Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001332 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001332
Unique NameTCONS_00001332
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length3218

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001332 ID=TCONS_00001332|Name=TCONS_00001332|organism=Clytia hemisphaerica|type=transcript|length=3218bp
catcaaataGCCGATAGGAAAGTATGTGATAAATGCATATTGTTAATCCT
GTAACATGAAActaattgagaaaaaatctgtATAGTTTTGTCCTgaaatc
agttttttttatgACGCAGCAAGGAGAATATGGAGGCATCATAAATATAT
CGTTGGAGAGAATaattaaaatcagaaaaaaataaactcAGTTTTGGTAT
TGGGCCAAAGCAATTAAAAGCACCTGCGGAAAGACTACTGTTACAAAAAT
GGTGTTGAAGAAACTAATGAACTGGGCTGGCCAAGCTAAAGATTACATCC
AGGATGGTTTATTCGGTATTACTGATATCGAGGAAATACCTTTACAACAG
AATCCGCAATCTCCTAGTCAAAAACGGATTCGAAAAAATGTCATGTTTTC
AGCAGGGAAGGATAAAACAAAGCTTGAAAATGATGGCCCAAACATTATAT
ATGACTTTTCTGATTATGACAATAAACGTAACAAAGCTTATAAGGTGTTA
CGAAAAGGTCCTTTAGAGTTCCCAGAAGATCATCTGGAGTTCGAGCATCT
GTCGAGTTTTGCAGTATTACAGGAATATAATGATACGTTCGTAGAGTTTT
CAGATAATGATATGGAGGATGGGAATATTTTTCCGAGCAGTAAGATGTTG
ATCTCGTATTTTGCAAGGCTTGGAACAGGCGAAGATGATGAAGCTACTAT
TAATCTGAATTTCATACAAAATCTCATCGACGCTGGTGCTAACATCAATC
AAGAGGATGCGTACGGTCAAACTCTATTCTTCTCTATCGTAAGAGACTGG
AACACAGATGTGGCGGAGTACGCCCTCACAGAAGGGGCGCATATAAACCA
TGCGGACCATTATGGGCGTACCGCCTTACACGTTGCTGCCTCAATAAATT
ATAAAGAAATGGTTGCATTTCTTATTAAGAAGGGAGcaaaagttCACGCG
AAAACAAGAGGTGAAGAACAAACTCCTTTACATTATGCTGCCAAATATAA
TgctgctgacgtcatcgaaatTCTGATCAGTAATGGTGCAGTCGATGGAT
TAGATTTCTTGAATCGAACGCCTTTTCATTTGGCTGTTGAACATGGATGT
GAAAAATCATCAGAAATCTTCTTAAAGCTTGGTGTACCAGCTGGggaata
tgatatttccaaccAATCAGTTATGGCATTGATAGTGGACCGATTACCGA
ATCTTGGTTATCAATGTTTAGACCAGTTCATGACCACAGATGATAGTGCG
TACAGTGCATTCTTTCTGGCACATTTAGAAGGGAATATCAAAGGATCATC
AGTGAGGGGACAAACAGTTCTTCAGTGTATTGTCAAGAATAATAACGAAG
AACTGATCATGCATCCAACCATTCAAAAGCTGCTCAAAATCAAACTAGAT
TTGTTCGGACGAACTCATGTTATTATGTCTAACttgttgaatatctttta
cGTTTTATTGGCAACTGTGTTCATCTTTTCGGTGCCGTATGATAGTTTTG
ACAAACAATTTGTACCGTTCGAAACACATGTTTGGAAAATATGCGTTGGT
GTTgtcttttgtttcttgtctATCGTTTACATATGGCGGGAtatcaaact
tttattgatactAAACAAAGAAGACGAGGAGTACAAAAAAGACATGCTTA
GGGTTTACAAGAAAATGGAGCAGTATTGTCATCCTGCATGGAAAACAGAA
AGCGAATTTGTTGATCGGGAAAAGAAACGGCTTGAAGAAAGTCGAAAATC
GTTCTTTTATGACGGATGGCAGTGTTATGAGCTCGTTGTAACTTTCACAT
CGTTTGCAATCATTGTAATGTATTTAGTGAACGTGCTGACTCCAAACAAG
ACCTTATTTACTGTCTTCAAATATTTGGCTTCTGTTAACCTATTACTTCT
TTGGATGAGGTTATACAAAACAATGCGACTTAGCAAAATCTTCTCCGAAG
TTGAAATGTTATTAGTTCATATCTTAAAGACTGTGGCGAAGATAGGAACA
TTATATTTGGTATTGCTGGTACCATATACTTTCGTTGTTTACATGCTTTT
TGGTGGGTCTGGTGATGAGGATGTCAGAATCACCAAGACAACAAAAGAAT
ACGAAGTTGCCCAAATTatttatGATCTATACCATTCAGCCGTTGTTACA
CATCACGAAATCAATGAGGTTGCAAACCAAATCTTCCGTGGTTTTTATTT
ACTCATGTTTGCAATTATCAATTTCGTTTTCATTGGTGTTATGACGGAGC
AATTTGTGCGCACGTACAAGAAAGCACTTGCAAAAGTCCACCTCGGAGTA
GCAAATGCGTTGATCAATATTGAATTAAGAAGCAGTCATGATAAAAGAAA
AGGATACAGAAAATTTATCAGAGAGAAATGCAATCCTTACTTGGAAGAAG
TATTTGGTAAAGAACGCCATTACAGAGAGGATCGAAATGACAAATACATC
AATATCAGCGTTGGCAGTGTATCAGAACTGTCGGAAAAACTCTCTGACTA
TCTCGaTGATGCCGACTTTCTAAATCAACCACAAAGGTCTTGTGATATTG
