATTTGACGATTTATAAAAGGTATTTTGAACTATTCT GATTCTAAATTTTGGCTCCTTGATGTTTTACAAACGGTCTTCCATAAGAA TTCTTTTGTATGTTCTTTAC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_001005XLOC_001005Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001942-exon-sc0000012-1575043694:588966..589063TCONS_00001942-exon-sc0000012-1575043694:588966..589063Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:588600..588764TCONS_00001942-exon-sc0000012-1575043694:588600..588764Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:588098..588156TCONS_00001942-exon-sc0000012-1575043694:588098..588156Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:587703..587811TCONS_00001942-exon-sc0000012-1575043694:587703..587811Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:587096..587173TCONS_00001942-exon-sc0000012-1575043694:587096..587173Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:586940..587028TCONS_00001942-exon-sc0000012-1575043694:586940..587028Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:586318..586536TCONS_00001942-exon-sc0000012-1575043694:586318..586536Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:585917..586075TCONS_00001942-exon-sc0000012-1575043694:585917..586075Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:585122..585193TCONS_00001942-exon-sc0000012-1575043694:585122..585193Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:584890..585019TCONS_00001942-exon-sc0000012-1575043694:584890..585019Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:584019..584401TCONS_00001942-exon-sc0000012-1575043694:584019..584401Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:582631..582805TCONS_00001942-exon-sc0000012-1575043694:582631..582805Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1575043694:581544..582269TCONS_00001942-exon-sc0000012-1575043694:581544..582269Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:588966..589063TCONS_00001942-exon-sc0000012-1510915933:588966..589063Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:588600..588764TCONS_00001942-exon-sc0000012-1510915933:588600..588764Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:588098..588156TCONS_00001942-exon-sc0000012-1510915933:588098..588156Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:587703..587811TCONS_00001942-exon-sc0000012-1510915933:587703..587811Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:587096..587173TCONS_00001942-exon-sc0000012-1510915933:587096..587173Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:586940..587028TCONS_00001942-exon-sc0000012-1510915933:586940..587028Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:586318..586536TCONS_00001942-exon-sc0000012-1510915933:586318..586536Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:585917..586075TCONS_00001942-exon-sc0000012-1510915933:585917..586075Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:585122..585193TCONS_00001942-exon-sc0000012-1510915933:585122..585193Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:584890..585019TCONS_00001942-exon-sc0000012-1510915933:584890..585019Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:584019..584401TCONS_00001942-exon-sc0000012-1510915933:584019..584401Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:582631..582805TCONS_00001942-exon-sc0000012-1510915933:582631..582805Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1510915933:581544..582269TCONS_00001942-exon-sc0000012-1510915933:581544..582269Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:588966..589063TCONS_00001942-exon-sc0000012-1491911889:588966..589063Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:588600..588764TCONS_00001942-exon-sc0000012-1491911889:588600..588764Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:588098..588156TCONS_00001942-exon-sc0000012-1491911889:588098..588156Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:587703..587811TCONS_00001942-exon-sc0000012-1491911889:587703..587811Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:587096..587173TCONS_00001942-exon-sc0000012-1491911889:587096..587173Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:586940..587028TCONS_00001942-exon-sc0000012-1491911889:586940..587028Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:586318..586536TCONS_00001942-exon-sc0000012-1491911889:586318..586536Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:585917..586075TCONS_00001942-exon-sc0000012-1491911889:585917..586075Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:585122..585193TCONS_00001942-exon-sc0000012-1491911889:585122..585193Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:584890..585019TCONS_00001942-exon-sc0000012-1491911889:584890..585019Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:584019..584401TCONS_00001942-exon-sc0000012-1491911889:584019..584401Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:582631..582805TCONS_00001942-exon-sc0000012-1491911889:582631..582805Clytia hemisphaericaexon
TCONS_00001942-exon-sc0000012-1491911889:581544..582269TCONS_00001942-exon-sc0000012-1491911889:581544..582269Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:581544..589063 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0.71006 0 1.85475 1.81161 2.37256 1.16263 1.04592e-08 2.37212e-10 3.45079e-10 0 0 0 4.22366e-05 0 0.470583 0 0 0 0 0.838835 0 1.26378 0 0.176136 3.46516e-09 0 0 0 0
Blast
BLAST of TCONS_00001942 vs. Swiss-Prot (Human)
Match: ASCC2 (Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens GN=ASCC2 PE=1 SV=3)

HSP 1 Score: 142.124 bits (357), Expect = 9.719e-35
Identity = 86/280 (30.71%), Postives = 141/280 (50.36%), Query Frame = 3
Query:   90 PSMGGRDVEDRNFLTFTMPSNMQLEDKGEFSTWCERMIFIFEDLKWLLALPVNEFWNQVLHDTTLTSSLESFLQNSPRFYD--LKNIPETCKTALGRVSKLYLLVIQRMSLHDEDQNQPMPTEVFGDMIYENYIFDAAKLIDICAIFQRPNNDEMQTLLGTIMENVFACQPNYYNDLSSAFESIIVTISN------------------MEERLQPPKGGKPVNGREAVDMLMFLYDMTCSLSAFLNVFPKASSLLFRTDLISRLATIYETMVPMLMKLIE 869
            P++      DR F+ +  P    +    E   + ER  F+  DL WLLALP ++FW QV+ D TL   L+S+L+  PR +D  + + PE       R+ +   L   RMS H E ++  +    FG+++Y N++FD  K++D+C +F + N+  +Q ++G    N+F  QP+YY+DL     +I+   SN                  +EER +      P+   E  D++++L D   +L AFL++FP A     + D   RLA+ YE  +P +   I+
Sbjct:   25 PALHPEQKADRYFVLYKPPPKDNIPALVE--EYLERATFVANDLDWLLALPHDKFWCQVIFDETLQKCLDSYLRYVPRKFDEGVASAPEVVDMQ-KRLHRSVFLTFLRMSTHKESKDHFISPSAFGEILYNNFLFDIPKILDLCVLFGKGNSPLLQKMIG----NIFTQQPSYYSDLDETLPTILQVFSNILQHCGLQGDGANTTPQKLEERGRLTPSDMPL--LELKDIVLYLCDTCTTLWAFLDIFPLACQTFQKHDFCYRLASFYEAAIPEMESAIK 295          
The following BLAST results are available for this feature:
BLAST of TCONS_00001942 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
ASCC29.719e-3530.71Activating signal cointegrator 1 complex subunit 2... [more]
back to top