Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001579 (transcript) - C. hemisphaerica

Unique NameTCONS_00001579
OrganismClytia hemisphaerica (Jellyfish)
Sequence length916

The following sequences are available for this feature:

transcript sequence

>TCONS_00001579 ID=TCONS_00001579|Name=TCONS_00001579|organism=Clytia hemisphaerica|type=transcript|length=916bp

protein sequence of TCONS_00001579-protein

>TCONS_00001579-protein ID=TCONS_00001579-protein|Name=TCONS_00001579-protein|organism=Clytia hemisphaerica|type=polypeptide|length=249bp

transcript from alignment at sc0000011:307298..315693+

Legend: exonfive_prime_UTRCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001579 ID=TCONS_00001579|Name=TCONS_00001579|organism=Clytia hemisphaerica|type=transcript|length=8396bp|location=Sequence derived from alignment at sc0000011:307298..315693+ (Clytia hemisphaerica)
AAAATGTGCCAGAAAAGCCAAAATCCTGattaatttcttttgtaaaagct gTAAGTAAGTTTTCGCTGGTAAGTTTGTAGACCTGACTTTCAATTGTGTC GAAATTTGTTCTCTCAACAAGCTGTATTATTGCTCCAATATGTGAGCTGC AAAAAACTGTGTGTTTTGTTTAAACAGTTAGTTAGAGTTACATCAACAAC AGATCAacatgccaaaaacattttgttcaatcatcttcacttcaagatag gccaccatagaacgAATTTCCTTTTATAggtgaaccatattcatgtcgTG GCTTTCagcattagtcaaaaaagtcattaaaattgttTAACCTctgcaaa aaatcccgacgatgAGAGTGCGCACCATttaagttgaagttggtttgata ttctacgtttgacgtttgatattcgattgatattcgtttgatattctcaa atttgcgttttgaagtttttgtgactacttttggaactggaaactattgg aagccatcaataatagagtttattctcaagcagttagtcacactaggaaa tctagcttttagaaaaaacaacatcagtcatctacaggatatatttcaac aacaaggatgagagttacctgaatcaagtttgcaagacaatattaattaa aacttgaaagttggaaacaaaataaaacgtgcaNttgcggtgcatttttt tgcttgagagtcaagtaaacgatatagcgcttttgcagcattaatctttg atacgcattttggcgggacgctagtgtggctaactgtcAAGGGTAGGGTG CGCACTCATCGGATTTTTGGCGCGGAACGaagaagaatttacaaaaatga acttcaaggcattagtacttaccgtgagaggtcctaaagccgacagccca gcttaattccgacaccccaaataactgttatgaaaaaaaattctatgttt acaaacattccctctccaagttNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNtttaaatcatccaaatctgttcattctt ttttttaaatcaatcaggaattatcagggaaacaagtaaaaaaaactgca tcaaggtatctattttctttccaaagatatNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNaaattctcgacccacattgaaacaaatggctgtc gctattgagctggttcatcttttcaatcgcggtttttttagtaaacccag ggtaagattaggctacaaccTATCACAacctgctttatttgaaaatctac aggccgtctggaatttcgaaaaataagaagaaattttttaacaagattgc ggattttttcatttaagcaccattcaccatctgaaagctgaggatttcag ctttctagtggtgaaatttggataactttggaactacttaaccaatttta acaaatggcccctcatttttctcacgaaggtaaggactttcaaataaaat tacagtagtttggttttcaaaatttgaggggaaaattttggcctgtccac cctaacAATGTTTTCCTTTAGtaagattgaccattttgttgttttggatT TGAGCGAAATTTctggagcccaacttgtcattttggccgaaatgaggttt aacggttacaaatttttagagggagcacgctgtgacggagagcgctgaaa ttttgcacacacacccttgagaataaactctattggcttcaaatgttttc cagttccaaagataaccgctctcccccacaggagcccaacttgtcatttc ggccgaaatgaggtttaacggttacaaatttttagagggagcacgctgcg acagagagcgctgaaattttgcacacacacccttgagaataaactctatt ggcttttccaatagtttccagttccaaagataacagctctcccccacagg agcccaacttgtcatttcggctgaaatgaggtttgacagttacaaatttt tagagggagcacactgcgacggagagcgctgaaattttgcacagacactc ttgagaataaactctattggctagcttccaatagtttccaattccaaaga taaccccTCTCCCCCACGGTCAccctcccccacaggagcccaacatgtca tttcggccgaaatgaggtttgacgattacaaatttttagagggagcacac tacgacggagagcgctgaaattttgcacagacacccttgaTAGGGTGGAC Aggacaaaattttcccctcaattttaaaaaaccaaactaattttatttga aagtccttacctttgtgagaaaaatgaggggtcatttatNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtggttaagtattcccaa agttattccattttcaaaacacaaaaaaatcaccttttcaaagaatcgcc tccttacaccacgccagcaagaaataattttcagaaccaaaatcgcgcca aaaatggcggatgaaatctagtcttccgtgtggcggggtgtggggagttt tgccgGTGCGGTCTAAAAATcagcccgatgactgttaaactttagcctat cgctaatgagctggaaatgatagctaaaaacaaattttaccaatgaaaag ctgaaacccttagctttccaacgatatatgatagccctgataaaaatttc aggaaagtgccgaaaaatcgaaatttcttcttttttctcgatttaaagac agcccgtagattatcgaaaaggctaccacgtgacatactaaagtactatc