ATTGTTTGCAGAGTCTTCAGGTAGAGTTGGAACGCCTCTCGGCAGACATG
AATTATGGCAAAGCAGGGTTACAGTTGAAATCGAAAGAAGTATTGGCGAA
AGCCAATAAATCGGCTGAAATTATTAAAGCAGGTTGTGATCCACGGCATC
TAGCAAAAGGAAAACATCTATCCAAACCAAAACAATGAAGATAATCTGGA
ATCTTCTGAAAAGGTTCCGTTCCATCAGATACGAAGGGTCAAATAGGAAT
GATCCAGCTCCATTCAAAGTTAATGCCTTGCTGCCATTTTAATGGTTAAA
ACGTAGTTCATAGATGTTGAAATCTTCACAACTAACTCACTTACTAAAGA
GACTTCAAAGCGAAAACGACAATAACAGAACATCAAAAGATAACTTTATT
TTAAACTTTCTCCGATAAATTTTGTCTTGACTATCAGACAATCTTATTTT
ACGAAAAAGGGTCTAAGCCTATCTTTGGCTTTTGGTTGCTCTGGACTCGA
TCTAGACTCATAAGAATAAATCCATTCTACCTCCCCCACCCTCTGCCGTT
AAGAAATACGGGGAATGTGATAATCGAACAAGTTTATTCAGTccaaacca
ttgagtttaaagcgcgaagggctagagtagaatctctaacatTTATAAGG
CAAGATAAAGTGAAGCCA
Run BLAST on NCBI

transcript from alignment at sc0000010:155949..170280+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001332 ID=TCONS_00001332|Name=TCONS_00001332|organism=Clytia hemisphaerica|type=transcript|length=14332bp|location=Sequence derived from alignment at sc0000010:155949..170280+ (Clytia hemisphaerica)
catcaaataGCCGATAGGAAAGTATGTGATAAATGCATATTGTTAATCCT GTAACATGAAActaattgagaaaaaatctgtATAGTTTTGTCCTgaaatc agttttttttatgACGCAGCAAGGAGAATATGGAGGCATCATAAATATAT CGTTGGAGAGAATaattaaaatcagaaaaaaataaactcAGTTTTGGTAT TGGGCCAAAGCAATTAAAAGCACCTGCGGAAAGACTACTGTTACAAAAAT GGTGTTGAAGAAACTAATGAACTGGGCTGGCCAAGCTAAAGATTACATCC AGGATGGTTTATTCGGTATTACTGATATCGAGGAAATACCTTTACAACAG AATCCGCAATCTCCTAGTCAAAAACGGATTCGAAAAAATGTCATGTTTTC AGCAGGGAAGGATAAAACAAAGCTTGAAAATGATGGCCCAAACATTATAT ATGACTTTTCTGATNAGATAAAACAAAACTGGAAAATGATGGCCCAAACA TTATATATGACTTTTCTGATTATGACAATAAACGTAACAAAGCTTATAAG GTGTTACGAAAAGGTCCTTTAGAGTTCCCAGAAGATCATCTGGAGTTCGA GCATCTGTCGAGTTTTGCAGTATTACAGGAATATAATGATACGTTCGTAG AGTTTTCAGATAATGATATGGAGGATGGGAATATTTTTCCGAGCAGTAAG ATGTTGATCTCGTATTTTGCAAGGTAAGTGCTTTAAATTGGTAGTTTTAG CCCAAACAGCTTTCTTTGGAATCTCTTGGGTTCcaataaacggggggagg taagttggaaaattttcgagatttaaTAAACAGAGGGGACTAATTGCCGG GTGGTTGGAAATAGTActttgaaaacccaaaaataaggtaaatataggct aaaatcaggctatttagagcaaaataagagacctctttgacagctgaaat tattcttaaaaattaacaaaCGGGGGGGGGGAGTTTATTTGAAACCTAAG AGTACCGTGTCCGCCACTGTACTGTTTTAGAGGATGTCATGGGCAGTTAA GGTATGATAACTCAAAAAAGTCACAAACTTACAAATGTTGACCAATGATT TTGGTAAACATAGATTCACAATCTAGCTAAGTCTACTATCACTGATTCTC ATTTACATTTTGCGAATGCAGTTAAACGTAAAGGATTTATGGAGACTTAT CTTTAATACCCAGACTTTAATTTTTCTGTTAGGCTAAGCAGAGGATCTCC CATTTTACACACAACCTTGAAATGCTTATTTTAATAGTGagccaattttt ttcatttcaacacAGGCTTGGAACAGGCGAAGATGATGAAGCTACTATTA ATCTGAATTTCATACAAAATCTCATCGACGCTGGTGCTAACATCAATCAA GAGGATGCGTACGGTCAAACTCTATTCTTCTCTATCGTAAGAGACTGGAA CACAGATGTGGCGGAGTACGCCCTCACAGAAGGGGCGCATATAAACCATG CGGACCATTATGGGCGTACCGCCTTACACGTTGCTGCCTCAATAAATTAT AAAGAAATGGTTGCATTTCTTATTAAGAAGGGAGGTATGCTCGTCCTGGC TTGAGAAacctattttaatttttatatctttgtttgagttgaggaaattt cgagtttaACCCTTTAAGAGCCACGGTcttatttttcttactttttaagt tttttaagaaaatcgctatttcaaactttaaaggcttatatctccgaaTC CAGAatgagttagaagctcgttcatAGCTCGCTCGTTGAATAGCTTAGAA TTTAGTTTAGAAGTTTAGGCTCCATCGGGAAGGGCGGACTGGGCGGAGGC TaaggggggggtaggttaggggaATAAAGCAgtctgcgcggacctgactg aatgatggaaagtagaaaggtgcccagtggtacaacttcaaatcaaaagt