Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001200 (transcript) - C. hemisphaerica

Overview
NameTCONS_00001200
Unique NameTCONS_00001200
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length5677

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00001200 ID=TCONS_00001200|Name=TCONS_00001200|organism=Clytia hemisphaerica|type=transcript|length=5677bp
tatagaaaagaacggTTTATGGAGCTGGACAGACAGCAGTCGAAGTATTT
ACACCAATTGGGGTAAAGAAGTGGATAATAAAAACAATAGACATGATTGT
GTTTATATCGATCAAGAGGAGGGCAAATGGAAAGATGGAAATTGCACCTC
ATCAAAACCTTTCCTCTGCAAAATGAAAACAGAATCTTGTCCATCCGAAT
GGAACAACTTGAAATTGAACTCTGTGGTGGGATGTTACAAACTGTTTAAT
GATGATACCACATGGGAGAAAGCTGAACAACGGTGCAAAGCTGAAAACGC
TCATTTAGCAAGTGTGGCCAGCGAAGATGAACAAACCATGATTTATCAGT
TCCACTCGTCCACCTCTTATTGGATTGGATTTAATGATCGCGAGAACGAA
GGTGATTGGTTATGGTCTGATAGGCTGACGTCATCATACACCAATTGGGC
GGATAATGCGCCAaataatggcggatatagctgTGCGTCGGTTGGTAAAA
GTGGGAAATGGCATGATGGGAAATGTAACGAGAAGTTGAACGTggtctgt
aaaaaaaaagGACCGAAACCAGAGAAGACAGATGGTTACAATGAAGATGG
TGTCTTGTTACCAGTCTCTCGTTTACTGGAGAACGACGAGACTGCACCAA
GTCATCTCTATGATGATAAGGATAAATCAAGTCCAGttGTACCACTGAAC
TTCTGGCCGCTTTTGAAAGATTCTAAACTTGGAATGGCTGGTAACCACCC
ATTGGCCGTCAATGAGCCACAGAACGTCAAAATCATCCCCGGAGGAGTGT
TATTAGATGGAGAGCGCTCCTTCTTAGATGCTGGTGACTTCCATGGACAT
TGTATTGGAGATCCTGAGAAATGCAACAAAGGCTTTTCCGTTGCGTTACA
GGTCAAATTCGATCCAGTTGTCCTTGGTTACAAGAAACCTCATTACGTCA
TTGATACATCAGGACGAGGCCGTGGTTTTGCCATCTACATTCAAAACGGT
AAACTTCATTACAAAGTGGTCACTGATGGAGGGTCCTGGGAACTAGAGAC
ACGTTTGACAGTCTCGTTATGGCAAGATATCGTGTTGACGTGGAAGAATC
CATCAGGTCTACACGTCTACGTCAACGGCGCGTTCATGGATTACACGAAC
ATCACGAAAACTGTGGACATCAACACCAAAATGGTGACCACCACCAAATT
GTTGATCGGGAGAAGAAGTATCGATGATCGAGCTCCTTGTACTAAGATGG
CAGTAGGTTCAGTAGTTTTGTTCTTCAAACAACTTTCCGTTGAAGATGTT
CCTTACGCGTTCACGTACGGAGATACGGTGGTTGCATACACACGTTTTTT
CATGACAGATATCGAGAATTCGGAAATTCCTGGCGCTGCTGAGTTTGTTG
AGAAGTCTATCACAAACATCGATGGAGGAATATTTGTTGACGGTGACACT
TCAGATTCGGTCAAACCACACGCTTACCTGCAACTCGAGGATTTCCCTGA
TGTCATCTACAACGTACAAAAAGCGCGACATGGGTTTGCAGTCagtttca
aaatcaaattcGACCAACGTGACCGTGATTATAAAGAACCACGATACATC
TTGGATACGGGTGGTCATAATGGTGGAATGAAGGGTATTTCCGTATACCT
TGTCAATGATAACATGTATTTCCAAGTCATCCGCTCTTCGGATGAAGACA
TCATGATTTGGAAAGTTCGCGTTCCTATCTACACCATCCGTTGGCAAGAA
GTGGTCATGACATGGCGCTTAGACAAAGGTTTATGGATTTACGTGGACGG
CATGTTCCGCGGTCACACGCTCTCACCACAACCTCTACCTAAAGATGATC
TGAGCACACCAAAACGTTTGACCATAGGACGTAAAAATTCAGGACCGGAA
AAATCAGGAGCAGTGTTTGGTTTCAGTTCACTGGCAATCTTTGGTCGATA
TTTGTCGAGAACTGATTCTGAGAAAGTGTTCGGGAATACAGACAATCCAT
ACCAAGGAATCATTCGGGAGGTTTGGAAGAACACTCCAGGCGAAGAGCTG
GATAAACTGGAAGACAACCCTGACTACCCGAACAACCCGACCACTATCGA
AATCATCGAGAACTTTGATGCACCTTTTAACGTTGAATCGAACTATGGTT
CCAAACTGAAAGGCTACTTCATCGCACCTGAGACAGGGAATAATACTTTC