tttcccgcgagtctataactaatccagctcaatagcgatagctatttgaa aaatggtggtcaaggtAGACGGTGGTGCCACAAATTCCGAGTTGCCATTT TTTTACCTTGATGTCTAATAAATGGTATACCAGCCATATTgaaccaattc taataaatgacccctcatttttctcacaaaggtaaggactttcaaagaaa aattagtttggtttctaaaaattgagggggAAATCTTTGCCTGTTCACCC TATCAGTGGTATGTATTTAACAGTTACATCAacatgccaaaaacattttg ttcaaccacctttaCTTCAAGGATAGACCAccatagaatgatagaatgaa cttccttttacaGGATGAAccattcatgtggctttcagccttgaactcca tcacagagcctatttgagatattacTAACTAGCccggagaaaaattttaa acctttattatttgaatgcatgcctttttaatataatactcaaatataaa aaaattaaaaaattttaacttgatcaTTAGTTAGGGTGGACatgccaaaa ttttcccctcaatttttagaaaccaaactaattttatttgaaaatcctTA CCTTTgtaagaaaaatgaggggtcatttattagaattggttaagtattcc caaagttattcaattttctaaacacaaaaaaatcaccttttcaaagaatc gcctccttacaccacgccagcaagaaataattttcggaagcaccaaaatc gcgccaaaaatggcggatgaaatctagtcttccgtgtggcggaGTGTTGG Gaggtgcggtctgaaaatcggcccgatgactgttaaactttagcttatct ctaatgagctggaaatgatagctaaaaacaaatttcaccactagaaagct gaaatcctcagctttcagatggtgtaaggtgcttaattaaaaaaatctgc aatcttgttgaaaaatcgcaatttcttttatttttcgaaaattccagaCG GACTGcagatttttaaataaatcgcaatatgatagattgtagcctaatct taccctggtttataaaaaaaaccgtattgaaaagatgaaccagctctaTA GCTTCAGCCATTTGTTTCCATGTGGGTcaagaattttccggtgccgtggt cagcgctaagtcgtgttttcaccttgacgtcgaaaaacatcaatatcttt ggaaagaaaatagatacctggatgcagttttttttacttgttttcatttt ttcagttttttgttcattttcatttgtttatcttttttgcaactgtttgc aatgtcagctttttccataaattatgcgcgcatagaaaaatatcgaaaac cccgcgaaaattctgctcagtgactgggcgcgtattGGCCAATTAGACAA ATATCCCTGCAGAagagttagttggaccagaccgtaaaccagagacaaaa ttataaaaaactagatggtgaaatagtttacggtctggatatccaggcta caatGGAACTAAATCAAACTCCATCAAATGATTTAATTTCAATCAAGATA AATGAACCTAAtcaaacactcacaatttttgaagcaaagtATTAAAAATT GGATAATTTTCGGACCTAGAAAAAAACGTTAGTAATGGGGGgacttgata agttctatctatcaattaactaaaaatcgattcacttgAAAACTGTAGGa aattcgaagggcaaattttttgtcaattctacaccctattagtagcatca ggggggggggggcagggtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNGGGGGGGGCagggtccaggataccaaccAAGGGCCCAACAacctga cttttcgagatttgaaagtagtagacaccaccaccccctaaatCAGTATC GATACGAACTTGAAAATCccgttttttctgaaaaagggggaaCCACCCCC CCTAAATTGGCAATAAATAAAAATGCAAGAAGTTATGTGCATAGGATACT GCATACAAGGGACGCTAAACAAAATCTGtggatatttttaatcaaagaac attcctcttattaatcacttatattatgtaccacactttagactcctgaa aatgaaaacaagtttttttcattctaacacaacgtaaattaagtttcttg cactaaattggcaaaatgtatcaaattcataaaactagtTGATAAACTAG ACTAGATAAAAAACTCATTGTATTAGGCACGCCTAGAGTCTTTGTAATAG CCTATATGATGAACGTTATGtacagaaaaattttatcacgactaaaaaag ctctaagatctgctaagacttgatacagtttgttcaactctagttttgaa tgaattttggttgattgaaaggattgagagcagcaaaagttataataaaa ataaaaatggcggatgaaatctagtcttccgtgtggcggaGTGTTGGGAG TTTTGccggtgcggtctgaaaatcggcccgatgactgttaaactttagct tatcgctaatgagctggaaatgatagctaaaaacaaatttcaccactagN gcccgatgactgttaaactttagcttatcgctaatgagctggaaatgata gctaaaaacaaatttcatcaCTAGAAagctagacggtgaaatagtttacg gtctggatatccaggctagttttacttttgaattttctttcaaaaaatgt taaatagtTAAGAGAGGAAGGAGCAATTTGTATGTTGTATCTTGTATGTA TATACTGCAAGCATGagaatttcaagtaattttttttagtaaccCTTTTA ATTTAATTCACCCCTTCCTGGTATCTTTAGAAAATGTTACGTAATTTGAT CTGGAAAAACCAACAATTATTCTTGAGGCCATCACAATCCCAATTATTGA AGCCTATTTTCAATTTACACACAACATGTATAAAAAGTGGAACTCATGAT TATGAAGCGGTAGATGTCTTGTTAAATGCAAAGCGACATAAAGAAGCAAC AGGTAATGAATCGATTCTCAACCAAGCAGCATCGCGATCTGGAGCTGTTG TTCGATGGAAGAAAGTGGAGGGTGAAATGCTTCTGGATGAAGACCCAGTA CTAGTTGTTGGTCGCCCATTTCAAATTAAAGCTGCAACTGATGTTTTGTT GAATGGGGTTGTGGAAGATACAGAAAATGTAGATAGCCAGGATGAGCGTT TAGTATGGCATGGCTATAAACGTAATTTTAAAGGACAATTTCCCCCTGAA AAACCAAGAAAGACTTGTATCCGTAATAATGGAAATAGAGTATCAGGAAA TCCATGTCCACTTTGCCAGATTAAATTGAAGTCAAGCTATAATGTACATT TTACTGACGTACAGCTACTTGAGCAGTTTATTTGCCCGCACACTGCTGAA ATTCTTTCACCCAAGGTGACAGGTATCTGTAAGAAACAACACCTTCAAGT TGAAGCAGCTATTAAGAAAGCTCGAAATTTTGGTTATTTACCTTTTACAT TGCCACTACATTCAAAGGAACAAGGAAAACATATACCAGCCGGTATACCa acagataaaaaaatcaaagtgaaaatgcactgaaattaGTATTGTTAATC AGATTTTGTATACTTAccatgttttattttttgattcatATTTTAATTAG ATAAATCTTAAAATAAGCCAAAAAGCTTTTTATTCTGTTTCATTTC