aaaacagggccaaatttgaaGGTTCTATGATCACTCgagtcaaaatctca aaaaagtggatttttgtcaaatttttgcatttctttgAACTTTTGGTTTA AAATCTCGCTgtgaaaactcatttttgaacatttcttgcttgaccatgaa gcgcAATCCAATTTCtatacgagttagaccaaaaatgaggatttctaact caaactggacATTTCAGGAGGGCTCCGCCgaaatttattcaaatatacTT GGCACGGAAAGGGTTGAGTTAGTGAAGATAGCAAAGAGTTTATGTATCTT GTATTTCAATTGGTGCGGTAGCTAGTTTTTTATTTGTCCTTGAACCTTGT TGGACTTTGCCCGTACCAGGTGACAACTGCTTTTTTCTCGGTACCGTTCA GAGATACGGATTGTTCAAGATCGCTTCCAGTCATTTACTGCTAGACAGAT GAGTCTTTATATGTAGTCCGAATACGTTAAAGGGATAAAATCGAGGAAAA ATTCTGTGGGAATTAGTTCATCTTATCTGCCTGACCAAGTAAGAGGAAAT CAATCGAAAAAGCTCTAAATTCCGTTATCCAAGAATTcttcaaaatctca aaagtcCCAAAGATGCATTCTCATACGCAATTTGGAAGTGATTTACCAGT GACATATATGACAGTGCAGAATATGTttctttttcagcaaaagttCACGC GAAAACAAGAGGTGAAGAACAAACTCCTTTACATTATGCTGCCAAATATA ATgctgctgacgtcatcgaaatTCTGATCAGTAATGGTGCAGTCGATGGA TTAGATTTCTTGAATCGAACGCCTTTTCATTTGGCTGTTGAACATGGTTG GTAACGAATTCTTTTTCTCCCCTTGATCTTCACAATGCTTGATAATTGCT CGCcattgtccctgggacaaaatcagcgtgtcttttgggtatttcccaca ctttttgtcccatgaaacaaaaatgaaaccatgggacacgcactttcttt cttgtgttggtgggatggagcatgttgcattgcacaaaCGTGAAAATAAC TTCTCGTAGCCTGTCGGCTGCAAAATTTGGTCTAATGCGAACCTTTACTA ATTGATACTTAAACTAAAACATTTGTCCTCTCAATTGGAAAAGTCATATA AAacactttctataatttgaatttttccataattcgaaGAAATTCATTGG TCTCTTCaaaatcgaattatagagagatgTTCGACTGTATTTTCCCTGTA TTCTGTTGATTTGCATAGAGAACTCGTGTGTTGCGAATCATCACTTTAGA TTTATATCCACTGAAGAGATCTCGTCGTGTCTAAAAGcactaaaatttga taaataccGTAAAGCGGGCGTAGTTTTTGAGGTCGATTCGCTTTCCTTAT TTTCACGGTATTCGTGGCGCGTTTTATACGGAAAGCACCTAAAAAGACCC GGTTTCTGCCActagttttgaatttaaacaatacaACTATAGTGGCAAAC TCCTGGACTGTTTTTAATGCTTCcaaataaaacattacgtcatgaatacc aggaattcaaaacaaaattatttcaagaAATTATTTCGAAAATACTGTAC AAAATTCTCAATTTGTGATTCTTTACAGGATGTGAAAAATCATCAGAAAT CTTCTTAAAGCTTGGTGTACCAGCTGGggaatatgatatttccaaccAAT CAGTTATGGCATTGATAGTGGACCGATTACCGAATCTTGGTTATCAATGT TTAGACCAGTTCATGACCACAGATGATAGTGCGTACAGTGCATTCTTTCT GGCACATTTAGAAGGGAATATCAAAGGATCATCAGTGAGGGGACAAACAG TTCTTCAGGTAATTTAAGTTTAAGTCAACTATTAGATTTAAGGTGAAAAT ATAGCATGTGTGTCTGCCTGCGTATCTTGTTGTTTTGATGTGAAAGATTG TAAATCCTAACACCCCGACATCCACAATTTTAGGTGAGATAGTTATCATT ATCCTGACCCAACATTTGAATTAACTTGGATTATGTTTTCAAAACACATG GAATTgactattccagaaatagtttgGACCCCCCTATGTTGAGAAGGTGT TGGCGTCCAGGGTggtctttcaaataaaaaacccAGGGAGCCTAGTTTTA AAATGAGTTAGAGTGTAAAAATCCAGAGTTgtcagtaaaacgaggtcgag aaaatagacaaaaaatctAAGAGAgtcctaaaaaattgaaaaaaaatcca gggatcacctttcccaaaaaaagacctcctcaacatagggggtacaattt ttttctggaatagcccaatgatCTTTGGGTTTTGTCTTCATCTTCCTTTC ACACAACCATACTGATTTGGTTGTATGAATCACACTTGACTCTGGTCAGA AATTTTTCATCCCTTTCTTATAACAGTGTATTGTCAAGAATAATAACGAA GAACTGATCATGCATCCAACCATTCAAAAGCTGCTCAAAATCAAACTAGA TTTGTTCGGACGAACTCACGTTATTATGTCTAACttgttgaatatctttt acGTTTTATTGGCAACTGTGTTCATCTTTTCGGTGCCGTATGATAGTTTT GACAAACAATTTGTACCGTTCGAAACACATGTTTGGAAAATATGCGTTGG TGTTgtcttttgtttcttgtctATCGTTTACATATGGCGGGTAAGTGCTG CACGTGTTCTTGAAATAATTAAACTTTGGTTAAGAAGTTTcgtaaaatca gtgtttttcatttgtaattatGCGTAAATCTGATTAATCGCGATAGTAGG GTTCGATTTCCTGATCTTTCTggtttgatttcccgatttggtTTGAGTTT GCGCTCGCTGACCACGATGAAGATGTTTGCATAATGGTTCACTATTAAAA