TACTTGTCGTGTTCTCGCGCATGCGCTTTGTACTTGAGTAAGGATGAGAC
AGGCAAAACAAAGCAGAAGATCTTGACGCTTAATAAACCCACAGAACATA
ACGTTTGGAATAAGTATGACAACCAATCATCGGAGGCCATCTTCTTGGTA
GCGGGGAAATATTATTATTTGGAAGCCATTCAGAAGGGCGTCGATAGCAG
CGATTCGTTGAGTGTGGGCGTCAAGTTACCAACAGGAAGATATCAACGCC
CTATCAACAAAGAGAACTTGCAGTGGAGACTACCTGGCAATCCACACGCA
GGGCTTGTACGTGAAGTATGGTACAACATCCCTGGTTATTCCATCGAAGA
TTTGACTTCAGATTCCAACTTCCCAAATCGCCCTTCATCAATTGAAATCC
TTGATAAGTTTGATGCTCCTTTTAATTATGAGGATAACTATGGATCAAAG
GTTTCTGGATATTTCCACGCACCTTCATCAGGCGAATATACTTTCTACAT
GGCCACTGACAGTAGTGGTGAGCTGTGGTTGAGTAGTAATGAGAATGCAG
ATAGTCTGAAGAAAATTGTCACCTTGAGCAGTTGGACTGATCATAATCAA
TGGACAAAATATCCTGAGCAGAAATCTGACAAAGTGTTTTTGGTGGCCGG
AAAATATTACTACATTCGGCTGTACATGAAAGCAGACAAGCTGGGTGATT
GTGCTTCAGTGGCTGTCGAAATGCCTGATGGAACTTTCGAGGGACCAATC
AAAAAGAAGCATCTATCCTGGAGATTGATTGGTTCAAATGAAGGGCCTGG
ACCCAAAGAAGTTGTCGAAGAGTTACCTAAACCAGTTGGTTTATACCCCC
TGAATGAGAATACGCTGAAAGACATGATCACAAAAAATGTCGAGTTGAAA
AATGCTGAAGTCACAAAGGGACCTGGAGATCTACCAAAGAGCGCAATCGA
GTTAAAGGGAAGTCAATCTTCATACCTTGAAATTGCTAATAATGGAAAAC
TAGATGCTCGTAAATCAATTACAATTCTcaccaatatctttccaacggga
GACAATGGTCCTATTGTTGCTTATGACCCAATGGGAAATGGTGTTCACTT
ATGGCAGTACGATAAAACACAATTGTTCGTCCGTTTTACTTTACGTGGCT
CGAATGGAAACATGACATTGGAACCATTAGCTACACGTGTTTTGCAGATG
AAAAAGTGGAATCAAGTTGGTGCTTCATACGATAACAACACAGGAGTTGC
CCAATTGTGGCATGATGGCAAGATGGTCAAAAGTCGAAACATCGGGCAAG
TTGACTTGGCAACCGATCAAAACATTCGTATCGGTGCCGTACAAAACGAC
AAACGATATTTCGAAGGGAAAATCTCATGCTTACAAATCTACGATATCGC
ATTGCGAGAGAAAGAGATCGGTGAACTTCGTGTTTGTCCGAAAGCAAACC
TTAAAGATGAAAAGCAGGACGCAAAATCTGCAGTTAACAATACGCATAAT
GCAGCGACGGAGGCAGGAGCAGAAACGCGGATAGGTGATGAAACCGAAGA
AGAGCTCGTCGCAACACGTTGCCAACCGAATCCATGTTCGAATGAAGGGG
TTTGTCAAGATGATGAGAAAAAGATTGATGGATATGTCTGTATGTGCCCT
GCTGAGTTCACCGGTAGACGTTGCCAAGTTTCCAAACAGAGGGCCGAGAA
TCCAGTGGTGAAACGAACGGCCATTCCCACCACCACCGTCACCAATGACA
ACACCACCACCAATTTGCTTAATGCGATTACCACAAACCCCACTAACGCT
TCAATTGCTGAAAATGTCACAAAGAGCGATGAAAGCAAAGAAGATATTTC
ACTCTTGTATCAAAAACTTGGTTGCTATAAGGATGATCCTTCAAACCATG
ACCTTAAGACCAAAGTTGATTTAAAGCGAACCACACAAGAAGACTGTGCG
AAAGCTTGCGCAATGGCTGATAAGAGCTACTCTTACTTCGGCCTTCAAAA
TGGTACCTCGTGTTTCTGTGGCAAAGACCATGGGAAGTATGGTAAATTAG
GTGACGAAGCCTGCAATATGACCTGCAATGGCAACGAGGCTGAAAAATGT
GGTGGATCAGAGGCTaataatgtctttttttatgGCTTAGGCACCAATTA
CACGGTGAAGACATTCACAGGCAAACCCCTGGGAGCGGGTACTgatgcca
aaatttatttcgaaTTGGTTGGCGATCGAGGAAGCTCAGATTTCCGTCAA
CTCGACCCCAGTCCCGCTAAATATGAACCTGGAAGCGAGGACATTCAAAC
GTTCTTATTACCGGATCTCGGTAAATTGAAACGGATGAAGATTCTCCATG
ACAACACTGGAACAGCGCCTAGTTGGTTCTTGAAAAAGGTACAAGTGACG
GACGAAGAAGGTGGTTCATATGAATTTCCGTGCGATGAATGGTTAAGTGA
TACCAAGGGAGGAGGGAAACTTGAACGAGAACTCATCGCTAAATCGAACA
TACCAACACCAAGTTGAAAAATATCGACTTTGGAATGATTTCAAGCTTAG
ATGAAATGAAACGATCATCAATTACAAGCTTATGAGTACTGTGGCTGAGA
