Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001868 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001868
Unique NameTCONS_00001868
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2544

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001868 ID=TCONS_00001868|Name=TCONS_00001868|organism=Clytia hemisphaerica|type=transcript|length=2544bp
ATGTCTGAACTGTATAACAGACCGGTCCATATTGCTCACGTTGCCAGGAA
AGAAGAGATCCTTGTTATCAAGGCTGCTAAGAAGAAAGGGCTTCAAGTGA
CCTGTGAAGTTGCACCCCACCATCTCTTCCTTTCCACTGACGATACCAAA
CGTATCGGTGAAGGACGTGCCAGGGTCAAGCCTCAAATTTGCAGTGCTGA
AGACCAAAAAGCATTGTGGGAAAATATGGACTTCATTGATTGCTTTGCCA
CTGACCACGCACCTCATCATGTGGACGAGAAGAATTCTGAAAACCCTCCT
CCAGGTTTCCCAGGCCTCGAAACTATGCTACCATTATTGTTGACTGCAGT
CAAAGATGGCCGACTCAcccttgatgacgtcattttacgTTTGCACACCA
ACCCGAGACGCATTTTTGGCCTTCCAGAGCAACATGACACCTACGTTGAA
GTGGACTTGAACGAAGAATGGACCATCCCCGATGCTATGGCGTACACAAA
GTCCAAATGGACCCCTTTCGCTGGGATGAAAGTGTTCGGTAAAGTTTGCC
GCGTGGTGGTCAGAGGTGAACTTGCTGTTATTGAGGACCAGgTGCTAGCC
AAGCCAGGTTTTGGTGAAGATGTACGCGCATGGGAGCCTCCAAATTGTCT
ACCACCTCTCTCCAAAGCTCAGAAACAGAAGCTCGATGCCATTAATAATG
AACAACCAACACCAGCCAACTTACCTGACATCGAACAACCTTCATTGCTT
AGCGGACCGCCCACGCCAATCCGCAAAATCTCTAACATTATGGAAAAGCT
TCACACACAAGACGGTCTATCTGCAGAGCACCACCATGCACCTCACTTCT
TACCACCATTCCTTCATTCTCAACTACTGGTCGGCAAACACGTCTTAAAA
GTGGAGTCCATTAACAAAGACCAGTTAAATGCTTTATTTAACATCGCACA
ACAATTGAAAAAAGAGGAGAGGCGTGGTCGACAGATCGATACACTTAAAG
GTAAAGTTTTGGCGCTGATGTTTTTCGAACCCAGTACTCGCACTGCATGC
TCGTTCCAGTCTGCAATGCAGCGTCTCGGTGGAACTACCATCGCTATCAA
ACCTGGAAACTCATCACTCACCAAGGGAGAATCTGTTCAAGATACGGTTG
CCACTATGGCTTGTTACAGTGACGTCATCGTCATGAGACATCCTACCAAA
GGCATGGTTCAGCAAGCAGCGGAGAAGTCGCGACGCCCGATCATCAATGC
GGGAGACGGGGTTGGAGAACACCCCACACAAGCTTTGTTAGATGTTTTCA
CTATCAGAGAAGAAATTGGTACCGTCAACGGAATTACCGTGACAATGGTT
GGTGATCTGAAGAATGGCCGTACCGTGCATTCATTGGCTCGATTATTGAC
ACTGTACCGAGTGAACTTACAATATGTCTCACCTGACTCTCTTCCAATGC
CTGAAAACGTTCAAAACTATGTTCACAAGTGTGGCATCCCACAGAGACAA
TTCAAGACAATTGAAGAGGCGTTACCGACAACTGATGTGCTATACATGAC
ACGAATTCAAAGAGAAAGATTTGCAGACCAACAAGAATACGAGAAGgtgC
ATGGTTATTTCGTGTTGACACCGAAAATGTTGACGAAAGCGAAGAACAAG
ATGATCGTTATGCACCCATTCCCAAGAGTCAACGAAATCAGTACTGAAGT
GGATTGCGACCCAAGGGCTGCTTATTTCCGTCAAATGGAATACGGGATGT
TTGTTCGAATGGCTTTACTTTCCATGTTGACTGGTCGATTTTAATGGACA
GAGAAAACCGAAAATTTACGTAATCTTTGTCATAAAAGAAAACGTCACAA
AAAGCGAAAATATTGTAGCCATCTGAGCACTAATTTTATAGCTCGACAAA
AGAATATATTATAATGGATTGTAGGGCAATTTTGTAGTCATTAATTTTTA
AGTCGGACAATTTTCGGTCAAAGAATTTATCACTTTCCCAAAAGAGACAT
TGCAAATTCGTTTCTAATTATTTCGTTAATTGGTATTGTCGACAGTAATT
AGATGTTTGTGATATTATTTTTGCGGTTcatatttgagatttttttattt
ttgtagctTTTTTTCCAGATcccttttttagttttatatatttttacttt
tgGGATAAATAGGCTTTTTTATTATcatattattgaaaaaaataatcaaa
aaatcttgacaTAAAAAAGGAATACAACATTTGATCATTTGCTTATGTGA
AAGATTGTTTATTGTAGACCACAATCCTCGCAAAACCAATTTCCTGAAAA
CCGTCACTTTCACCTAAAGTGCGGACTACATTCTTGCGAACTTTTACGAA
AGGTATTAGCACTCTTCTTGCCGGAAATTTAGGAAGTTCTTTCAACCGTC
AAAATACACTCTAGATTGCGGTTTTTCCATAGTGAATTTTCGTTTTGAAT
GAATAATTTCTTCTTTATCTTAAACTCTCACGATATAAGTTAGTACTATG
AAATTAAGGGGAATGAATGAAAGAGTACTATATTCAAATCAGCC
Run BLAST on NCBI

transcript from alignment at sc0000012:62297..95755-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001868 ID=TCONS_00001868|Name=TCONS_00001868|organism=Clytia hemisphaerica|type=transcript|length=33459bp|location=Sequence derived from alignment at sc0000012:62297..95755- (Clytia hemisphaerica)
ATGTCTGAACTGTATAACAGACCGGTCCATATTGCTCACGTTGCCAGGAA AGAAGAGGTAATGTAGACTAAGCCATAAGCTCAACGAAATCATAATCGAC CGTTTCATTTGACGTTTCTTAGTTAACCTTTCTCTGGTCTGCATTATTTC ACTCTAAAAATGATTTAAAAAATCTTATTATTTATGATTTTGAGCTCTCA TATTCAACTTATTTTCTATTTTATATTATGATATTTATTATAATTCACTG GAGTTTTTATCAATTTTATTCATCATTTCCACACTTGATCCACTTCCACA GATCCTTGTTATCAAGGCTGCTAAGAAGAAAGGGCTTCAAGTGACCTGTG AAGTTGCACCCCACCATCTCTTCCTTTCCACTGACGATACCAAACGTATC GGTGAAGGACGTGCCAGGGTCAAGCCTCAAATTTGCAGTGCTGAAGACCA AAAAGCATTGTGGGAAAATATGGACTTCATTGATTGCTTTGCCACTGACC ACGGTTTGTTTTTTCCTTGTAATCCTTTTCATTCCTATAAATTCTGATTC TGAAGATTTTGCCCTCCCCTAATATTATTAACTTATGTGAATATTTTGTC TGGTTTTGCGCCCAAGAGTTTTGTTCTTTTATTTATCTTTTCAAGAAAAA ACTATACGCCTTGTAAGTTAAAACTAAAGGGAACTAATTTTCGAAATAGC CTTATCTGTTAAAATTAACCTTAGCTGATTGTATTTGTTTTTAATCACGA TATATTATGCAAGCTATTTTGGAAGCAATTATAATATTTTCAATGGGATT TATTAGAGGTCGGTTAGTGGGCAAAACCTCAAAACACACCTTTTTATAGT ATTGTTAATGGTTTTTTAATGCCCCTTGCTTTTTTCTCATAACCTAAGAA ATTCGATGAATCTAAATTTTACTCTATAACGGTTTGTTGATTGTGATTAA ACGAAAAGGATCCTGATTGGTTCATTTGAAAACAATGAAAAGCGGGTCAA GGTATTGTGAATTAAATCAAGTTGTAAATCAATTTAGGCTTGCCATTAAG CTTTTCTTCCTGAGGGAATCTGAGGTAGTTTGTTTTATAAGTGTGAAAAG GAAAGCTCAAAAGAGACGAAATGCCTGACTGGGTTGGAAATTAAAAACTA GGTGCGACGGTTTTTGGAACCGACTCGAGACTAAAAGTGTCTGATGAAAA TCAATAACACTGAGGTTTCTTATGAAAGATTCCATCCGACGATCCGATAC CTTTGCATGTCATATATTTTTTCATTAAAACGACCAAAACTAATTTAGTG GTTTCTTCTTAATTGGACTTTAACAATGCAATCCTCATCAATGGAAACGA GGTCTATCTAAACGGATCTAAATTTAGAAATTGTGATGAAGGCATGGTAT GATTTTCAGGTGATACTGTCGATAGCTTCAATAAGTTTACTGCGAAATTA ATTGGTTAAAAGAAACCTTGCTTTTTGTAATTTTCTTTTTTCTCCGACCA ATTAACCTTTGAACCAAAAACTTTCAAAAACCTCCAGAAAGGCGGCTACT TTAACACCGAACTTTTGATAATTAAATTCCTTTATACAAAGCTCTATTTC CCACAGTAATTACAAACGATTGTTTTGTCTTGGTTTGGCATTAGACCAAA AAGAAGAGTATATTTAATTCAATATATACGACCAGTCATCTTTGTAATCA CTTAATGATTGACTGGCTGCTGATTTTTCTTTTCAACAGTTACATCTCTG ATTTGGCTTTTCATTCATTTCTTTGGAAGTTCTCTTTCCCTCCTATAATA TATGTGATGTCATAATTTTATTATCCTGATTTGATCAAAATCAAAGCATT TAATTTGGTTCCTTGGTCTTAATCAAGTTACTTTTCTTCTTTCTCTCCGT AATTGCTAGTCTTGACGTACGATTGTCTAATAAAATTTCACTTTTATTTA TAATCAAAGGCAGTCAAAATTGAATGATTTAAAAAAAGAATCATACCCTG TATTTGATCAACCAAAAGCCGTGAAACTATGTAAATTACAGGCTCTGAAA TTATTAAGAACCTTGTGTTCAACAACAAATAGAGACTTATTTAATCCTAT TCCCCTGTCTCAATATTAAATTATATTGAATTTACGTCAATTCCCCCCTC