AATANTTCAAATAAAAAACCCAGGGAGCCTAGTTTTAAAATGAGTTAGAG TGTAAAAATCCAGAGTTgtcagtaaaacgaggtcgagaaaatagacaaaa aatctAAGAGAgtcctaaaaaattgaaaaaaaatccagggatcacctttc ccaaaaaaagacctcctcaacatagggggtacaatttttttctggaatag cccaatgatCTTTGGGTTTTGTCTTCATCTTCCTTTCACACAACCATACT GATTTGGTTGTATGAATCACACTTGACTCTGGTCAGAAATTTTTCATCCC TTTCTTATAACAGTGTATTGTCAAGAATAATAACGAAGAACTGATCATGC ATCCAACCATTCAAAAGCTGCTCAAAATCAAACTAGATTTGTTCGGACGA ACTCATGTTATTATGTCTAACttgttgaatatcttttacGTTTTATTGGC AACTGTGTTCATCTTTTCGGTGCCGTATGATAGTTTTGACAAACAATTTG TACCGTTCGAAACACATGTTTGGAAAATATGCGTTGGTGTTgtcttttgt ttcttgtctATCGTTTACATATGGCGGGTAAGTGCTGCACGTGTTCTTGA AATAATTAAACTTTGGTTAAGAAGTTTcgtaaaatcagtgtttttcattt gtaattatGCGTAAATCTGATTAATCGCGATAGTCGGGCtcgatttcccg atctttctggtttgatttcccgatttggtTTGAGTTTGCGCTCGCTGACC ACGATGAAGATGTTTGCATAATGGTTCACtattaaaaaataacaattaac ggagtttgcagccgtcattacggctgttttatttttttgaatcccTGGta tccatgacgtaatgtttggAAGCATAAGAAATAGTCTGGGTGTTTGCCAC TAGTTGtcttgtttaaattcaaaactagTGGCAGAAACCTGGTCTTTTta ggtgcttccgtataaaacattatgtcatgaatatcatgaaaataAGGAAG GTGAATCGACCTCAAAAACTACGCCCGCTTACCAAATTATATTTGCAAAG CAGGTTTTTTTAGCAGGGGATTGTTGACACCATTAAAGCTTCAGTGATGA AGGATCTTATCCCTTAAATGGATTATATTTCGCACGGAttaattttcact aatttttgccgtttttgcgaAACTTTATAAAAAGGCAAAATAACGTGACA TTATCTCATTGGAAAAAATctgttcgagttacggagacaTTTAAAGCGTT AATTTCAATTGtatctttattttattcattGTATGCACCATCGCAAGGTC TTCCAtgaacccaacagctgattggttgaaagtgacgtattgactgattt tacgtcacttacaaccaatcggctgttgggtctgtgatgtaatgtcagaa gacattgcaatggtgcatatcatgaataggatATCAATTGATCATGTTCA TGTCTCGACTAATACCCTAATACCCTAAGCCTTGACACATTGGAACTGCT TTCCAGGCTGGGTCACATGGGGTCGATTCCCTTGTGTTTTGTCCTACGGG AAATTAGTTTTTCAAACCAAGTATCTTTATTTTATAGGAtatcaaacttt tattgatactAAACAAAGAAGACGAGGAGTACAAAAAAGACATGCTTAGG GTTTACAAGAAAATGGAGCAGTATTGTCATCCTGCATGGAAAACAGAAAG CGAATTTGTTGATCGGGAAAAGAAACGGCTTGAAGAAAGTCGAAAATCGT TCTTTTATGACGGATGGCAGTGTTATGAGCTCGTTGTAACTTTCACATCG GTAAGTAAAATACACTTTCGGCCGTAGtcgtgcgggcatttttttgtctg ctTTATCCCATTTAGCCTGTTAggcgaaaaccgcttttttatcgcgattt aactgaccataaaacaaagaaaaaatttggtttgtgggaaggtactggct atATCCCAttaaaaccgtcccaatccttttttgacgcatttttctattgt ctataggtgcgaaaaaaggactgggatggttttagtgggataaattGGAC AAAGAATGCCTGCGCGACAAtcggtggctacggtcgaaaaggtgtataca aTGTGTCCATTTTGTCAATGATAGTCATTTTTGAGGGCtgtagtttttta tttaaattattCAAAGATTTAACCTTTCAAGCGCGcaacattttataaaa aatgtgatAATATCCACCTTTTTTGtaatccaaaatttcaaactggcATA AAAGCTTGTACCTTGAGACAATAAGAcaatggttttggtaccatttgaaa ggtatttttatactctttctaaaagcattcAATTCATGCCCTTTAAAATC TAGTTTTCAGGGGTTGTAGCCTGTCACGTGTCAtgtcacgtttatcgctt catAGTACAATGAAtttacggcaatgaattttgaaattagccgtagatat caggtctgtgtacagacaataaGTCTGGGACTCGGTATATTTCCAAATTT ATAGATCGTGTTTACAAGTTTCTTTGATTGGAAGGGTTAATAAGGTTAAT CATCTACTCAAATTACCTTTCCAACGAGAAATGTAATAACATTCACTTTT GCAGATATAGTCCATAAGCTGAGGGTCAAAATGGGCTCGATGAGTTTACT GAATAAATTTTATGTAACATTGAAACTTCCATGTTAGCAAGGTACAATGT GCCATCATATGGAATTGCCCCAATTGTTAAGATNTTATGTAACATTGAAA ATTCCATGTTAGCAAGGTACAATGCCATCATATGGAATTGCCCCAATTGT TAAAATTACCAAACCTACTTTTACAATACACCCAACATCACACAATATCA TTTCACTCTTTGTTTTCAGTTTGCAATCATTGTAATGTATTTAGTGAACG TGCTGACTCCAAACAAGACCTTATTTACTGTCTTCAAATATTTGGCTTCT