AGAGGCTTTGGATCGCGTAAAGTCCGCCATTTATCGAAGTACATTTTATA
TACAAAAGCTTTTTTCGTACAAAAGGGACTTTTCTTGACCCACGCATCAT
TGAAGAGCTTACGAGTCCGAAAAACTAGAGGATTTAAGACTTTTAGTAGC
TCGAGACTTTAATAAGGAATATTTTTGTAGTGGGATTTGTAATATATTAT
GCTTgtaaatattaaattttataTAACCGCTTTATTTATTAGATGATTAT
TTCCTATTGCGTCGTTGTGCGTANCTTgtaaatattaaattttataTAAC
CGCTTTATTTATTAGATGATTATTTCTTATTGCGTCGTTGTGCGTAGATT
TGTTTTCCCACTTTCTATTATTGTCTGGTAGGGTTAGAAAGTCGTCAAAG
ACAATTAAAGCACATAGTGCCTGTCTCATCGGCCAATCCTTCTCTCAAAG
TTAACGTTTGAAAGGTCTTTAATCTCTCTATTTTGAGTATAGCTCATTTT
GGGCCCGTATGTTTTGAGAAACCTCGGGATTTCAAGCTTAGCAATTTTTG
TATTATGGAGAAAAAGTTTTAAGATGTTCGAAGTAACTCTTTTTAACAGC
AAGGATACCTCTCCTCAAACGCACCGCTGGAAAACCAGGTTTCCTGTCAT
AAAAAATTAGCAAGCTACAAGAGAATTTTATCCGTATAGGGTATAGTGCG
TTTTTAGTTTTTATACACGGGCTATTTTGTATAGGGAAtttcaatgtttg
aaaaaagacattatttttgaaatctatttGTTTATTCACTTTTGACATTG
GTACATGCATCGACTGTGTGCTTTCAAGCAATGTCGGAGATATCCTTTGT
TCCTTCTGCACTCAAGGTAGTCCATAC
Run BLAST on NCBI

transcript from alignment at sc0000007:977859..997379-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001200 ID=TCONS_00001200|Name=TCONS_00001200|organism=Clytia hemisphaerica|type=transcript|length=19521bp|location=Sequence derived from alignment at sc0000007:977859..997379- (Clytia hemisphaerica)
TATAGAAAAGAACGGTTTATGGAGCTGGACAGACAGCAGTCGAAGTATTT ACACCAATTGGGGTAAAGAAGTGGATAATAAAAACAATAGACATGATTGT GTTTATATCGATCAAGAGGAGGGCAAATGGAAAGATGGAAATTGCACCTC ATCAAAACCTTTCCTCTGCAAAATGAAAACAGAATGTAAGTGTAGCTCTT ATTCTTTTGCACTTTGCTTTGTAAAAAATTACTGGAATTTCCAAAGGTCA AGGCATGGTTTAAATGTGTATGAGGTTCAAGATAATAAGATTTCCCTTTA AAAAAGTCTGTTTTCAGTTAGATCAGCTTTGTTTGTGATATCTGGGTTCA GCACAATGGATTGTTGATCGAGTTCATAATGAAAACTACATCGTCCACTG TCCACTGTTTCCAAGTGAAGTGTTGCAGTGTGGTTGACATTTTATCATGG TAACAATCAGAAGTTTTCCCATCAAACAAAGGGCATCAAAAACATGATTC GTCACGAAGGCGCTTTCATAGAATGTTATTCTACACTGTTTACTTTTCCC AACTATTTGACAACCTGATTAGTAAATGATTCATACTTCGAGAATGCACT TGTCTATTTACTCTAAATAAAGTCTAACGATGCGGTAGTTTTTATGTAGA CATAAAAGTCGTAGCTTTGTATATAAGAAAGCGTTGTACATGATCCATTT TACTCCATATGCCCCGAGCTCAAAGGACTACCTGATAAGCCATTTTATCT CACGCTACGCTTTAGTGACAAGTAAAGTCCAGTGCAAAATATCACTTTAT TTTTTTACACTATTACAATATTACTATCTGGCATGAGGATCTACCTTCCT CCTGCTGTAGACGCATTCTACAATCTGAGTTTGAGTAATCTGTGTTTTCA AACGTTCATTTTGATTCTCTTCTATAGCTTGTCCATCCGAATGGAACAAC TTGAAATTGAACTCTGTGGTGGGATGTTACAAACTGTTTAATGATGATAC CACATGGGAGAAAGCTGAACAACGGTGCAAAGCTGAAAACGCTCATTTAG CAAGTGTGGCCAGCGAAGATGAACAAACCATGATTTATCAGGTAAATCAA CCACTGCTGACTCTTCCGGTCTGGTATCTTCAAAGTTCAAAGCACAAAAT AAATAAAAACACAACATTCTGCAACATTCTAAAACGTACGAAGAGAGTTC GAAATGTTAGCAGCTAACTGTAGGGAAAAATTTTCTCAATGGGAAAATGT GCCGGAATGTCAACCCTATAGGAAAAATATGAAAAGTGTTATAAACTTCA ACAGTTTTGTACCATTTCAGAAACCCTCGATCAAAAATCTAAAGAATATT CATAATTCAATCTGTTATTTAGCTTGGTCATTGAGATAGGGGTGTAAAAG