CTTTTTCAGCACCTCATCATGTGGACGAGAAGAATTCTGAAAACCCTCCT CCAGGTTTCCCAGGCCTCGAAACTATGCTACCATTATTGTTGACTGCAGT CAAAGATGGCCGACTCACCCTTGATGACGTCATTTTACGTTTGCACACCA ACCCGAGACGCATTTTTGGCCTTCCAGAGCAACATGGTAAGAAAAGAATT CTCTAAAATTAAGTTGAACAACTTTATAACCCTTATAACCAACTTAGTTG CTACATACCAAGTAGAGAATACAGGTTTTTTTAACTTCTAGCCTTCCTTA TTAGCCTGTTCTCGCTTAAAAGAAATTGAAAAACCGAGTCCGTCTTAAGG TCTGGAGTCAAGAACTCTTCCAGAAATGGATCTTGTTTGATAAACTGTAG GTTTTATGCAGTCAACGAATAGTTATAGTCGATACAAAGACTGGGCCTTC ATTTTGAATACTCTGACTGATGGATGGGCTATCAGTAAAAAAGTTCTATG TATTGTCAGCTTTATGTAGAAAGACTCTTTGATATTGTCTTGAACTTCGA AAATGTTGATTAATCATCTGAATGAAGGGTTTTCCTCTGATAATGAAAAT GCAGTCATTCATTTTAATTATATCATTTTTATCAACAAACGAAAAACAGG GATGGTGATAGTCTTATTAAGTTGGGATTAAGACACATCTGACTTGCACA CTTTATCCTGCAATTATAAGCTTTTTGACATCTTTGAATACTTTCACTGT GTTACTCAATTTGCCAGGAAAGCTAGCCTCAAAAGTTGGAAAAAGGATCT TGAAATTAGAACCCTTCCTTTTGTTTCAACATGGAACACAATAGACAAAC CATTCCACTCTACATGGGGTACTAGGTGTTTGATGGGTTTATATTAACTG TATGCGATGAAGAATTTGTCGCCCGTTATCAACTACTACTCCACAACTAA AAGGGCTTTAAGAAATTTAAATGGATAGGATTCGCCAGCACTCTTTAAAA ATGCATTTACACTTTGTTTCTTTCAATACTTTTACTTACCATCCCGTAAT GTTTTTCAAATGAGTAATTATCACAAGATTTGCACAACATGATTCGACCA ACACATTATTGACAATCTTATTTCCGTTTTTCAGCTCGTATCACCAGCAC AATGAGCATTCAGCCATTTCACCCTTAGTGCTTGAAACCCAATCACTGTC ATAATTATTGCCATGATTATGATGACCCCCATTTCCTCTGTCAATGTGAT ATTGACTGAAATTATTATTTGTTCATCCTTTAGGACTCGCTTAGTATTCG TTTATTATATTTGCATCTGCATTTGAATTTTGAATTGAAGAATTTTAAAG TTATTTTTATAGTAAGGAAAAACACTAGAGGTACCAAAGCTCTTTATTTT ATGCTGTTAAACTAGATATCTTCACAAATGAGGGTTTTTTTTCTCGAAAA GGCTAATTCTTGAAGCTAAAAAAATGAAAAAGTATTTTTTCACTGTCGGA AACCATAATACAATATATTTGCCGGCAGTCGTCAGCTGATTTTCGACGTC AGAAAAAATTAAAAGACATAAGTTAAATTGTGGCTTTTTCGAGACAGTAT AACAAATTGTGTCATTAGAAAATAGCAGGGAAAATATTTTTTTTGTAAAT TCAATCGAATTCTATTACACAAAATTTCTCATTGACGGAAGCATTCTGTT ACAAAAAAGAAACTAATCAGTGAGAAGGAAGATAATTATTTGCTCCCACC GTGATTTTGTAAATCATACCCCAAAGTACATGCTAGTTTATAAGAACCAG TAATTTAGTTGTTCTTATTTTTCGTGATTTTAAGGCATAATGTCCTTAAA ATGTTCTCAATGTGATTTCATGCTTTAATTATTTTGTAATGTTCTTAACG TGTTTACTTCACTTATCAACTTAAAAGGGATTGGGATTGGGGATTCTTCT TCATTGTTCTTAAAGAGCTTTTCTTCTAAAAAAATAGAGCGTATTCAAAA AATATCTCCACCTTTAACATCACAAAGTAAATCAACGAATTGTTTTAGTA TCTGAAAAAATTGCATTAGCCACTTATCGGATGACTGGTTGACTACCCAG TGTCATAAGTAATATCAAAATCAAAGCTCTGCTATAAGAAAATTCAAGCT ATTCATTACGCTAAGATACCCCAATTTCACTCAATACCTTCCATTTTCCC ATAGACACCTACGTTGAAGTGGACTTGAACGAAGAATGGACCATCCCCGA TGCTATGGCGTACACAAAGTCCAAATGGACCCCTTTCGCTGGGATGAAAG TGTTCGGTAAAGTTTGCCGCGTGGTGGTCAGAGGTGAACTTGCTGTTATT GAGGACCAGGTATGGCTAAATTATTTACCAACCATTTTTTTGAATATTTT TTATGGTGAAAAAGCGCGAATGTGCTTTTTAAATATCAAATTAACTCTTG TTTTTGCTCCTCCATTTGATTTTTGTGATAAAGGTTTTAGAGAGTTTTCA AAAATTTCCTACTGGACCATTTAAAGAAGAGGTCGTTTTCTAAAAAAACA ATTATTTTTACCAGATAATTTTCTTCTGTGGACGAAATAGTCTAATTTGA AATCGATTAACTGAGGAAAATGTCTCCACAAATGGCTTTAATATCGGTTT TTCTTTTCTGCCTGTCTCACTTTCACCTCTTTACAACCAATATGATGCAT TACTGCGTTTCTGCAACAAAAGAAATCGTGCTACTAATTGAAATTTCTTA ACGAGATTCTGCGGTTTAACCTCTTCATTTAACGACCTCCATGCTTATAG TATTGGTATAAAGAATCCTCATTATCGTGCGGGTCATTAATTTATACGAA TGATGTTGCTATAGTAACAACAATTATATGGAATGCTAAATTTAGGCTCT TTTGCACAACCCGTAATAATTTTTTTGCGATGGGTCATAAATTTGAGGAT TTGTATCCCCAGCTGTATTAAATGTCATCCAAATTTTCACCATCAATTTG ACCAGATAATTAATTTGCTGGGATAACTTTCTGACAGTGTGGTTACATTG TTTGTGTGATTTGTCATTTTTGTTGGTCATTTTTGAAAAATTCCTTGTGT TCAGTCATTTTTGGAATATTTTAATGTCTGTTTTTGAATGCTATGCTTTC TCTTCGTCACACACGCCCTTTATCATTATCACCCAAAACAAAATTGCACA CTTTAATTTGTTTTAGAAATTTCTGATCCGAACCCTATCTGCAAAATTTT TCGGTGGGAATGCTCTGCCTTTAACGACAGGACAATTCTTTTTTTCCAAA AGAAGTTTCTCAAATTTTGTCGAGATCTCAGCGCACTGTGGGTCAACTTT CGGAAAGGAAAGGATTTTTACTGTGACTTAAAATATCATTCAGAATGTCT TTCTTTGGAGGATTATTTCTAGTGAAAATTACAGATAATGAAAAAGAAGA GGATTTTGGGTCTACTCTTTGAATAAATCCCATCTCACTTTTTTACTTTT CTTTAGGTGCTAGCCAAGCCAGGTTTTGGTGAAGATGTACGCGCATGGGA GCCTCCAAATTGTCTACCACCTCTCTCCAAAGCTCAGAAACAGAAGCTCG ATGCCATTAATAATGAACAACCAACACCAGCCAACTTACCTGACATCGAA CAACCTTCATTGCTTAGCGGACCGCCCACGCCAATCCGCAAAATCTCTAA CATTATGGAAAAGCTTCACACACAAGGTAGGAATCTTTAAGTACTTATGT TTTCGACTCGATCGTTTTCTCAGAAATGTTAGGAAAATCCAACTCCTGAT GTACTGCGTTCAACCCAGATTCAGAAAAGTTCGAAGGCGTAAATTATGCT TATTTTTTATAGACGGTCTATCTGCAGAGCACCACCATGCACCTCACTTC TTACCACCATTCCTTCATTCTCAACTACTGGTCGGCAAACACGTCTTAAA AGTGGAGTCCATTAACAAAGACCAGGTTAGAAATGTTTTTTTAGAAACTG TATTTAGAAATACCTTAGATTTAGATTTGGGATCCTCGATTGCGGCCGTG GCTGTTTAAACTTAACACAAAAGGCATCTATTGTTTGGTTAAAGATCCGA TGATTAGTCGATTGGTAAAAGGCAGTGGAACGCCTTGAGCTAAATTTCGG TTTCTAAATTCCTTTGTCACTGTAGCAATAGATAAAGTGTGAAATAGGTA ATCGTCGTACATGAAATTCAAAACGATACCTTCATGGGTATGCCTTTTTG GTTTCGTTTTAAAGTTTTCATTGAGGTGAAAACGATTAGTTTTTGGGTTT AACTTGTGACGAATCTAATGTTTATCTTATGTCTTGTGTTTCAGTTAAAT GCTTTATTTAACATCGCACAACAATTGAAAAAAGAGGAGAGGCGTGGTCG ACAGATCGATACACTTAAAGTATGTCGACGCCCCTTTGTACATTTTACCC CTTTGTGTGCACACAGTGAAATCTACTCCACTTTGACTTTTCTTAGAGGG GTCTTGCTTCAAACTATCGTTGCCTTGCAAACAATGTACCCTAATGTACC TTTCAAATGTTTTTTTCCTATCCAATGTAGCTGACCTAGTTTCCTAAAGC TACAAAATTTGAAATAATTTCAAACCTGTAGATTGATAGTCAAAGCTTAA ATCCCTAACAAAAAATGAGTTTTCTTAAAGCAATACCTTCATTTTGGCTT TTCACTTAACATAGAACCTTAGAAGAGCCATTCTGTTTATTACTCAAATC TAGAAGCTGGCCGTTTCATCAAGATGTTTCTAAGACGATATGTCTCTGAA GATGGTTCGAATTTTAAATATTCTTCTTAATTTTGATAGGGTAAAGTTTT GGCGCTGATGTTTTTCGAACCCAGTACTCGCACTGCATGCTCGTTCCAGT CTGCAATGCAGCGTCTCGGTGGAACTACCATCGCTATCAAACCTGGAAAC TCATCACTCACCAAGGGAGAATCTGTTCAAGGTATACTAGCCTACTTTCT TTGTTTCATTTGCTTGATATCCCGCTGATTGCATAACATTCAATAACTCA GCTTCTAAAGGATGTGATTTAAGGTACCAAAGACTGCGGAAAATATCATT GTATATTTTAAAATCACGGGGCTTACAAAGTCTCTTGGTACTAAAGGTTC AAAAACCCAAAATAATACTTTCATAAAGTTTTGGCTCTACGAGGTTTAGT TAAAGTAGTTTATCCTTATAAAAGCTGTTTCATGAAAGTGTCGAAGATTT TTTTTCTCCCTCTGTCTTATCACTCGTGTCCTTTGGAATTTCTTTTCGTT CCTCTTGTTGTAAAGTAAGAGCGTAGACGACCAACTGTCTCCTCTATGTT CTATATATAGAAGTATGACATCATCGATCTACCATTATCCCTCCGTAAGC