GTTAACCTATTACTTCTTTGGATGAGGTTATACAAAACAATGCGACTTAG CAAAATCTTCTCCGAAGTTGAAATGTTATTAGGTAAGTGAAATTCATAAC TTAAGGGCTCTGTTCATAGTCAGAAGATTAAGGgttttgaagataaaact ttttattttggttccttgatacttttgataaaaactgTCTTTATAAATTG TTTGGTAATAATTGCCAGGAgtaattgaaaatttaattacaaaaattacg CTATGAActataaaagttcaaaaaatgtgtgttaAGTTAAGGGTgattaa tatttttctttcaaatttttttttgaattgtcaacaaagaattgaactat ttgaaattttcagaaatttttctaaattgatgtatcaagaattatgactg tttttctacgaaaaattgggatgaaaaatttgtcaaaagccactattttc aagattttgagacaaagaagctttaTGAAAATCCATTTTCAGTTTAGTTA TAGATCAGGCAGAAATCTATATTTTGAACATGGCataaatgaaaaattca ctatggtcagaggcCTAAACTTTagggaaaataaattttaacgaACATAA CAGTTTATACAGTATATCTTTTCTTGCGTCTGTTTGTACGACACATTTCA TATTTAAGGGTTGAATGCCAATTTGGGAAATTAGCCTCGCTAGAATGTCa atattcattttcatttaGTTCATATCTTAAAGACTGTGGCGAAGATAGGA ACATTATATTTGGTATTGCTGGTACCATATACTTTCGTTGTTTACATGCT TTTTGGTGGGTCTGGTGATGAGGATGTCAGAATCACCAAGACAACAAAAG AATACGAAGTTGCCCAAATTGTAAGCTAAATCCTAAAAGCTCCATTTTTT CTAATCAATTGCCAGGCTAAATGACTGTATCGAAAGTTACAGCATCTAGA AGTAGCTCTATActtgcttcttttttttcacttaaacgGGAGGCCCTACA TAGTCTAGTAAACTTATTATGTCACCCTTCACGCTGAAATGAACCTGGAA AATACTTGACCAAAAAAATAAGCAGTCAGTCAGTCAAAAGtgacattctt ttttttttcccatGTTAGATCTCTGATTGTCTACTTTAATTATTACGAAA AAACACtacttttgaattttcagatttatGATCTATACCATTCAGCCGTT GTTACACATCACGAAATCAATGAGGTTGCAAACCAAATCTTCCGTGGTTT TTATTTACTCATGTTTGCAATTATCAATTTCGTTTTCATTGGTGTTATGA CGGAGCAATTTGTGCGCACGTACAAGAAAGCACTTGCAAAAGTCCACCTC GGAGTAGCAAATGCGTTGATCAATATTGAATTAAGAAGCAGTCATGATAA AAGAAAAGGATACAGAAAATTTATCAGAGAGAAATGCAATCCTTACGTAA GTTTTACCGACCGTAGTTCGATGGTAAAGCATATGGCTTCAGTGCGCACG GTATGGGCAAAGGTGGTCTAAATAGATTACGACGCCCCTCAAAACAACAT CACAAATGATGATGCTTCAGTGCGCACGGTATGGGTTAGATGATGCTTTC GTCCgttagagggtcagtaaacgcTAATTATGCACAGAGTCAGGGCGTCA GGGTGGTTTAcggggaaaaaagtggcggtaaaGTTTGGAACAACCCCGGa aaacacctccgccactgcttactccaccccgGGCTAACCACCATTTTCAG ATTTATCCcgtctcctaaactattccctttttcagtgatcttgtgtagac gatagcatcgtctaggtaTGTGTTAAATCCCTacctgggtcataccaaag ccGCAAAGGTACCGAAATAGTACTTGATGTCTCTGCTTAATGTTCATcaa ttattaaaagaaaaagatcaaatgaGAGTGGAGTGACCCAGGGAGAAAAT GTAGTGCCTTTCCACGCGTTTGGGTAGATAACTACTGAAAAAGGAGCCTC CAGCTTCCattactctcaggtgcctatcAAACGTGGGGGTACAAATAAAC GTGGGGGTTGgaattttttcagaattttaataaacgtgggggttggaaat ttgatatGTTTTCGAAAATACCCCTAATTATTGGAAGCAAGAAGATGCAC ATATTTTAAGTGTAACACAACAATAAGTCATATTTTGTCACACCTATAAG TataattatatttgttaaaattgCTTAACTTGATAATTTGTCAACTGTCT AGGTCAACGTCATTAAAAGCCTGCAGAAAATACTTACCTTATCAGCCAAA ACTTAGTCAGCCCCTTcttgactaaattttggcttggtgactaaaatttg ggccgactaaagatttagaaatggccaaaacttaattattagtcggccct tagtgactaaattttgacgaggtgactaaaattagggccgactaataatt aaggctgactaaaattaaggccgacttaGTTTTGGCCATTAAGGTAATCT CCATTTCAAAGATAAGACGCGACTTTGAAATTAGGCGTCCAATGAAAAAT ACTTGATaagaaatttctgaattttaataaacgtgggggtcctaataagg tccgtgggggttggaaaattttcgaaaaattaataagcgtgggggcacgt ttattaggcacctgagagtattATATCGTGACTTAGGAACCTTCTTACTC TCAGTTGTCTAATGTGATGAATACCCAATATGCAACTCTGTTTATTAGTT TGTCTATTTACTATGCAACCCCCAAATCTTCGACTAGTTGAATCCTACCA TTGAATTTacatcattttttatctttccttAGCAGCCTACCAAAAGGTAG AGAAGAGTGCCAATTCTGTCCTTGGATTTCTctgctttttctaaagattt