ATTCTAGACTTTTGGTCCTTTATCGTGCTGTCAAAACCTCATGTTTGAAA TACTGTATAGTAGTGATCGACTGACATTGGATGATTAATGCGCTTAATCA GGTTTTACACTGACATGCGACTCTCCTTTCTCTATTAAAATCATACATTA TCTGTTGGAAAAGCTCAAAGAAAAATGAAATTAGCACACAAATAACAAAG AGTCGACCTTCTGAAAAGGAATAACTTGTACAAAAACCTTCAAGGAATTT TAACAAGTGTTTACCAACTTTGTGATACTTCCGAAATCGATTAAAATTTA TATATTTGAGAAGTAAAATTTACCATACAGTCCTAAATAGCTTATACAAT TAGAGCATCGGGTTTTATCAATGTTACTGTATAGCACTAATCCACTTTCC TGTGGTGGACCACTTCTCTTCATACCTACCACATACTTGCGAGGTATTTG AAGGCTTAAAATGAGATCATCTGTTTACAAAAGACCTCAACTTTGTTTTC ATTTAGTATTTAGTGACGTAGAAAACAAAGCAGTATTTGCATAATGGCGG AGGGGGTAAAGTTTTGTGACTTGGGGCAATTTGAAAAAAATTAAATCCTA CTAGGTAACTGGATTGTTCCTCGACGGACGAAGAAAATGGTCAACCGGAT GTCTCCCCGAACTGACATTTCCGCGAACTGACAACCAGTGCCGGATATTT CCCCGAATGGATGCTTAATAATCCTCTACTCTACTACACTCTTCCTGGAA AATGCACCTAAATGTACAAAGATTCAAGCAAAAAATATTTAATATCTGAA AAAATTAATCTCCCCTCCTCAGTTGCTAAGACACTTCTTGACAAACGTTC TCACTGGGTATAAGGAGTATTGTGTGTTCTAAAATTTATTTCGCTAAAGT TATTATTGTGTATGAATTCTAATATGTACATAAATAATAATGATGTAAAA GTTACAAAAGATGAAACCAGGAAAATAAATAAGATGTTATTATAAAACTA GCAATATTCATGGAACTTGCACGCCACACGTAAACCAACGAAGAGAGCGA ACAAGAAGAAGAAGACTCCGAGAATCATAAAACAACAACATGTCTCTTTC GATACACACCGCCCGTGAACATTCCTGTTTTTACGCGCCCTGATGATAAA CGCCACGATAACGCCAATGGTGATAACCACGCCCAAACATACGCTCAAAA TAATAAGAAGTGTATATTCAGTGTCTTGCCTTGCTTTTTCACATTGGTCT CCATAGAAACCTTTTAAACATTCACATTTGTATACAGTCTCGTTTACTTG TAGACAAGAAGCCTCGTTTTGACACAAATGATCTTCGCACGAGTCATAAG TTTTACATAAAGGTAAATGGATTTTCGATAACTGTCTGATATTCCGTCCT TTGAGACGGGGTGGTGTTGCGCAATCACCTTGGAGTTCACCTTTCATGCG GAGGTCGATGATATTCCTGTGCATAAGCCAACAATCACATACTAACGGAT TTCCTTTCATGTTTATTTTGCCAAAGATAACCAGACTTGAAAACACATTA TTTCGAATGGCTTTTAAACGATTATTTTGCATGTCTAAAACGTGAATCTT TAAACCTTGGAAACTACGGTCATCCAAAGTAGATATGAAGTTGTCTTTCA GAATGATGTCAGTTAAATAACGAAAATTATTCATCACTCCTTTACGAACA CGTTGTAACTGATTATGAGCTGCGTTGAACTTTTGTAACGAGACCAAACC GTTGAGTACTCCTGCATAAAGAACGTCTATCTCATTATGATCAAGAAATA GCCTCTGTAAACTCGTCAAGCCTGTAAAAGCATCAATGGTGACTTTATGG AGCTTATTTCTCGACAGGTATAAAGTTTTTAAACCATGCATTCTCGCAAA CGAATAGGGCGCCAAATATGTAATATTATTCCGTGATAAATCCAAGTCTG TGAGATTGGGCAAATCCAAGTTTTGTGGAATATGTTCTATATTGTTCTTA GTTAGCGTCAAGTGTTTCAAACTGAATAGATTCTTAGACATGTTCTTAGG AAAGTTCTTTATGTTGTTCTCATCTAAGAATAAGAACTTCAATTTATGGA AACGCCTGAATAATACAGGATCGAAAAGATGAAGGGAATTCCGTTTCAGA TTGATCAATTCTGTGCCATTTTCACATCCCTCCAAAGCTGTTGAAAGCTC TTCATCTGTGATATTCTTCTCTGATAATCTACAGTCTTTGCTCCAAACTT CAATTAATAAAAAACTTGAAATCAAAAGCAAAACCATGTACAATTTCACA CAAAACATTATTGCTTTTCTATCATATAACCTCTGCAGAGATTCTTCTTG TCACAGTTTGTTCGTGTCTTGGTGTTCGGTCATATTTTCTTTGTCTGTGG TTGGTGGCCTTTCGGAAAAGTTGTTTTATACACGATACTGTAATGTGTAC TCTTCCGATTGTTTGTGTTTCAATCTCTCCATCTGACTGTTTATTTTGAT GAGCTTATCCTTTCACTGTAGTCTGTCAGTTTTTCTCATTCTTGTGTAAT