AACTGACAGACCAGCACGAGAACTATGAAGGTTTTTCCTTTTCTACTTAT GAAGATAAAAGTCACGATACTTTTTGTGGGTTTTTTATGGTTGGTTCAGA AAACACTGATTGGTCAAACTTAGACGTCCGGTCTTTTGAAAGCTCTCTCT CTTTTTGATGGTGTTATTCTCTCATCTCTAGAAAACTTGGACCATCCTTC CTGTTTAAGGGATAACTTCTTTACTTTTACTTATTTGTTTCATGGCAAAA TTTGGTAAAAATCTTCATTAGCCCATATGAGACTAACCTTTCTCGTGTAA AATATCTACTTTTTTTGGCCTACTGATGAGTATGATGCGAGTCGTTTAAA AAATGTTCGAATAATCAGAATCTACGTTATTTCTAAAGGGTTCTATTTCT TGAACGGTAATATCAAATTGCATGCAATAGTTTTGCACACGGCACAGAAT TTTTTTAAATGCCTAGATACCCTCAAAAGTGGACATTCGACCCCATGAAA TCTTTTTTCTACACTTAGATTATTTTCAATGGCGGCTTCGATTTACTGAA TTTTGACAGATTTATGCAATTGATCAATACACGAGCTCAATATTTTTGGC ATTTCAGCTGAGTGTCAGCAGTTGTGTTTCCTGATATAAGAACAAAACCG AACCATAGCTTATCCGATTACATGTATCCCATCAAAAGACTCTCGAATTA CCTTTTATCATCTCTAACAGGGTATGGGTCGTTTTATGCAACTAAAAATA AAATCTCTCGATGATATAATTATTTTTCCTGTGTCAAGTTAACACTATGG AGTTTAAAGCCCAGAGAAATACCCTAGATAAAAGGAAAATTTATGCTTAA TTTAACTTATCAAGAATATTTTAATTGTGAGAACAGACAAGGCACAGCCA AAATTCACTCGCTTTCATAAAAAATATCACGTCAATTTTTCTCATTTTAT GCAATAACAAATATGCACAATATTTTTAATGGAAATAGAAAATTACTTTC ATTAATTTCATATAAGTAGTGGTAATATCCAATTTGAAAGGGTTTAAGTC TTTAATTGGGTCAACAAACTTTTATATTGATGGTACTTTTACTAACCCCA TATCTCTGTCTCGTTTTGATAACGATTGTATTCAATACAAAGCCTGAGAC CAAAGCTGAGACTAAAGCATGTTTTCCACTGTTGTTAACAAACATGTGGC GCACACTTCAATCAGAACTTTCTCGGGCTTTCTTCTCTAGATTGACCTTA ATTACTCTTGATCTCACAAATTTGTTTAGAAGAATATCAGGGTTGTCCGC CGAACGGCAGTTAGTTTTTCAGGTTTTTCAGTTTTTCAGAGTTTAACCAA CGATATCTTGGTTAGGGTTGTTATTCAAAGTCTTTATGGACGAGCTATTG TTGCAGGGTCGCCGTTGTCTCTGTACCATCTATCTTACCACGCGTATGAC GCTTGTTTCTGACAATTTAGTAGAACTCGATGTTTTCTTATCTTTGAAGT AAACCATCGAGCTGTTTAGAGGACTTTTTCACAAAACTACTCTATTACGA TCTGTGCCCCATTTGAGGTGATAATCAGTTGAATTCTTGACTATGCAATC TTAATTTTAATCACTTTGGTTAACCCAAGTGTATTATATAGGCCTTTGGT TTTTGGAGAGCTATTTGCTCGTTATGGCCGCTTTTCCTCGTTAGCTAACC TAAACGAGTTTATAAGGTAATCAAATTGTAGTCGTACCGAAACCTTTCGA ACAATGCAACTGAAATGTTTGTTTTGACTTCTGCCATCCTTTACGTTTAT TGCATTGGAATTATCTCGTTGTGTCCACCTTGAGCCAATGAGTAATTTTC CTATTCAAGAATAAAAAATGTCATGTTTTTTCAGTAGTAAGAAGTCTGGA TATTTATTGTGAAACGACAGAGACGTTTCAGATTTACATAATCAACAAAG CCACAAATGATTTTTCATTGTGAATTAATACTTTTTTCTTGTGACACACC GTAAAAAAAAGTATAGTATTTAAACTTAGATAGTTTTTATGGCTCTGAAA ACCACAAATCTTTCATCATCCATTCTTTTTTCGAGGCACACTGTATCAAA AGGAAGTTCATTATGATTGACACACACTGTAGAGGAATTTGAAATTAGAT AATTCACAATGTCTCTGAAAACCACAAATCTTTCATCATTGAAAATTGAT ACTTTTTTTGAGGCACACTGTATAAAAGGAAAGTTCATTATGATTGACAC ACACTGTAGAGGAATTTGAATTAATTGGATAATTCACAATGTCTCTGAAA ACCACAAATCTGTCATCATTGAAAATTGATGCCTTTTTTTTTAGGCACAC TGTATAAAAGGAAAGTTCATTATGATTGACACACACTGTAGAGGAATTAC TTTTTGATACACGCTGTANGAGGCACGCTGTATAAAAGGAAAGTTCATTA TGATTGACACACTGTAGAGGAATTACTTTTTGATACACGCTGTATTAAAT GAGGAAGTAAAACAGATTAGTTTGAGGCACACTGTAGACGAGTTTGAAAT CGGATCAATATTATGTCAATTTTTATTGTCAAAAACACGTCATTCATTCA AATAATACGTTCTCGTGATCTGAGAGATGCAATAAAAAAGAAGGAAGGAT TGAGCCTTTATTTGAAACACTCTGTATAAAAATGCTGAGTTAGATATACT TGACAACAATGTTTATCAGATACTATAGCGGGAACCAAGACCACCGTTGA ATTGGAGTTGTGTTGTTCCTTTTATAGGCATAACATATTAACCATTTGGA ATCAGGACTCCATTTGTTTATATAAATAAACCTCATTTTTCTGAGGTGCT CTCCATCCTATCCTTATTTAAAAAAAAAGAAAAATGAGCCAGAACGTCAA ACGTCCATAAACCATTGCAACGAAGTGCTTTTAGATTTGGAATTCTTTGG CTCTTTTGGTTCATCCGACGTGCAGCACTCTTAGAACTTACTCGACGTGG TGTTGTCGACGGACATGGCACTTCATATATGTGGAGATGACGTCACTGAC AGCAAACACGAAGATATTAGTCAGCTGTCAGTTAGCTAACATTGCTGTCC TATTGTCATTTTCTTACCCGTCTAATAAAATGGTTTTCATGAGCATGAAA TTTTCTCACACTTCAAAAATTATGAAATGAGTAAAAAGTCTGAAGTCTGT GACGCTTACTATAAAAACTTGTCAATTCTTTTCGATGTCTACACGTTGTT AATTTTAGCTCAAAGGCCGGATATCAATATCGTCTAAGCCTGATCTTTTG CTCACTCAAAAATAACAGTATATTTTAACGACATCTTATCGTAATAAACT AAGGAGCTTTTGACAATTCAAAGTAGCTGTTATTGATTCTAAATACTAAA ATAACGTGATCCTTAACTTTTTAATAGCCGTAAAAATTTTCTAACATTGG AACCATGTTTCTGAAATTTGGCTTTTTGTCAATTTATGGTCTATCGTGAC AGTAAAGTCACGTGTGGAAAAATACGAATCCTTGCACTCGAGCCCAAACT AAATTCTGTAAAGCCTTCGGTTGTCCTTAGAATGTTCATAAATGTTTTGA CTTCGAAGCCTTATGTTCTAATAAAGTTTGTTCTTTTATTGTGTATGGAA GGCATACCATTGAAAGAAAAAGAGAAAAACTTGAGATCTGCCACTCGAAT GGAGTGTTTATTATTTCTATAATGTTTTCTGTCTGCAACATAACATCTCT TCCATCTCCTTAGGTAGGCCTCTTATCGAATGTCAACAACATCAGTCATC ATACTCCTGCTAAGGGGATTTTTGTTACCTATCTTGTGGGGGGGGCGTAC GGTATTTCGGAATTCCGGAAATCGATCTTCGGAAATCGGGCAAAATTCCT TCGGTATTTCGGAATGCTGAAACTGTTTCGGTATCGGAAGTCCGTGAACT TTTACGGAATCTCGGAAATTTCAGCAAAATTATTCGGTATCTCGGAAATC GCAAACCCCCATACGCCCCTCCTTTCTGATCCATGGTTTTGAGCAAAATT TTTGTTCTTTTGGCAAGGAAACCATATCCAGCAATATCCAACGGACTATC AACCTTTTATAGTTGATTAAGAGCCAGTGTTACTTTCAAGGGCACGATCA ATCTCTGCTTCGCATTAGGATCTAAAAGATCCAATGATTCTTCGATAAAA ATACATCTCTAAGAATTAAATTCTAATGCATTGACATTATTTTGAACACA GGACACGGGTTGACGGTGAAATTAAGAACATTTTAGACTCAAAAAGTTGA AAACATCCACAAGGCTTCAAAATAATTCGGATGTTCTTATAAAAAAAGTG TATTTTGTTGAAAATTTGAAAGGTGTGCAATGTTCGTTTCTTAAAGCGAG GCTACGAATTTTCTTTGCATGATAGGGCCCCCGGCTTGAGAGCTGAAGGG AGGGGGCCAAATATTGGAATAGATTGACGTTGCCCACCATGGTTGGGTAA CGGAGAAAAACTTTGAATTTTGAGGGTGAAAGAGGTATTTTAGGACCCAT TTCGAGTCAATTTGAAACGAATTCATTGAAGTTTTCAAAATAATCTTTCT CGGCAAAAAAAGTGAGGGGACACGACTCAATGGGTATATAAAACGTGGCA CTCAATTGTGTATGAAAACAAACAGTGTTTGCAATTGCAATTCATTGAGC AATAAGATATGTCGAATCAAAACACTTGTTATGTCAGACTCTTGTCAATT TTTATGGTATACTAACCCCCTTACGATGGTTGGGTTTTCCTCTGACCTCG TCAAAATAAAATTAATCAGACCATGAAATTAATTCAGCTTTCAGCAACTC AATTATTAAGTAATGATACTGTTTTTTTCCCAAAATAATGTTTTAAAAGC ATTTCTTTTACAAAATACACATACCACAATTAACTTGTGGGTTAAAGAAC AATCAGTTTTTAATCACATCTTTTCTTTTCTTTTTTTCTTAATGCTTACA TATTAAAAATTCCAATGGTTCGCTTCATGCTTCAAAATGAACTTGATTGC TATTTTTTCGTTTCTTGTTCATATATACTTTTTTCACTGCATTGAAAAAT ATCTGAAAAAAGCCCGACAACTTCCTTATACTCTTGAGCCTATCAAGAGC GTAATCCTGCAATAACTTGATCTAAAATACAGCCCTTTCTCAGTACACTG TAACCCAATAAGAATTCTTTTGCAAGGTGACGAAGTTTTAGCTGATTTTT TAGTATCTCCCAACTATGCTATGGTATTTATTTTCTTTCTAAAAGATTAA TTTTAAAGGAGCTATTAAGAACCGCGTACAGCACCTGACCCCGAGAATGT