tttcttttccttgttgctgagcatcaagtagaGAAACATCAGAAGATTTT TAGTATGACCCAACTGGGGTCGAATCCACAACATCGCACTATCTTAATGC TATAGCCTTGTAGAAATACCTTTTAGAGCCTTTTCTCTCTTGTTTGGGTT CTTGAAcagcaatagaccttatcggagtttctgattttcctaaaaaaagc gatgcattgtgggattgtttcgagtgtgttacaatagaaatctcttagga attcctcgagggaattctattgtaatacaatTGAaataatcccacaatgc atcgcttttttagaaaaatcgaaaactccaataaggtctattctttttat ttctattaGTTGGAAGAAGTATTTGGTAAAGAACGCCATTACAGAGAGGA TCGAAATGACAAATACATCAATATCAGCGTTGGCAGTGTATCAGAACTGT CGGAAAAACTCTCTGACTATCTCGGTAAGAGTTAGGCCGCCAGAATCCCC CTAATTTGTTTTGTTCTAAGGAAAACGAATCAGACTCAGAAATCAAGACC GCTTAGCAATTTTTTGGAACCGTTGTCGTTGAGTTTCAATGATCTTATGG TACACAAGGTCTTAAATTTgcttttttctcgattttggtGACAAAAATTC GCTTTTCAGAAGTGTTTTTTCAAGTCTGATTAGCATTCCTTACAGCACGT CATTGGTAAGAATTAGACCATGTCTTGACCTACTGAATCAGTTTCTTTTT GCGGCCAAATCAAATTCTCAACTTCTCTTCTCTGCTTCTCAAAATCTCAG ACACTCTCCTTCGTAAATGCTTTGgcaatttttgattttgcacaattatc ttcatttttagacattttcgGGCACGATTTTTCTTTCAATCATAGCcgtt ttgatataattttgttagttttaagccCTATTAACATATCtctgagttta aaatttgagctctGAGAAGGATATATCAATAAAGCTAAGGTAAGAAGCAG AGATACAGATCTAAGATGCAGAGTTTCAAGTCTTTGAGGCAGTGAGATTC ATATTTGAGAAGCAGAGTTTTAGATCTGGGAATGTGAGAAGCAAATCTCA AAAGCTGAGATCATGAGAGGTATTTTTCGGCCAATCATCCATGGCAGTAC CTTTACGGCCAATCACAATTTTAGCTTCTCAAATCTAAAATCAGCCTCTC AGATCAAGGCTCAGATTTAGAATTCGGCTTCTCAGATTATAATTTCAACT TCTCAGTTTTATGATATCTTTTTACTATtaaagtttttcttcttcaaaaa ttataaattgattATTTTGCTTCTCAAATCATCTTTCCAGCTTCTCAGAT CATCTTTTCAGCTCCTCAGATCATCTTTTCAGCTTCTCAGATTAACTTTA TAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGGGAA TAAATATAAGCTGAACAGCTGATTTGAGAAGCTGAAAGGCTgagagtaaa aatttgaaaagtagaaTCGATGATTGGCCGAAAAATACCTCTCATGGCAA AGGTACACTGATCCCACTGTTCTAACATATTCTTAGTTGCTGGAACTCTC TAATTATGATTTATTAATTTGGGCTTTCCCAGTAAAGATTCGCACCACCT TGACAGAAAAAATGACCATTATTTAGAGGGGGTTGAATTGTTTCTGGAAA AAGCTGAAAGGGTCAACTGTCTTGCAACTGCAGTTTTGGTGACTTCTGGT AAACTTGTGCGAAATCCCAATTCTGCGATTGGGCTGGAATTACAAAaaat tttggaggtgggtcggtcggtcggtcggaagaAATTATATTCTGACGATT TATAAAATTTTCGTCAATGGTAGGGTTAACAGTTTTTGACGTATTCGATT TTTTAAGAGTCAAACTTTTCCTTTGCCATTGCTTTAGCTCGTATAAAACA TGGCTAAATGGAAAGAGCGCTAACAGGAAATTCaagattcttatgcttga gtcagacaagatacgagttttgatttcattatttgaagttaaaaaaaaaa atttttaaatagcaataactttttttgggtcggcaggtttcgaaATAGTG TCAGGCGGGTGATGACAAaccatcattttttaaattccagCCTTAGTAAG TATTTACGTAGTGCGATaaaatgaatgctaaaaatGCAGGTCTTTGACAA TCAAACGACTACTTACTCAAAGGTAAGATTGAAGCTTGTCATGTGAATGA TTTCTAGGAGCGTATTTCGGTAACCAGGTTATTATCTCCATCTATAAAAC CGACTTtgccagctggtacacaacgttgtttcaacgttcatctaacgttg tatggacattttgaacgttagataaacgttgaaacaacgttgtctgGAAG CAGGgttcgtttttttcttttggaaatattcctttctcttcttttttaga TGATGCCGACTTTCTAAATCAACCACAAAGGTCTTGTGATATTGATTGTT TGCAGAGTCTTCAGGTAGAGTTGGAACGCCTCTCGGCAGACATGAATTAT GGCAAAGCAGGGTTACAGTTGAAATCGAAAGAAGTATTGGCGAAAGCCAA TAAATCGGCTGAAATTATTAAAGCAGGTAAAAAATTACATATTGTATATT TACCTATATATGATTTAAAAGATAGAgacttaaggcttggggacgaTATA TGTTTTTGCAAAATTGATTCTAATCAATTTTGCTTTATTGTCCCAgagac aaaatcagcgtgtcttttgggtatgtCCTTCCccttttgtcccatgaaac aaaaaaagaaaccatgggacatgcacttttttcttgtgttggtaggatgg agcatgttgcattgcaccaacgcgaaaaaacttttttttagttATTTTCC CTGATAAAGCTATATGGTAAAAATCAATCATTTTCACGAAATTCAGGTTG