GTTTCTTTCTAAATCACTTATCAAAACATCAGTTTAGTACACTCCGTCAC AGTAGGCTTTCTCCTCAAAACGTTTTCAAACTCTCACAGTATCTCCAGGC GTGATAATCAAGTAACTTGAAAGTACTTGTTAGCAGAACAAAGATTCCTT TGTTCATCCATATAGTGATATGCTTACATGAACTTTCGTAGGTACAGGTC AATGAAGAATGGACTGTTTATAGAAACGCGACTTGTCTATAAGAATATTA TCATAGTACTACTTCCTGTCAAGTTTCCCCCGGGCCCCGGGTACTTAACT ATGATAATCTATGGGCAAGTATTCTTTTAAGGTGGGGTTGCTTTCTCTAA ATCCAAAGTTTGGATTATGAAACTTTTTCACATACATCCCTTGCACCCTG AAATCTTCACGAAATTCCTGACATTTTTTGACAAAGTCTCTTTTCCTTTT ACAGTTCCACTCGTCCACCTCTTATTGGATTGGATTTAATGATCGCGAGA ACGAAGGTGATTGGTTATGGTCTGATAGGCTGACGTCATCATACACCAAT TGGGCGGATAATGCGCCAAATAATGGCGGATATAGCTGTGCGTCGGTTGG TAAAAGTGGGAAATGGCATGATGGGAAATGTAACGAGAAGTTGAACGTGG TCTGTAAAAAAAAAGGTTAGTGGTTCAAACGTACATCAAATGGCTTGTTA AAAAACCTTGATATCTTTTCCCTTCTAAAGTAAATGAAGTTGCTGGCTGC CAGAGTAGGATGGATTTCGTAGTTTTTGCACTATTAAATGAAGTAAGGGT TTTTCAACGAAATGGTTGGATATTCCGAACGTCAATGAAAACCCCCCAGA AGGAGGGCTGGTAACTTTTGCTAAGATTAGGCGATGAGACAGTTAGATGG ATATTCCCTCTAACGACAGGACATTGTTTTGTTTACTTCTCTTCAATTGG CATAAACAACACCATTAACTGTCTAACTTGTTTCCAATCAAAACTCATTG AATATCGCCCATTTCAAAATGGTAGATCTCGTTACCATGGTGACATAATA ATCGTTACGTCATGTAAGTTGTGACAGTAATTTATTACGCGTTTTTGTTT CAATTAAAAGATTTAGTTAATCCGTGTGTAAATTTTGACGTCGGACTTAG ATTAACGACCACACCGTTATTCGAAAAGAAATATAGATTTTGACTCATCT TTCGTTGAGTCTTTCGTGACTCAAACTGAAAATTAAAACCATCAGAAAAG TGCGCTCGTTCGATGATTTTGATAGATTAAATTTTGGTCAAATATTTTTC TCCTCGCTTTCTTTTGTGGTTTGCTTAGGCTGACCTCCTTTATGACAAAG CGTGCTTAGCGGCCCGAATTGAGCTGTTTAATAAACCTCAAAAAGATGAT CGGTCTACAAAACACATTTTCAGGCTGAACTCATATACCAAAGCGGCTTT TTAAAGTGGTTCTTTGGAGTTTATATATGTCACAGGGATTACACGTTTAT TTTTTATTAGAACAAACTATATAAGAACATACAGGCTTCGATGGCCAAAA TATTAACAACAAGTTAAGAGCATTTTAAGGCATTTTAAAATTTCGATTTT TATCAAAGTAATTCAAGATCTTCCACCGAGTGAAGAATATGTAACGGTTT TCAGGTTGGTGACCGTCAGATTTGGGTGAGTCACTGAAGTGTTTTGAACA GTCCCAATACTCAAGTGCCTTGTGATATACTATGCTATGGAAACCGAATA CGTTCTCTCAAACATTGTTGGGATTTCTCTGGATTTTCACTCAACAGTTA GCACAAGTTTAAGAAAGAAGACACGTTGAATGATCAATAGATATCATTTC AATTTTGCACCCCGCTCCTTCTTTTTCCAAAAATCTCGATTCCACCTTTT GCTTTTTCAGGACCGAAACCAGAGAAGACAGATGGTTACAATGAAGATGG TGTCTTGTTACCAGTCTCTCGTTTACTGGAGAACGACGAGACTGCACCAA GTCATCTCTATGATGATAAGGATAAATCAAGTCCAGGTTAGTGGTTTTAA TCCTGATTTTTTAGTTCAACGAGGGTAAAAATATTATTATATAACATCCA AATTCTTTTGCAAGTTTTGAAAATTTGAATAAGATTCTGTTAGTAGTGCT TTTAAAATGTATGGATTTTTTCTTTGCCCTGATTACATGCTGACTATTTT AATATCCTTTTTTCTTTGATAGTTGTACCACTGAACTTCTGGCCGCTTTT GAAAGATTCTAAACTTGGAATGGCTGGTAACCACCCATTGGCCGTCAATG AGCCACAGAACGTCAAAATCATCCCCGGAGGAGTGTTATTAGATGGAGAG CGCTCCTTCTTAGATGCTGGTGACTTCCATGGACATTGTATTGGAGATCC TGAGAAATGCAACAAAGGCTTTTCCGTTGCGTTACAGGTACGTTTGAAAT GATCTTCCCGTAAATATTATTTTCGATTTTCATAAATCTTGTTTCTTGCA CAACCTCTCTTAGGTCGTTATTGGATTTTGCAAAAATCATTTAATTAGTG TTTTGAAAACGGTTATTGATAATCATTAGAGATTTTTAGGGGGATTTTGA