AGTAAACCCCGAGAATGTAGGTTTCTCATTTTTTAGTATTGTAGCCCTAA CGATAGTTCAACTTCATAAAAATTTGTTTCAGAGCATACTGTTACATCTT ACTGATTATTTCTGGACAGAAAATTTTAACTTGAATTANNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGAAAATCTGAAT GGAAGTTGATTGGATATTACCCGAACTGAGACATTTTTTAAATAAATCCT CTCTAAATCGAAATCTATTGGAATTAAGTTATGATGATTGGGTATTTTCT TAGTCCTAATGCACTAAGGAAATGGGGAAAATAGTTCATTTCAATATTTA CTGTTCTAAGTTAGATATTTTGACGAAAATGTTTGACCTAACTTTTGGGG TTAGTTGACCTACAATTTGGGGGCCTTTATAACCCGACATAAAAAGTCTG TCAAATTATATAAAACTTGTTTGTTGTACTTTAATAACATGAAAGTAATA CCTGAGAGATGATTAATATTGAAATGTTGAGCTTTTACGACGTGTCCCAG ACCCGTTGGGGCCCCAGCCCAATCAGAAAATTTGCCTAAGTTTGGAGCAA TAGAATTTCTATTCCAATTTGGACTTAAGTAGAAATTTTTGGACCCGAAG TGGGAAAAAAGTTCCACCGGGGCTGTGAGGCAGGGGTGTTGTTACATTAT TCACATATTTCAACACAAAATTTTCAACCTACAAAATAAAAAGAACTTTC TTGTCTCCTCTTTTCGTCCTTCCTTTTACTTTTCCTCATTTGTAGTAAAA TGAAATTAATATATTTGTTAATTTTTTGTCAGCGTATATTTCTAAAGTAT GAATTTCACTTAGAGAACAATAATTTCCGATGAATACCGAAATTCCATTC CCAACAACCGAATCTTTTCACCTACATTCTGGGGGTTAAAAAGTGAAAAA ATCCAATTTTCAGAATAACAAAATGCTCTTTAGAATATTATTTTTGCATA AAACATTTCTAAAATTTGCTGTTAGAATTAATACAATTGAAAAAATATCA ACATTATACTATTACTAGATTTAAAGCCATAAAACCAAACCTACATTCTG GGGGCTATAACGAAAATGGGAGTCAACTTCAAGGACCAAAAAAATTGGTC TATCTATCAAAAGTAATGAAACTAACCCCTGGGAAAGTATTTTGGGAGTT CAAAATTTCGTTAAAAATATTTAATATCTTTTAAAATGCAAATCTACATC TTTCAGGTCTGATTCAAATTTCACCTACATTCTCGGGGTCAGGTGCTGTA CGATTTTTATTTTCATATTTTCGGAAAGCTTTTTTATAGTTATCAAATCA CATCACCATTCCAAAGAACCATATCCACAAATTATGAAGATGGGTTTTTT TATAATAACATCCGAAATTTTTGAAGCCTTTGGATGTCCTTAACTTTTCG AGTTTTAAGCCTAAAATGTTCTTAAAATGTTCTTATTTTTACCATTGTTT TAGTATTTTTTCCCAAGAAATTGGGCATTTTAGAGCCCATGAAGCCTTGA AAGGTTCTTTGATATTTAGGCCATCGAAGCCTTATGTTCTTAAAAAGTTT GTTCTTACAAAAAAAACTTGTATTTGAAAAACACTACTTATCTCAATTAT GACTACACCCTTCAAAAGTTTTGCATTAGCATCTCAGTGAGGTGCTTACA GTGGCGAGACGTGAGTCTATTTTTGGTATGCATTTAATCTTTGATAGCGA CTTGAGAAAAAACGTTCAAGTTGTTACTTCTAATTGCACTTGAAATGAAG CAAAACCACTATGTTGGCAGCAGAACATTTTTCTAAATCTCATTCTCATT CTCCATGAATGCCGGTCCCTTTATAAGAAAAACTCCACCATTTCTTTTGC GCTACTAGCACTGTTTCTTACTTTACTTTTAGTTTATAGTCTTAAGAAAA CTGGCATAGGCCAGGGAAAAGAAATAATTATATTTCTAAAAAAGATATAT TTTCCTTGTCCTCTAAGAGTTACCTAAATTTGAAAATGACTTTTGGTATC TCTGTTCATATCTTCTGATTATCTAGCCCAGCTCGAAAACTTTAAGCTTA ACTTGATTGTTCATTCCTTTATCAATTCATTCACTCATTCATTCATTCAT TCATTCGCCTCCCATTCTTGCTTAATCATCATGAAACATGCGTAGTAAGG AAAGTAAATGTTGTTACAGTTTCTTGTTTCAGACAGCTGATTTAATTTGA TTTTGAACCACTTAAATGTCAACAGTTTGCGAACGGTAGTAAAATTCCTT TGTTTACTTCTTGGAAAACAAATTCTTTGAAAACGATACCACTCTGAGTA TTCCAAGCTAAAAGTCAAATAAATGATGCCAACTAAAGTCAATAAAAACA GTTTTTTTAGTTCTTATAGAAAAATATTAACCGTCAATCTTATTGTTACC AAAGTGATTCGACCACCAAATGGGGTCATTTAACATTTTCAAACAAGTCA TTTTCTTTTAAAAAGAGATCGTTAATGGCCATTGACAGTGTTATTCAAAC CGATACCCCCTTAAAATGTTTCAAACGGAATTTATCGTATATACAGATTC TGTTTTTAGTTGAGAATTCTATAAGAACAGCAGACTGAAATTGATTTAAA TTTAAAAACAAATTATGGAAATGCTGATTTCGAGCACAATTTGGATGAAG AAAATTAAAACTCTACTGCGAATAGCGGACCAGGCTTGACCAGAAATGTA TAGTTCTTAAAAGCAGTTCAAGATATTGAATGGCCATTTTGAGTCTAATT GTTGTCCTATATTCTTGAGTTAAACCAAACCACAGACCCCTCCTTCTTTC CCATTAAACAAGCCGAAATGGGGTTGCTGTAATATTTTGGATGTCAAAAA TTCTCAATTTTTTGTGGTGTCATCGTACTTGTAATTTACGTAAGAAAAGT CAATCATGTACCAGTTTATCACTTCCTTACCTTTGTATGCCATTACCTTG ATTTCGACCCTTAAATGCTTTTCTTCCAAATCAGTCAATCTGAAAAAGCT ATGCGGTAATCCCTTTCTACACTTTTTTATATTGTTCCTCTAAAAAGGTC GAAATGTTTTTGCTTTTGTTAATTCAACTCCTTCAAAATCTTTAAAAACA ATATGGAAATTTTCACTGAATAAGGACTTTCTTTTACCACCTATGACTTC TGAAATTTATGTTAGGTAGAGACATGTGTCTTTGCCAAACACGCCGGGTG TTACCTTAAAGCAATTCGACGCCTTAGTAAGTACTAGTAACTGAAAGGAG AGGTATACAGAGTTACTTTAAGATGGAAACAAAGGGGATAGACGCACTGC ATTGCACAAATTCAAAAAAATGTCAGCAGTAAATCAGCCAAAGTTATGTA TGAAAATAAATATTGTGGTTTCGAGTTTGCTTTGTTTAGATTATTCCTAT GTTTTGGGTATTAGATTTCATTGAAATCAGATCACTTTTTTACCCTCAAA ATGATGGCTCATCATAAAGGATCTATTGGCATCAAGTATCAAAACTTTTC TTTCAATCTGTACTCTTATTTCACAATGTAAAACATTCCTAAAAGAGAGA TGGACTTTAGTCGAAATAAAACTGAAAATTCAAACTATTAGTGTAAGAAT ATCCCCCAAAATTGGTTCCATTTTTTCACCTATCAATCGATACGAATAAA TCCTGACAGAGCTAGCAAAATGAAAACCTTTTCTCTTGCAATTCTAAATA TCCCTTGCCCCTAACTTTTCAATCAAACCAATGATTACAAATAAGTAATG ATTGTTCTTCAAATTAATCATCCTTTAGGTCATTAGTAGACAAGACTATG CCTTTTCTTTTGAGTACTTTGTACCTGGCATTGTATGTTCTAGTTCTTCC ACCATTTTTTCATCCAATAAGGTGCGTAAGTACAGCATACTTCGTTCCCT AATAGTACGGCATTTGTTCAAGAGATGTCTTTTTGTTATCTAATAAGAAG TGTTGGTACATTATAGACTGAAGTTGTTTTTTTCCTGTTTTAGATACGGT TGCCACTATGGCTTGTTACAGTGACGTCATCGTCATGAGACATCCTACCA AAGGCATGGTTCAGGTAAGGATATCTTTATCATGGTAACGAAAACGTTTA CTTTTTAGCTGACAAGTTTTTCGATCCTAAAATTTGAATAAAGTACTGTT GAATACAGTCTCCTGGCAAAGCTCCAATACAAAGATTTGAACTTGCTAGA GGCTTCAACAGTTTTTAATCCAAACAAAATCAATAGCGTGCCATTCTTCA CGTTATTTCAACATCCTTGATAATTTCGCGATCACGAGAACCTTATTTGA AACGGTTTTCTGATGTTCTCAGATTGGGCAGATTCTTCAACTTCATATTT CTATAATTCTCATCTGTATCAGATAAAACATAGGAGTTGTTGTAGTAACA GTCGTATGATTTAGAGTACGTGCGTGAGTTTTGAAAATTCCATTCAAAAT GTACTTGAGACTACTCGAGATGACTTTAATCGAGTGCCTTTTTGCGTAGG TTTTTTGAACCTTTCTTTATTGTGATTTGGAAAAGAGAAAAAGTTAACTG CATTTTTGTACCTCTGTAACGAACGTTCGGGCGTCATCACTTGGGAAGCG GTCCTTCTTTGAACGAAAAACCTCCAAACCTTAATACTTCCGAGATACTC TGGAAGCCAACTCTCTGAAAAAGAACACTTTTTAAACGATTTCTTTATGC CGCCATTTAAACCAAAAATGGTCTAGTGTGACAAGTACTCTTTTCCTGAA AATTCTTTTCCACGTTGGACCTGATTGTTTTTAAAGTGAGTTTTCCCTGA TTCAAAACGTCAAAATGCTTCTTTGTACCTAATTAAATGTTTACGGGTGA CCTTATTGCTTGTGAATGAAAATTATGATTATGAAAACATAGTGTCCTTC CCTCCTTTTTTTGAAAATCAAGGGGGCAAAGATTAGATGCAAATGGGAAA ATCTCTAGTTGAGGGAAAAGATTTTCAGGCTTCAAAGCAGTAAAATATAG CATGTTTTATGCATTTTTTAGCAAAACAATGTAAAAACATGCTTTTTTCA GAGAAATGTCTCAATTTAAATTTTTAAAATGTCAATTTTTAGGCAAAAAC GCATGAAATTGGGGACTTTGCTGGACTTTGAGGCTTCGAAAATCTAGGAG GGGTGTAAAATGGGGAGTAACCAGAATTTTTCAAATCTCAAAGGGGGGGG CAACAAACCCACTAGGACACTATAGAAAAGAATTAGCGTTCCACCAGTGG CAAACTAAGAAAATATTAACCATTTGATACATCTTTTAAGTTACTTTTAG TTAGAAAAACATCGATTACACGGTGTGCGTAACGTTAATAAACTGTACTT