TGATCCACGGCATCTAGCAAAAGGAAAACATCTATCCAAACCAAAACAAT GAAGATAATCTGGAATCTTCTGAAAAGGTTCCGTTCCATCAGATACGAAG GGTCAAATAGGAATGATCCAGCTCCATTCAAAGTTAATGCCTTGCTGCCA TTTTAATGGTTAAAACGTAGTTCATAGATGTTGAAATCTTCACAACTAAC TCACTTACTAAAGAGACTTCAAAGCGAAAACGACAATAACAGAACATCAA AAGATAACTTTATTTTAAACTTTCTCCGATAAATTTTGTCTTGACTATCA GACAATCTTATTTTACGAAAAAGGGTCTAAGCCTATCTTTGGCTTTTGGT TGCTCTGGACTCGATCTAGACTCATAAGAATAAATCCATTCTACCTCCCC CACCCTCTGCCGTTAAGAAATACGGGGAATGTGATAATCGAACAAGTTTA TTCAGTccaaaccattgagtttaaagcgcgaagggctagagtagaatctc taacatTTATAAGGCAAGATAAAGTGAAGCCA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000719XLOC_000719Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001332-exon-sc0000010-1491911889:155949..156391TCONS_00001332-exon-sc0000010-1491911889:155949..156391Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:155949..156391TCONS_00001332-exon-sc0000010-1510915933:155949..156391Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:155949..156391TCONS_00001332-exon-sc0000010-1575043694:155949..156391Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:156448..156671TCONS_00001332-exon-sc0000010-1491911889:156448..156671Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:156448..156671TCONS_00001332-exon-sc0000010-1510915933:156448..156671Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:156448..156671TCONS_00001332-exon-sc0000010-1575043694:156448..156671Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:157264..157532TCONS_00001332-exon-sc0000010-1491911889:157264..157532Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:157264..157532TCONS_00001332-exon-sc0000010-1510915933:157264..157532Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:157264..157532TCONS_00001332-exon-sc0000010-1575043694:157264..157532Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:158586..158744TCONS_00001332-exon-sc0000010-1491911889:158586..158744Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:158586..158744TCONS_00001332-exon-sc0000010-1510915933:158586..158744Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:158586..158744TCONS_00001332-exon-sc0000010-1575043694:158586..158744Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:159527..159756TCONS_00001332-exon-sc0000010-1491911889:159527..159756Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:159527..159756TCONS_00001332-exon-sc0000010-1510915933:159527..159756Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:159527..159756TCONS_00001332-exon-sc0000010-1575043694:159527..159756Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:161112..161375TCONS_00001332-exon-sc0000010-1491911889:161112..161375Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:161112..161375TCONS_00001332-exon-sc0000010-1510915933:161112..161375Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:161112..161375TCONS_00001332-exon-sc0000010-1575043694:161112..161375Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:162386..162598TCONS_00001332-exon-sc0000010-1491911889:162