TCATTTAGACCTTAATTCACACAGCAGAATAAACAAAACAACAAATTAAA CCCTGTTTGCACTCCCCACACGAGACATCACAAAAATCATCATCCGCTTT CAGGTCAAATTCGATCCAGTTGTCCTTGGTTACAAGAAACCTCATTACGT CATTGATACATCAGGACGAGGCCGTGGTTTTGCCATCTACATTCAAAACG GTAAACTTCATTACAAAGTGGTCACTGATGGAGGGTCCTGGGAACTAGAG ACACGTTTGACAGTCTCGTTATGGCAAGATATCGTGTTGACGTGGAAGAA TCCATCAGGTCTACACGTCTACGTCAACGGCGCGTTCATGGATTACACGA ACATCACGAAAACTGTGGACATCAACACCAAAATGGTGACCACCACCAAA TTGTTGATCGGGAGAAGAAGTATCGATGATCGAGCTCCTTGTACTAAGTA TGTTTGTTTGTTCACCATTTTGTGATCTTTCTTTCCTCTCTCGTTAAAAT GTATTTATTGGATATTTTTCGAGTGATCAATGTATAGGATGGGGATGTCT TTCTATCAAACTTCCCTGTGGTGATTTAGCATGTGTTTCTGTTTTTCATG ACCAAGCTTCTCCATGGTATTGGCTAGATTGCAAATCGTTTGCCTGATAC AACTGGATTTCATTCGAATTACATACACGAAACTTTCATTGAAATTCGGT TCAATCTCTAAACACTTTTACTTTTTCAGGATGGCAGTAGGTTCAGTAGT TTTGTTCTTCAAACAACTTTCCGTTGAAGATGTTCCTTACGCGTTCACGT ACGGAGATACGGTGGTTGCATACACACGTTTTTTCATGACAGATATCGAG AATTCGGAAATTCCTGGCGCTGCTGAGTTTGTTGAGAAGTCTATCAGTAA GTGCATTTTGATAAAATCTGAAAATATGAAATTTATTTTTTAGAACTAAA GCTGCGTTTTCTGTCTATTTTTTAGTTTATTTTGAAAAAGATTATCTCTC TTGTTGCGACCCTTTTTTTCAAAATTCTGTTTTTCCTTTATAGCAAACAT CGATGGAGGAATATTTGTTGACGGTGACACTTCAGATTCGGTCAAACCAC ACGCTTACCTGCAACTCGAGGATTTCCCTGATGTCATCTACAACGTACAA AAAGCGCGACATGGGTTTGCAGTCAGTTTCAAAATCAAATTCGACCAACG TGACCGTGATTATAAAGAACCACGATACATCTTGGATACGGGTGGTCATA ATGGTGGAATGAAGGGTATTTCCGTATACCTTGTCAATGATAACATGTAT TTCCAAGTCATCCGCTCTTCGGATGAAGACATCATGATTTGGAAAGTTCG CGTTCCTATCTACACCATCCGTTGGCAAGAAGTGGTCATGACATGGCGCT TAGACAAAGGTTTATGGATTTACGTGGACGGCATGTTCCGCGGTCACACG CTCTCACCACAACCTCTACCTAAAGATGATCTGAGCACACCAAAACGTTT GACCATAGGACGTAAAAATTCAGGACCGGAAAAATCAGGAGCAGTGTTTG GTTTCAGTTCACTGGCAATCTTTGGTCGATATTTGTCGAGAACTGATTCT GAGAAAGTGTTCGGGAATACAGACAATCCATACCAAGGAATCATTCGGGA GGTTTGGAAGAACACTCCAGGCGAAGAGCTGGATAAACTGGAAGACAACC CTGACTACCCGAACAACCCGACCACTATCGAAATCATCGAGAACTTTGAT GCACCTTTTAACGTTGAATCGAACTATGGTTCCAAACTGAAAGGCTACTT CATCGCACCTGAGACAGGGAATAATACTTTCTACTTGTCGTGTTCTCGCG CATGCGCTTTGTACTTGAGTAAGGATGAGACAGGCAAAACAAAGCAGAAG ATCTTGACGCTTAATAAACCCACAGAACATAACGTTTGGAATAAGTAAGT ATTAATGTTCTTTGTCAGGTTCAGCGACTGAAATGGTAATCCTAAAGCTT TGGCTTTACGAAAGTTATTAATCGCCCTCATGTTCCAACGGGGATCAAAT GGTATAATATACTACTCGATTAACTTCAATTGAATCATACTCAACTCATG CGAAGACTTTTAAGGAAAAGTAAGTGGTACTTTTGTCTATTTGAACTCCT GCTTTTTTGTGTACCATGAAAACTAAGTCACAGCTTCCAACCTTAAAGTT ATATTGGGTACACTGACAGATGAGTGAATCATGAATTATAATTTCAGGTA TGACAACCAATCATCGGAGGCCATCTTCTTGGTAGCGGGGAAATATTATT ATTTGGAAGCCATTCAGAAGGGCGTCGATAGCAGCGATTCGTTGAGTGTG GGCGTCAAGTTACCAACAGGAAGATATCAACGCCCTATCAACAAAGAGAA CTTGCAGTGGAGACTACCTGGTATGTGAAACCTCTTTTATAATCTGCATT ATAATTGTTCTCACTGTCGCCCCTCTTTTGTATGAGCTTGCAGTAGCGTA GACAGGGGTGAAGAACGATCTGCGTAGGAGAGCAGACTTTTACGACAAAG