CGCCGTCTTTTTCCTACGAGAGAAGAATTGGAAATGCACTCAGATTTTTT CTGTTATCACCTACAGCAAGCAGCGGAGAAGTCGCGACGCCCGATCATCA ATGCGGGAGACGGGGTTGGAGAACACCCCACACAAGCTTTGTTAGATGTT TTCACTATCAGAGAAGAAATTGGTACCGTCAACGGAATTACCGTAAGTTT TTTCGCCGGAACACGTTTTTTTCGCTACATTACTGATCGCTGTACCAAAG TTTACCTGTAGCGTAGCGTAAATGAATTATGAAACTTCCTTAGATAACGG GTCTGTTAACAGGAAGAATATCTTGCGACATTAAATGTCAAGAAGCCTAT GCAATAGGTTGGCTCTGGTTAACTCTTCGACTCTTCTAAGTCGCAGTCGC TGAAATTGTTGGAATATCTCTTATCATTTTCCAAGTTCTAAGTTTAAAAA GTTAAGTGGTTCGTAACTAAATTGATGTCGTTACGCTTTCCTGCAATGAA AGCATTTCAGCCGGGTCTAAGCTTTATCAAAAAAATATTTTTTTGAATGA ATAAAAAAATGTTTTCTAGAGACACACGGCGTAACACACGGATAAAAATA AGACCCAGAAAGTTAGCATGTCATTTATCAATCAAGAAAGCAAATTGTTC GTAATCGCTTCTCTCCTCCCCTAAACCACCCTACCTTTAAATCCCCAATG GATTATCAGAAGTGAAGCATGAGATCTTTTGGATTATCACCCGAGAATAT TTATATAACTTGGGTCAACGATTTTCTTTTCACAGCGCATTGATATTTTA CCTCGAAGATGGTCCCTTTCTTCATCATACCATACCTTACGGTTATACAG TCCACTGAAGCCGTTTTTGATTAGCTAAGTTAGTCAAGCTAATCAAAAGT TTGTACCTTTTTCTTTCTAATTAAAAAGCTACGCATAGTGTTCAAGCATT CAAGCATAGAATTTGTATCTTCCCTCTCTAAATGTTCTTCCACTTTAGGT GACAATGGTTGGTGATCTGAAGAATGGCCGTACCGTGCATTCATTGGCTC GCTTATTGACATTGTACCGAGTGAACTTACAATACGTTTCACCTGACTCT CTTCCAATGCCTGACAACGTTCAAAACTATGTTCACAAGCGTGGCATCCC ACAGGTATGTGATTGACTCTCCAACGTTTTCTCGACGCCCATCTAATGTT CAAAACATGTTCTTTTTGGGGTTGGTGGGTGGGGTTTGGAATAAGCGGGG TGGATGGAAAAATTCTCAAAACTTAATAAGCGGGGGGTTGGAATAGAAAT GTCCTGGATTGAATTTTTTGAAAAGGAGGCTAATACAGCAGAATAAGGGC AAGAGAGGAAACTTTCAAAAACATTTTCCCAAGAATCAATAAGCGGGGGG GGGGNAGGGGGCAAAGATTAGATGCAAATGGGAAAATCTCTAGTTGAGGG AAAAGATTTTCAGGCTTCAAAGCAGTAAAATATAGCATGTTTTATGCATT TTTTAGCAAAACAATGTAAAAACATGCTTTTTTCAGAGAAATGTCTCAAT TTTAATTTTTAAAATGTCAATTTTTAGGCAAAAACGCATGAAATTGGGGA CTTTGCTGGACTTTGAGGCTTCGAAAATCTAGGAGGGGTGTAAAATGGGG AGTAACCAGAATTTTTCAAATCTCAAAGGGGGGGGCAACAAACCCACTAG GACACTATAGAAAAGAATTAGCGTTCCACCAGTGGCAAACTAAGAAAATA TTAACCATTTGATACATCTTTTAAGTTACTTTTAGTTAGAAAAACATCGA TTACACGGTGTGCGTAACGTTAATAAACTGTACTTCGCCGTCTTTTTCCT ACGAGAGAAGAATTGGAAATGCACTCAGATTTTTTCTGTTATCACCTACA GCAAGCAGCGGAGAAGTCGCGACGCCCGATCATCAATGCGGGAGACGGGG TTGGAGAACACCCCACACAAGCTTTGTTAGATGTTTTCACTATCAGAGAA GAAATTGGTACCGTCAACGGAATTACCGTAAGTTTTTTCGCCGGAACACG TTTTTTTCGCTACATTACTGATCGCTGTACCAAAGTTTACCTGTAGCGTA GCGTAAATGAATTATGAAACTTCCTTAGATAACGGGTCTGTTAACAGGAA GAATATCTTGCGACATTAAATGTCAAGAAGCCTATGCAATAGGTTGGCTC TGGTTAACTCTTCGACTCTTCTAAGTCGCAGTCGCTGAAATTGTTGGAAT ATCTCTTATCATTTTCCAAGTTCTAAGTTTAAAAAGTTAAGTGGTTCGTA ACTAAATTGATGTCGTTACGCTTTCCTGCAATGAAAGCATTTCAGCCGGG TCTAAGCTTTATCAAAAAAATATTTTTTTGAATGAATGAAAAAATGTTTT CTAGAGACACACGGCGTAACACACGGATAAAAATAAGACCCAGAAAGTTA GCATGTCATTTATCAATCAAGAAAGCAAATTGTTCGTAATCGCTTCTCTC CTCCCCTAAACCACCCTACCTTTAAATCCCCAATGGATTATCAGAAGTGA AGCATGAGATCTTTTGGATTATCACCCGAGAATATTTATATAACTTGGGT CAACGATTTTCTTTTCACAGCGCATTGATATTTTACCTCGAAGATGGTCC CTTTCTTCATCATACCATACCTTACGGTTATACAGTCCACTGAAGCCGTT TTTGATTAGCTAAGTTAGTCAAGCTAATCAAAAGTTTGTACCTTTTTCTT TCTAATTAAAAAGCTACGCATAGTGTTCAAGCATTCAAGCATAGAATTTG TATCTTCCCTCTCTAAATGTTCTTCCACTTTAGGTGACAATGGTTGGTGA TCTGAAGAATGGCCGTACCGTGCATTCATTGGCTCGATTATTGACACTGT ACCGAGTGAACTTACAATATGTCTCACCTGACTCTCTTCCAATGCCTGAA AACGTTCAAAACTATGTTCACAAGTGTGGCATCCCACAGGTATGTGATTA ACTCTCTAATGTTTTCTCGACGCCCATCTAATGTTCAAAACATGAACGTT GTCAAATTTTCTCTTTGGGGTTTGGGGGGGGGGGTNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNGGGGGGGGGGGTCGTCGTCGTCGTTAGATCTTACAG GGTTCGATAAACTGTGAATTAGCTGGCTCGAATGATGAAGGTTTTAAACA TCCTCGGCCCTTTTTCGTTTCGAATTATAGAAAAATTCAACTTTATTTTC CCTGATGGGGGGGGGGTGTTGCTGACACTAAGTGATGATGAAGTTAAGAG TTAAACGGTGTGTGTCTTTTCGCTATACCGAACCGATTCATCCCAGGATA TGTGTGACGGTTATTTGAGTCGCAATTGAGCTTTTCAAGGTACGAAAGGA CAATGATTTCCAACACTGAGATATTGGACTTTTTTTACTTCTGTATCAAA AAGTGACATTTTCATATTGTTTGATGGATGGGTATGTTGAGAGTTATTCA ACGTACAGAAGAGCATTATTGGATTTGACTTTGAAACCCCATTGCACTGA TCCACTTATCCACTCATAGCATTCAATCTGCACAATTTATTAACATAGAA CTGTCACATAAATTTATACTTTTCTTTTTGTCGGGGGTCTGCATACCTTC TCAAGAGAGCGAGATGAATGAAAGATTGATTGTCTATCGTGGTATATTGA ATTATAAATTTCTAATTTGTACTTAAATAGAGGTTTAGACGGTCATTTTG TTTTTGACCACTCACATTCTTTCGTTTCGGAATCCTTTCGCGTGTAGACC ATCTCACAAGGCTTATCTAAATCTTTGATGGATGGAGGAGCTCTTTCTTG CCAACATCTCACTAGAAAATGAAATATAGATTACTCTCTAAACAGTGTAT AAGGATATTTGTATTCGTTTACCCGTTTGAAGCTAATAACCACTTTTTGA GGTAATCTGCTTAAAGGTTTTCTCTCGTTCTTTTTCCTTTCAATGAAAAT ATTCTAGTAAAATCATAGTATCGCTATAGAGGGTGGACCTACTTATGTGC AATTTAAAAAGACTCATATAAGAAACAATGATTAGTTTAGCGACAGTATT TGCTACAATAATGCGATACTTTACAAACCGTTTTTTAATTTGTTTAACAG TTTCAAAATCGGAATCTCAGCAGTAAGTCTCATATCAAAGTCCTTTTTTC TACTAGTTGAAAAACTTCACTTTTTATTTAAATTAAAGCTTCTATCCTGC CATTGACTATTGGACTAGTAAAAATAGATCTCAGGGTGAATCAGATTAAA TCTTGCTGTAAATTTGTCTCCTTGAACCCCTCTTTCATTTCAATTTTAAA ACCGCCACAGGTGAGGTAAATTTCAGACGCGCCTCTCCTCTTTTGCTCTT TTTCAGGCGCCCACCATGAGTCTTTGCCAAACTTTATAATCTCATTTTGA AGTTTTATTAGACACTTTGAAAATTTCATTTCTGCGTTTATAATTCTTTC ACTAACTGGGATGGTCACCAATTTTTCTCCTTCATTCTTAGTCTCAATTC CCAGTGTATCTTTATTGGGCCACCATTACCAAAAAGCTTCAGCGGAATTT CCCGGAACTGAACCTCTTCACTTATTTTATAAGAACCGGTAAATCTTGGC TCAGCCTTGACTGCTCTTAATTTGATATTACCAGGAATTTTGTGATGTTC TTGATATGCTTCGTTTATATACTTTGCGAATTAAAACACCCTTCAAAACA AACATTGAACATTAGCATCGACATTATGATAGTAGTTTTTTTGTTTGAGG CTGAAGTTATTCTGAATTTGTTCAGGTTGACTTAATTTCAGCATTTCAGC ATCGTAAAATGTGTACAACTAATTTGACTTTTTCTTTCCTATATCAAGGA ATGTTGATTGATATTCAATTGCATTAGATAACGAAAATAGAATTTTATCA GTGCATAATCAGCCAGCTGAGTATGTCTGCACTTCACATTATTGCTTGAA TTAATCACGATGCCCTTAAATCGTGTCAAGTTCCAAAACGAATACCTTTT TTACTTTCCTACCCAAGATTGGTAAAAAAACCTACCTACTTAATAGGATA AAACAAAGAACTTACTCTGGTCAAACTCTATGTACTGTATCTTTATAAAT TTTTTGGGGAAATGTTTAGAACACCCCTGCCTCAAAGCCCCGGTGGAACT TTTTTCCACAGTGGGGATAAAAATTGGAGATAGAAGTTCTCTTGTTCCAT GGTTAAAAGATCCAGTGGCATGGTTTTGGATTTCAATATGTAAACATTGA ATTTTGAGTGGGGCTGAAATTCTAGGGTATTTTCCCACCGGGGACGAAAT