386..162598Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:162386..162598TCONS_00001332-exon-sc0000010-1510915933:162386..162598Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:162386..162598TCONS_00001332-exon-sc0000010-1575043694:162386..162598Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:163668..163830TCONS_00001332-exon-sc0000010-1491911889:163668..163830Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:163668..163830TCONS_00001332-exon-sc0000010-1510915933:163668..163830Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:163668..163830TCONS_00001332-exon-sc0000010-1575043694:163668..163830Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:164467..164618TCONS_00001332-exon-sc0000010-1491911889:164467..164618Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:164467..164618TCONS_00001332-exon-sc0000010-1510915933:164467..164618Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:164467..164618TCONS_00001332-exon-sc0000010-1575043694:164467..164618Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:164922..165194TCONS_00001332-exon-sc0000010-1491911889:164922..165194Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:164922..165194TCONS_00001332-exon-sc0000010-1510915933:164922..165194Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:164922..165194TCONS_00001332-exon-sc0000010-1575043694:164922..165194Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:167008..167122TCONS_00001332-exon-sc0000010-1491911889:167008..167122Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:167008..167122TCONS_00001332-exon-sc0000010-1510915933:167008..167122Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:167008..167122TCONS_00001332-exon-sc0000010-1575043694:167008..167122Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:169248..169424TCONS_00001332-exon-sc0000010-1491911889:169248..169424Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:169248..169424TCONS_00001332-exon-sc0000010-1510915933:169248..169424Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:169248..169424TCONS_00001332-exon-sc0000010-1575043694:169248..169424Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1491911889:169745..170280TCONS_00001332-exon-sc0000010-1491911889:169745..170280Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1510915933:169745..170280TCONS_00001332-exon-sc0000010-1510915933:169745..170280Clytia hemisphaericaexon
TCONS_00001332-exon-sc0000010-1575043694:169745..170280TCONS_00001332-exon-sc0000010-1575043694:169745..170280Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000010supercontigsc0000010:155949..170280 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.0353716 0.0402417 0.0333746 0.0195911 0.079501 0.0816696 0.075793 0.0638609 0.00496783 0 0.0179181 0.0157049 0.384234 0 0.0267802 0.0359241 0 0 0.244405 0 0 0 0 3.12238e-05 4.98569 4.71473 0 0 0.0130866 0.0199997
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00001332 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top