CACTTACGTGGTATAAAATCATATTTACTTTGTCGTTTAAATCTGCTCTT CTAAGCAAATATTCCTTAACCCCTGTCTACGCCTCTGTTAGTGGTAAAGC TTGTGATTCTGTCCTGTGCTTCCCTATGAAGATTCTGGTTGGTGCTAAAA GATTGTCATTTCATTGTATTGACTCGTATTGATTTGGTAAAAACACTTTT TCATCGCTTCTTATATTTTTTCACTCCAGGCAATCCACACGCAGGGCTTG TACGTGAAGTATGGTACAACATCCCTGGTTATTCCATCGAAGATTTGACT TCAGATTCCAACTTCCCAAATCGCCCTTCATCAATTGAAATCCTTGATAA GTTTGATGCTCCTTTTAATTATGAGGATAACTATGGATCAAAGGTTTCTG GATATTTCCACGCACCTTCATCAGGCGAATATACTTTCTACATGGCCACT GACAGTAGTGGTGAGCTGTGGTTGAGTAGTAATGAGAATGCAGATAGTCT GAAGAAAATTGTCACCTTGAGCAGTTGGACTGATCATAATCAATGGACAA AGTAAGAAAATGCTTAATTCATACATCATCGATCTTTCTTCTGTGTAAGG GTTGACCTATACGGACGTTCCTTTTCACTCCGGAAACATTTACAATCTTT TAAAAATAAATTTGTAAGACACGATACTACATCAAAAGCCCATCAAAAGT CAAGTGTGCGTACACAAATGAATCCATAACACTCACTCGTGTTGGGAACC AAAGTTCTCGAATGTTCCTTCAAAGACCCTTTAAAAAAAAGATATTATTT TACACTTCTGTGTTCTGTAGGGTATCTGGAGTTACCAAACACTAAAAACT TTTCTTAATCAACCATAGATATCCTGAGCAGAAATCTGACAAAGTGTTTT TGGTGGCCGGAAAATATTACTACATTCGGCTGTACATGAAAGCAGACAAG CTGGGTGATTGTGCTTCAGTGGCTGTCGAAATGCCTGATGGAACTTTCGA GGGACCAATCAAAAAGAAGCATCTATCCTGGAGATTGATTGGTTCAAATG AAGGGCCTGGACCCAAAGAAGTTGTCGAAGGTCCGTATAAATATTTAGTG AAAATTGTCAAGTTGACAATTTTGTGGGTGTTTGTTATAGGCAAAGTATA ATTTAGTATCATCTGTTTTTTCCAGAGTTACCTAAACCAGTTGGTTTATA CCCCCTGAATGAGAATACGCTGAAAGACATGATCACAAAAAATGTCGAGT TGAAAAATGCTGAAGTCACAAAGGGACCTGGAGGTAAGTGATTGAATTAG ATGCGATATTCATTTTACCCAAAGTGTTTCTTAATTCCATGTATTTTCAA TTTGACGTCATTCAAATAGGGTGGTCTCAGCCATGCGAATAGATTTCGTG GCTATTAAATAAAAGTTACATTTTTTAAATCAACATTTCTCATTATAAGC AAAAAAAGTTACAATAGTAGTTTAGTAAATCATTCCTTCGTGTTAGTGAT TTCATATCAGCCAATCAGGTGTCAAAGAAATGTCTTTCCACTTTAGATCT ACCAAAGAGCGCAATCGAGTTAAAGGGAAGTCAATCTTCATACCTTGAAA TTGCTAATAATGGAAAACTAGATGCTCGTAAATCAATTACAATTCTCACC AATATCTTTCCAACGGGAGACAATGGTCCTATTGTTGCTTATGACCCAAT GGGAAATGGTGTTCACTTATGGCAGTACGATAAAACACAATTGTTCGTCC GTTTTACTTTACGTGGCTCGAATGGAAACATGACATTGGAACCATTAGCT ACACGTGTTTTGCAGGTAAGACATGTGTTCTAAAAAGTATTCGAAAGAAG TTTGGAGCTGCAACCATGGTCGTAATATTTGAGAAACAATGGAAATTCCT ACGAAATCTTATAGCCACATTCGATTTGGNTCATGGTCGTAATATTTGAG AAAAAATGGAAATTCCTACGAAATCTTATAACCACATTCGATTTGAAAGC GCTCTAACTTAGGTTGGAGTTAGGTTAGGGTAGAGTTTTAACTCTGAGTT TTAACATGAGACTTAACACTTAGGACCTTAGGATCTCAGGATCCAAAAGT TCAAAAGTGGTCCAATAAGGCTCATAATATAGCCTGGAAGTCTATAAACC CGTACCTAATTGAAATATCCGATTAAATTTAAGAGATATCCCAAAATCGA CTTTCTCGCCCTAACTCCAAATTTCGAAAAACGAGGAAATAAGCTTAATT CTCAATAGATTTTGACCATGATTGTGTTCTGGAACTGCTCACAAATTAGA TGATCCTAGCACCCCCGTGTCACAGACCCGTTGGACCCCACCCTCGCCGC AAAACCACTCTTAAATCTTCCTTTCTGGCGTTTTTGAACTGGAAACAATA GATTTTCTATCCCATTGGGATTTCATAGAAATTTTTATCTCCACCGAGAG AAAAGATTCCACCGAGGCTGTGAGACAGGGGTGTATCCTACAGCACAAAC TTGTGTTAAGCGAATCAAGTTTTGTCCGCTTTTCTCGCTCGCTTTCAACT TCTCGTTCCTTCATCCTCAGATGAAAAAGTGGAATCAAGTTGGTGCTTCA