TTTTGACACATTTACCAGTGGGGCTGGGGTCCTGGCGGGTCTGTGACACA GGGGTGTTTTTGAAGAGTCTAGAGATTTCAACATCTAACGTTGACTATGG ATTTTATTTTATTTTATGGGTTTTATTTTCTCGACTATTCAGTCATGTCA GGAACGACATTTGATACGTTGTTAACTGTCATTTATCTTTTATAAGGCCC TCTAGGTGTTTTAAAAAGGGTACTTTTACGAAATTCACAGTCCTCCCGGA AGTAATGTTCCTTAACCAATTTTGTCTTCAAAACATGGTTGTCACGATTC ACTCCTAAGGTTTTCCTATCCAAAAGGGATACATTTGTTACTAGGGTGGT CTTGATTCTTTTCTTCTGTCTCTAAGTCATTTGTGTAAATACAAATTTGG TGTCGTCACGAGATCATTCAATGACTCTGAATCAATGAAAGTTTGTTTTG ATATAGTCTACTATTTCTTAAAGATCAAAATATAAAGTGTCAATTCACTA CAAAACTGATTCATTTTTATAGACGAGTGAGGAACCCATGGGGGGTAAGT AAAAGGGGTTACGTAGATGCGTCGCTCGTCACTAGAGAAGAGGAGTCTGT TCCTCGTAGCATTCCTTAATGGGAAATTTTCAGGAAAAGTTAGAGCTTTT TGAGCAAAATTTCCGTCTCATCTAGGGTACATAGTTCTTCTCACAAAAGA TTAAACAACTCCAATGGAAGGACCATTTCTGAACCTTACCAACATTACCC CTCGTCTTCGGTTAGCTGGTTAGAAATCATTCCCATGAAGTTGTTTCTTT AGTCCTAGTCCTCACATTATCCAACCCCCGAGTTCCCTAGCAAAATCAGA TGGCACAGTGAAGAAAAATGTCTTGAAATTAGATCACCCATTCAAGTTAC TTGATTCGGCAATCATCAAAAGTCTTGTGTCAATATTTTCATTTTTCGAG CCTTGTAATCACAAAGAATAACAAGACATTACTACTGTTGGTTGGCCTCC TCATATCGCCCATACATTGATTTCTAACAATCTTTGACAGATGTCTATTT ATGCCTATTATCCGGGTGGAGACAAAACGCTGAACGGCGGAATGCCGGAA TGCCGGAACCGGAATAGCTGTTCCGGCCGGAATAGCTATTCCGCGGAATA TGATTTTTTTATTTTTTTTTTATTTTTTGTANNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNTAAAAAAAAATCATTATTCCGCGGAATAGCTATTCCGGCC GGAACAGCTATTCCGGTTCCGGCATTCCGTCGTTCCGCCGTTCAGCGTTT TGTCTATACCCCTATTATCCCTTGGTACAAAACCAATCGATCACTCGTCG ATCTTCGAATCATGACATATTACCCCTTAACAATGGACTCTGTTTTCTGT AAGACCAAGTCAGCTTTCGTCAATGTTCTTATTTTAAGGGCAACTTTAGG TCACTACCTTCAGGACGATGAATGTGTATAAAACTTTTTAATGGTCATTT GCTAAATATATGAAGGGTTAAATTGACAGCTTCAAGTTGGAAGGGGCCAT CACTGTTTGTCATCAGAATCCATATTAAGAAACAATTTGTTTTAAGCCTA AAGACTTAAAAATGGCCCTCAAGGAGAAAGGTGTTTACTTGCAAGGGTCA ATGTTTACATAGATGTCCATTGGGTCACTTTTGGCTATTGGCCAATTGAA AAAGTCTATCCTATTGAGCTTTTTGAAAGGATCATGTTTCGCTTATGGTA TAACGTTTCAACTTTTTGTTTGTTTACAATCGGATACCAAAAGATTTGGC ATCGTGTCAATCCTTAGAAAATATTATTCCACAATGTGAAAAAATAGAAA CATATTATAGACTTTAAAGTCGATAAGTTTTTATGGCCTCGTCCAATAGA AGGTTTAATATAATGCAGCTTAAGATCGAGCTTGTCCTTAGCTTGTCCTT GATTCTATTCGGTATCTTATTGCTAGAAACTTCATTATTTTTCTAGTCTT TACATGAAATTAGCTCGTTCGACTTTCAATCATTTTTGACTGCAGCAAAA ATTTTCCATATTTTAGTATTTTGTGTCAGTTTTCTTAAATTTGACATTCG AAAAGATTTATGCGTTATCGGCTATCAATATAGGCTTATGCATATCCAAG GGCTTAGCCTCTAAATAAAGACTTTAAATGTATGGAATTCCATATCGTGC GAGTGTGACCTTCATCGTATATTTCAGTACATCTCAGTCTTCCCATAGAC TTTATTTATCAGACCAAGTTCAAAGTCTAAAATTCCTTTACTATTGCACA TGTATTCAGGGCAAAACCGGAGAGGTCTTGTGGCGACACCGTTACAAAGA AACAGTGTTCCCGATTCGAATCCTCGATCCTATGATGGGTATTGTTTAAG AATTTTACAGTGATCGACATTCTCAATAGAATTTAGTTCATCTTCTTGCA TTTGCCCCCCACCGATGATTTCCACGTTTTTTTATAAGAACATTCAAAAT TCTTGAACCTTCGGATCGTACTAACTTTTTGAATTTCAAGCCTAAAAATA TTCTTAAAATGTTCTTATTTTTGTGAGTATTTTTGTGCAGTTTCCTAAGA AGTTATCGTATCATGGCTTGTTCTCAATATGGCCATCAAAGCCCTGTGTT CATATATATTTTGTTCTTACAAAAAACGTGTATTGTTTGTGATTCTAACC AAGGACAATGATTGCACTTCAACCAATTCGTTCGGCTGTTTGTCAAAGAA AACCTTCTTCCTTCTAAAGAGTTCTTAAGCTATCCCTATCCAATATCCTT TCAATGACAATGTTCAACAAACATTATGTCATACTTGAGGAAGGAACCCT AAACCTTTTGTATATTGATATTTTTTGTTGCGCAATTCTATTCCAGATTT TCTCTGGTTTGTTGACCTAGGGGATTTGATAATTTTGGCGCTCGATTTCG TTAATTAGATTTAACTCACTATAAAAAGATGTTCACTTTTATAGTATACT CTCAATTATTCGAACTTACTTCCAGTCCCCGTCAAGGAGGAAACCTCTTA AAATACTTTCTATAATAAGAATCTCTCTGATTCGAATAAATAAGATTTCC CGCTTGAGTTCGAATTGGCGACTGTCAACTGTATATGAATTTTTTTGTAT CAAGTTAGGTGCACCTTTAAATGTTTTGGGGTTTCATACTGCCTTTCAGG TACGGAAAATTAAATGTCTTCGCGTTGGGAAGCAGCTTTTGGGTTGCGGT TTGATAATACCCATAATAGAAACTGCGAAATGTGTTTTCGTTATTTCATT TCTTTGTCATATCCTTACATAATGATTTATCTAAAATAAGGTTATTAAGA GCCGGTTTAAAAAGGTCCGGTAGTTGAAAGGGTATCAAACTTGTACATGA AAGCTAACAATTTGACTCAAAAGTATCGATGAGAACGACTTGTGTACTGT TAAGTTAAGGTATTTCTTCATCTGTTGCTACAGTAGACGTTTGCACAGTT TTCAAATTAAAAGACTGCATACCTCAAACAGTCATACAGGGTGTAGATAG ACGGTTGCCGGGGAGAAGTGCAAAGTGATGCAATTTCGTCCCATTTTATT AGTTGTAATCCTGTTATCAACTTAATTCGTTGATAAAAGTTTTGATGAGA AATACCTTTGATTTATAGTTAGCACTCATTCTATTTATCCTGTCTAATGA TAGTTTGCCATCTTTAAAGTATACCGCGATAGTGGTTTAGTATATGCCAT CATCTCCTTTGTCCATAACCTAAGATTGTACAAAGAATATCTTGGAAGCG TGGAACCATCCATTGTGTAGTTTAGAATGATTTGCATTTGAAATCTCAGA TTATAGGTATTCCTCCCCTAAGCGTTGTCTATTAATTAGAACATGTACCT ACTTACAATGGAGTTTCTTCAACTCGAGCCTCTATAACTCGAATGTCTCC TTAACTCGAACGAGTTTTATGGTCCTTTCAGTTAACAATGCCTTAAAAAC CTTATGTACTCCATAACTCGAAATTTGTGTTTCACTTTGCGTGTTCGAGT TATAGAGACTCAACTGTAGTATCTAGACAGCATGACCAAAATATGACAAA GACGGTGTCACACAATTAGTGCAACTGTATTATTCAAGGTTATTAAAAAA TTACAATCATTTTGCATGTAAAATATCCGGTGATTTCCAACGCAATTCAC ACTCATTTCTGCTCTTATTACGATGATTCTGCGTGACGGATGTAAGGGTT GTCATTTTTTAGACATGGCAGTTTTCCAGTGAGAATGAAGTGGTCGCTTC CAAAGCCCGGAAGATTTTAATATCCGCTTGTGTTTTCAATCACAAATTAA ATCAAATAGTGTCTATTTCATAAAGAGAAAGGCGGCTTCTATTTTGTAGG TTACTTGTCCCTTTGTCTCCCGTTTTTCTTATTTTGGCGTATTTTTGTTT AGATTGTAAATCGTTTTGGAAGTTTTTTTCTCTCGCCACTTCAGTCGACA CTCGATAACTTGATTTAACTCTCAACTTGTCCTGCTCGTCACCATTTAAT TAGATCTAGAAGCGATTACCTTTTTCTGTTAGTTAGATAACTCATTAATT CGTTCAATCTCCTTGTCAAAGTAGAAAAAATCGCGCGACGTCATCTTTGT GTGACGTCATGTTTTTGTTTTTCGCACCTTTTGAGAGAGCTTTGATGACA CCATTTTGTTTTTGAACAACTTCAAAAGAAGTTATCAACCAACCAATCAA TCAATCAATCAATCAATTTCATCCTAATATTTTTTCTTCTCGGTCTTTCT CTCTTCACAATTTTCAAATAATTATTTTTTTGGAATTCTCTTTTTCTCCA GAGACAATTCAAGACAATTGAAGAGGCGTTACCGACAACTGATGTGCTAT ACATGACACGAATTCAAAGAGAAAGATTTGCAGACCAACAAGAATACGAG AAGGTAATTATCCCTCTCATCACGACACCTGGCCTCATCATTTAAAAATA TTACCGTCCTTTTCTCGCGAATTTTCCGTCTCCTCAGAATATTCAAGGGG AACTGCGTCAATTCACATTCACACCTTAATGTTTATCATCCATTCCGCGC ACAACAACATGTTTCATAATGCTCTAAAGGGATGTGGCGAATATGATGAT CTACCCTGGCTAGCTATTCAGTCGAAACATTCAAGACCGCGTTTTTTCTT AGAAGCAAAAGCGACTGGGTTCTAATGTTTTTTTTAACGTTTTATTGGTG CGACGATTTCCAATCATATTTAAATTTCATCTGAAATCTGGATGAGAAGT AACGAAGCAGCTTGCCAACATTGGCAGATTCTTTGATGACGACCATTTCC