Coding sequence (CDS) from alignment at sc0000011:307298..315693+

>TCONS_00001579 ID=TCONS_00001579|Name=TCONS_00001579|organism=Clytia hemisphaerica|type=CDS|length=750bp|location=Sequence derived from alignment at sc0000011:307298..315693+ (Clytia hemisphaerica)
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000825XLOC_000825Clytia hemisphaericagene
The following polypeptide feature(s) derives from this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001579-proteinTCONS_00001579-proteinClytia hemisphaericapolypeptide
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001579-exon-sc0000011-1491911889:307298..307347TCONS_00001579-exon-sc0000011-1491911889:307298..307347Clytia hemisphaericaexon
TCONS_00001579-exon-sc0000011-1510915933:307298..307347TCONS_00001579-exon-sc0000011-1510915933:307298..307347Clytia hemisphaericaexon
TCONS_00001579-exon-sc0000011-1575043694:307298..307347TCONS_00001579-exon-sc0000011-1575043694:307298..307347Clytia hemisphaericaexon
TCONS_00001579-exon-sc0000011-1491911889:314828..315693TCONS_00001579-exon-sc0000011-1491911889:314828..315693Clytia hemisphaericaexon
TCONS_00001579-exon-sc0000011-1510915933:314828..315693TCONS_00001579-exon-sc0000011-1510915933:314828..315693Clytia hemisphaericaexon
TCONS_00001579-exon-sc0000011-1575043694:314828..315693TCONS_00001579-exon-sc0000011-1575043694:314828..315693Clytia hemisphaericaexon
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000011supercontigsc0000011:307298..315693 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
68.0319 64.9355 42.9538 44.6917 38.9788 28.823 37.5478 39.6817 37.2965 34.8316 31.8257 28.3068 18.2887 20.5527 29.9475 31.7407 57.7679 48.9974 11.5755 11.2198 32.2224 30.4571 74.682 66.1706 32.9187 31.3987 20.0918 15.5679 38.4307 40.0627
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
Vocabulary: Cellular Component
Vocabulary: Molecular Function
GO:0003735structural constituent of ribosome
Vocabulary: Biological Process
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006412 translation
cellular_component GO:0005622 intracellular
cellular_component GO:0005840 ribosome
molecular_function GO:0003735 structural constituent of ribosome
BLAST of TCONS_00001579 vs. Swiss-Prot (Human)
Match: RT18B (28S ribosomal protein S18b, mitochondrial OS=Homo sapiens GN=MRPS18B PE=1 SV=1)

HSP 1 Score: 103.219 bits (256), Expect = 2.231e-25
Identity = 52/115 (45.22%), Postives = 71/115 (61.74%), Query Frame = 3
            +E  E  +    R VW  Y+RN KG  PP++ RKTCIR N  +V GNPCP+C+       +V F +V+LLEQF+C HT  I     TG+C KQH ++  AI+KAR+ G L + +P
The following BLAST results are available for this feature:
BLAST of TCONS_00001579 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
RT18B2.231e-2545.2228S ribosomal protein S18b, mitochondrial OS=Homo ... [more]
back to top