CATTCCTACCCATCGTTAACTTTACTACTTTGTCTGTTACTCGTTTTTTT TATAAGAATAGACAATATATGTGCGTAAGAATCGGTGTCTAAAAGTGCAC TAAGAAAGTTTAAGGCTTCGCAGTCTCTTAAACGCCCAATTTCTTAGAGA TTCCCACATTATGCTGAAAATAGAACATTTTTTCCAAATCTAAAAAGTTT AGAATGCATGGATCTGAATGAGATTTGAGATCCTGTTATAAGAATAACTT ACTGATATAAATGAGAATCAGGGAAACCTTGGGAGTTTGTAGTTTCTATG CCAAGCATGTGTAAAAAGGTTTCAATGCATAAGTTCTTCAGAACAAAATT TGCTGAATAACTAAACCATACGGCATAAATGAATCGGCAGCCGGTTCTCG GTATTTTTCTTCTTTTTTCGGGTATTCTCAAACGCGTGGGGTGTGTAATT ACATGTTGCAATTTTATCTCTAGTGTGAAAAAATGAGGAAAACAAAAGCG AGAAAGTATTTTCTTTTCTATTGACATTGACTCATTGTTCTATATATTGT TCTCCTGATATTGTTTAACTAGCTGTCCTTACTAACGCCCCACCACGCCA TCTATTCCATATTGACACAGTTGTCTTTTTTTCCTTTTTGCGACTGGTAG CGAAAATTCAAAACTTTCGGCTCCTTGAGAAAGCGCATAATGCTCATTCA TCTCCATGTGCTTTCATTTTCGAAATTTGAAATTGAATCGGTCGGTTTAA TCAGGTCATTAAATTAAAATTTTACCTATTATTAATATTGGCTGGTCCCT CTGATACTTGGTAGTCGCCACCTGATATTAGAGAAGTCGCTCCTTCGATG TATTCATCGCAACTTTGGCGATAGATATATTTTTTAACTTTGGATTTTTG CCCCCTTTCCGGGCAGGTTCTTGTAACTAACACAGCCCCCTGGGAAATAT TATTGAAACATTTTCATTAGCATTTTATCTGTTTAAGATTTCTTTTCTTT TCATCTAATCAACTCGAGAAATTGACATTTTAGTAACCAGATTAAACCCT TGCTGGGCCAATTGAATTTCACTGATCCCCTTTTTCATGCTACACCACCT AATGTTTGCCAAAATTGCCAAAATTGTCGAAAGAAATACAGTAACAAGAT CAATGAATCCATTTTGATTAAAAATGCACCTTCGAACACTTAAGGGTGGC TTGAAAGAAACTTTTTTAAATGAATATTAGTTCGAAATGGTAAAAAATTC ACATTGTAACTCAATATGAAATACGGAATTGGCTTCTACATAAACATGCA ATTTATTTACGACGATAGAGGGGGAGAAATTTCCAACCGTGAATCTTTCG TTATGCTGTCAAACAGCCATTTATCAAAACAAGAAAAATATGATCCTTTT AACCGCGCACTCAACCATCTCGCAAATCATTCCATTTATTACAAATATCA ACAGTTTTTATCCCACATAAAATTTAAACCTTTTGTTTACCACCTTGTTG CAAAAGTGAGGCGTGATTTTTCGCGAATTTTTACGAAATTTAAGCAACGG GAAGACTATAAAATTCAAATTTTGGCTAAAACTCCAAAGACAATATAAGA AATTAAGCGGGAAAAAGCCCATTCGCGAAATTTAATCTATCAACGCGATA TTATTTGAAAAAGTGCCCGCAAAAAAAATGTATTCTTTGAAGTAAATTGG AAATGAATCCTAAAAGAAATGTTTTCAATCAAATCATTCGAGTTGAGGCT CAAGGTCTCAAAATTCAGAACAACCGGGCTCCGCCAAAAAAATACAGACT TTTATAGAAAATGGCGTTCGCTTAACTGTTTTTTTTTTTCAATTTTTAGG TGCATGGTTATTTCGTGTTGACACCGAAAATGTTGACGAAAGCGAAGAAC AAGATGATCGTTATGCACCCATTCCCAAGAGTCAACGAAATCAGGTATGA AACATCCTTCAAACTTCCCTCTCAGACGAAGTATGTACTAAAAGAAACTT TCCCGACTCAAAGTTAAGCAAAATTTTGGAAAATTTTGGAGAATATGAGT TAATGTTTACGTTTTGTGTAAATTTCAAGAAGCTAGGGGTTCTTTTGTTC CGATTCTAAATAAGCAGGACTCTCTTTATCCGTGTAACATCATTTTCGAT GCTCAGATCTTTAAAACACTTTGTAGTTTTGTGGTCGTTTGAGCCTGATG TATTGTGTATGGCATTTAAGATAAATACTATACGACAGAACGTTTTCTCT TTTCAGTACTGAAGTGGATTGCGACCCAAGGGCTGCTTATTTCCGTCAAA TGGAATACGGGATGTTTGTTCGAATGGCTTTACTTTCCATGTTGACTGGT CGATTTTAATGGACAGAGAAAACCGAAAATTTACGTAATCTTTGTCATAA AAGAAAACGTCACAAAAAGCGAAAATATTGTAGCCATCTGAGCACTAATT TTATAGCTCGACAAAAGAATATATTATAATGGATTGTAGGGCAATTTTGT AGTCATTAATTTTTAAGTCGGACAATTTTCGGTCAAAGAATTTATCACTT TCCCAAAAGAGACATTGCAAATTCGTTTCTAATTATTTCGTTAATTGGTA TTGTCGACAGTAATTAGATGTTTGTGATATTATTTTTGCGGTTCATATTT GAGATTTTTTTATTTTTGTAGCTTTTTTTCCAGATCCCTTTTTTAGTTTT ATATATTTTTACTTTTGGGATAAATAGGCTTTTTTATTATCATATTATTG AAAAAAATAATCAAAAAATCTTGACATAAAAAAGGAATACAACATTTGAT CATTTGCTTATGTGAAAGATTGTTTATTGTAGACCACAATCCTCGCAAAA CCAATTTCCTGAAAACCGTCACTTTCACCTAAAGTGCGGACTACATTCTT GCGAACTTTTACGAAAGGTATTAGCACTCTTCTTGCCGGAAATTTAGGAA GTTCTTTCAACCGTCAAAATACACTCTAGATTGCGGTTTTTCCATAGTGA ATTTTCGTTTTGAATGAATAATTTCTTCTTTATCTTAAACTCTCACGATA TAAGTTAGTACTATGAAATTAAGGGGAATGAATGAAAGAGTACTATATTC AAATCAGCC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000986XLOC_000986Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001868-exon-sc0000012-1575043694:95699..95755TCONS_00001868-exon-sc0000012-1575043694:95699..95755Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:95253..95454TCONS_00001868-exon-sc0000012-1575043694:95253..95454Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:93420..93596TCONS_00001868-exon-sc0000012-1575043694:93420..93596Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:91247..91401TCONS_00001868-exon-sc0000012-1575043694:91247..91401Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:89880..90099TCONS_00001868-exon-sc0000012-1575043694:89880..90099Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:89631..89743TCONS_00001868-exon-sc0000012-1575043694:89631..89743Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:89187..89261TCONS_00001868-exon-sc0000012-1575043694:89187..89261Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:88625..88766TCONS_00001868-exon-sc0000012-1575043694:88625..88766Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:78642..78712TCONS_00001868-exon-sc0000012-1575043694:78642..78712Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:75329..75454TCONS_00001868-exon-sc0000012-1575043694:75329..75454Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:74367..74522TCONS_00001868-exon-sc0000012-1575043694:74367..74522Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:65803..65904TCONS_00001868-exon-sc0000012-1575043694:65803..65904Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:63462..63556TCONS_00001868-exon-sc0000012-1575043694:63462..63556Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1575043694:62297..63149TCONS_00001868-exon-sc0000012-1575043694:62297..63149Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:95699..95755TCONS_00001868-exon-sc0000012-1510915933:95699..95755Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:95253..95454TCONS_00001868-exon-sc0000012-1510915933:95253..95454Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:93420..93596TCONS_00001868-exon-sc0000012-1510915933:93420..93596Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:91247..91401TCONS_00001868-exon-sc0000012-1510915933:91247..91401Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:89880..90099TCONS_00001868-exon-sc0000012-1510915933:89880..90099Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:89631..89743TCONS_00001868-exon-sc0000012-1510915933:89631..89743Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:89187..89261TCONS_00001868-exon-sc0000012-1510915933:89187..89261Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:88625..88766TCONS_00001868-exon-sc0000012-1510915933:88625..88766Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:78642..78712TCONS_00001868-exon-sc0000012-1510915933:78642..78712Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:75329..75454TCONS_00001868-exon-sc0000012-1510915933:75329..75454Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:74367..74522TCONS_00001868-exon-sc0000012-1510915933:74367..74522Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:65803..65904TCONS_00001868-exon-sc0000012-1510915933:65803..65904Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:63462..63556TCONS_00001868-exon-sc0000012-1510915933:63462..63556Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1510915933:62297..63149TCONS_00001868-exon-sc0000012-1510915933:62297..63149Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:95699..95755TCONS_00001868-exon-sc0000012-1491911889:95699..95755Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:95253..95454TCONS_00001868-exon-sc0000012-1491911889:95253..95454Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:93420..93596TCONS_00001868-exon-sc0000012-1491911889:93420..93596Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:91247..91401TCONS_00001868-exon-sc0000012-1491911889:91247..91401Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:89880..90099TCONS_00001868-exon-sc0000012-1491911889:89880..90099Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:89631..89743TCONS_00001868-exon-sc0000012-1491911889:89631..89743Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:89187..89261TCONS_00001868-exon-sc0000012-1491911889:89187..89261Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:88625..88766TCONS_00001868-exon-sc0000012-1491911889:88625..88766Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:78642..78712TCONS_00001868-exon-sc0000012-1491911889:78642..78712Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:75329..75454TCONS_00001868-exon-sc0000012-1491911889:75329..75454Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:74367..74522TCONS_00001868-exon-sc0000012-1491911889:74367..74522Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:65803..65904TCONS_00001868-exon-sc0000012-1491911889:65803..65904Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:63462..63556TCONS_00001868-exon-sc0000012-1491911889:63462..63556Clytia hemisphaericaexon
TCONS_00001868-exon-sc0000012-1491911889:62297..63149TCONS_00001868-exon-sc0000012-1491911889:62297..63149Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:62297..95755 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0 0 5.0134e-08 0 0 0 0 0 0 0 0 0.0271887 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Blast
BLAST of TCONS_00001868 vs. Swiss-Prot (Human)
Match: PYR1 (CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3)

HSP 1 Score: 690.649 bits (1781), Expect = 0.000e+0
Identity = 351/637 (55.10%), Postives = 442/637 (69.39%), Query Frame = 1
Query:    1 MSELYNRPVHIAHVARKEEILVIKAAKKKGLQVTCEVAPHHLFLSTDDTKRIGEGRARVKPQICSAEDQKALWENMDFIDCFATDHAPHHVDEKNSENPPPGFPGLETMLPLLLTAVKDGRLTLDDVILRLHTNPRRIFGLPEQHDTYVEVDLNEEWTIPDAMAYTKSKWTPFAGMKVFGKVCRVVVRGELAVIEDQVLAKPGFGEDVRAWE-------PPNC--------------------------LPP-LSKAQKQKLDAINNEQPTPANLPDIEQPSLLSGP------PTPIRKISNIMEKLHTQDGLSAEXXXXXXXXXXXXXSQLLVGKHVLKVESINKDQLNALFNIAQQLKKEERRGRQIDTLKGKVLALMFFEPSTRTACSFQSAMQRLGGTTIAIKPGNSSLTKGESVQDTVATMACYSDVIVMRHPTKGMVQQAAEKSRRPIINAGDGVGEHPTQALLDVFTIREEIGTVNGITVTMVGDLKNGRTVHSLARLLTLYRVNLQYVSPDSLPMPENVQNYVHKCGIPQRQFKTIEEALPTTDVLYMTRIQRERFADQQEYEKVHGYFVLTPKMLTKAKNKMIVMHPFPRVNEISTEVDCDPRAAYFRQMEYGMFVRMALLSMLTGRF 1791
            +++L  R VHI HVARKEEIL+IKAAK +GL VTCEVAPHHLFLS DD +R+G G+  V+P++ S +D +ALWENM  IDCFA+DHAPH ++EK    PPPGFPGLETMLPLLLTAV +GRL+LDD++ RLH NPRRIF LP Q DTYVEVDL  EWTIP  M ++K+ WTPF G KV G V RVV+RGE+A I+ QVL  PG+G+DVR W        PP+                           LPP + +A    L A   E+P   +   + +P L+  P      P P+ + ++  + L T   L  +     H          LVG+H+L V+   KDQ++ LFN+A  L+   ++ R +D LKGKV+A MF+E STRT+ SF +AM RLGG  ++     SS+ KGES+ D+V TM+CY+DV+V+RHP  G V+ AA+  RRP+INAGDGVGEHPTQALLD+FTIREE+GTVNG+T+TMVGDLK+GRTVHSLA LLT YRV+L+YV+P SL MP  V+ +V   G  Q +F++IEEALP TDVLYMTRIQ+ERF   QEYE   G F+LTP ++T+AK KM+VMHP PRVNEIS EVD DPRAAYFRQ E GM++RMALL+ + GRF
Sbjct: 1602 VAQLTQRSVHICHVARKEEILLIKAAKARGLPVTCEVAPHHLFLSHDDLERLGPGKGEVRPELGSRQDVEALWENMAVIDCFASDHAPHTLEEKCGSRPPPGFPGLETMLPLLLTAVSEGRLSLDDLLQRLHHNPRRIFHLPPQEDTYVEVDLEHEWTIPSHMPFSKAHWTPFEGQKVKGTVRRVVLRGEVAYIDGQVLVPPGYGQDVRKWPQGAVPQLPPSAPATSEMTTTPERPRRGIPGLPDGRFHLPPRIHRASDPGLPA---EEPKEKSSRKVAEPELMGTPDGTCYPPPPVPRQAS-PQNLGTPGLLHPQTSPLLHS---------LVGQHILSVQQFTKDQMSHLFNVAHTLRMMVQKERSLDILKGKVMASMFYEVSTRTSSSFAAAMARLGGAVLSFSEATSSVQKGESLADSVQTMSCYADVVVLRHPQPGAVELAAKHCRRPVINAGDGVGEHPTQALLDIFTIREELGTVNGMTITMVGDLKHGRTVHSLACLLTQYRVSLRYVAPPSLRMPPTVRAFVASRGTKQEEFESIEEALPDTDVLYMTRIQKERFGSTQEYEACFGQFILTPHIMTRAKKKMVVMHPMPRVNEISVEVDSDPRAAYFRQAENGMYIRMALLATVLGRF 2225          
The following BLAST results are available for this feature:
BLAST of TCONS_00001868 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
PYR10.000e+055.10CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3[more]
back to top