TACGATAACAACACAGGAGTTGCCCAATTGTGGCATGATGGCAAGATGGT CAAAAGTCGAAACATCGGGCAAGTTGACTTGGCAACCGATCAAAACATTC GTATCGGTGCCGTACAAAACGACAAACGATATTTCGAAGGGAAAATCTCA TGCTTACAAATCTACGATATCGCATTGCGAGAGAAAGAGATCGGTGAACT TCGTGTTTGTCCGAAAGCAAACCTTAAAGATGAAAAGCAGGACGCAAAAT CTGCAGTTAACAATACGCATAATGCAGGTAGGTGTTTCAATCCAAATACC ATATATTTCAATCAGTTTTTTATTCTTAATAATATTTCAACTTCTGATTG TCAACCATAAACATCCATTTAATCTACAACCCATATTACCCAGACTTTTT ATATCACACGACTCGTTTGAGTTAAGTAGACGTCTCCATCTCCATATAGA GAGTCTCCATTGCATTTCGACTTACTGCTGTCAGTCATCCATTATATCCC AATGTAATTCACGCAGACTTTTTATATCATACCATCATATATTCTAACAT ACACTAACCATCCATTAACACTTTTCATTCACAACTGAAGGAGTGAGCAA GTCGAGCCTTCCAGAGGCTTTGTCAAGTTTGGATGCAGATGTGGCAAGTG GAGCCTCAGAGTGGTTCGATGAAGGTAAATGATATAAATTGACAGACATG TTACCATATATATGGAGACAAAATTGACAACAGAAACAGATATAGTGAAT AAGAATTTAATGACGTAACTAATATAAGTAACATATAATCTACTGAGTAG ACCCAAATCATTTTGAGTAAAGTTATTCTTTGGTATATTGAAATTGAAAC AACACTTTTTTGTTTCCATAGCGACGGAGGCAGGAGCAGAAACGCGGATA GGTGATGAAACCGAAGAAGAGCTCGTCGGTAAGTCTCCATCTTGTAAAGC CTTTCAATCAATTTATATTCAAATATTTCGTGTGTCCCTTTCTTCAATTC ATCCTAAANATCTTGTAAAGCCTTTCAATCAATTTATATTCAAATATTTC GTGTGTCCCTTTCTTCATTTCATCCTAAATAAAATGAAAATGAAAATGAC GTTAAGTGCTAACCCAATTCTTCTTTATCTGTGTACCAACAACTACCGAC GAACAATTAAAATTCAACAAAATTACAACTATAATACGTACGCATTGTAC AAAGATTACGTCATAAGCACAATTTCCTTTGTAAGTGAAGTAAAGAAGGC ATCATCAACGGCCATCATACTGTGGACCTCTTGCGACCAAATTGACATAG AATTTTATACATACCATGACATAGAATTGTATACCATATAGACGTAAAAA TGTTCACTTTGAAGTCATCCACCGAACACAGCACGAGCAACAACAACAAC AACATAACACAACAAACAATGACAAAACCATGACAGAAAAACACAATTAC GAATACAAAATATATTCACCATGAACTTTTATTCATCGATTTTCGATTTT TTTTTTTTCAAAATAGCTGAAGACGCAAAAAAAGAAGGTAAAACATCGCA CCCAAAAGTCACGAGCAGTGCCGGAAAACTATACATTGTTTAAAAATTTG AAAGCTATCAATCCTATTTTTAAAATAGCGTATAATTCATGTAGTGCTAA GAAGCAGAGGAGGTGTGGAAAAAGAATGTTATAGGTGTAATATTAGTTTC ATTGCATCCCATAATGTAAGTCTCAATGCGTACATGGTCAAGTATTTTAT CTGAAGCCTTTCTACCTCGAAGCCTCGTTTTCATCCATTTTCTCTCTTAT CACCATAGCAACACGTTGCCAACCGAATCCATGTTCGAATGAAGGGGTTT GTCAAGATGATGAGAAAAAGATTGATGGATATGTCTGTATGTGCCCTGCT GAGTTCACCGGTAGACGTTGCCAAGGTAACTGATCATTCTATCAATAGTT ATCTTTTGTCTCATATGTAAAAACAGATGAAATTTGGATTATTCCATAAA TCAGAGTCTTAGAAATATAACTCATTTTGTCGTATGCTCCGAATTTGAAG GTTAGAATCAAAACACGTCCGATGCCTGAACATGGCGTTACTTCTCTTTT CAGTTTCCAAACAGAGGGCCGAGAATCCAGTGGTGAAACGAACGGCCATT CCCACCACCACCGTCACCAATGACAACACCACCACCAATTTGCTTAATGC GATTACCACAAACCCCACTAACGCTTCAATTGCTGGTACGTAACATTTGA AATTTTTCTATAATTGCCATTAAGACTAATTGCTCGGTTACACTGGCCGG CTTCACTTTTTAACAGAAACTGTTGTTATGGAGAAATCCGCTCAAATGAC ACCTAATCTTATTAAGGTCCCATGTTGTATAATAATTTGTTTTAAAAATT TACAGTACAGTATATTGCCTGAATATGAAGGAACGTTCACGAAACACCGT GTATTAGTTGTAATCTTTCAATACTGTGATTTCAGAAAATGTCACAAAGA GCGATGAAAGCAAAGAAGATATTTCACTCTTGTATCAAAAACTTGGTTGC TATAAGGATGATCCTTCAAACCATGACCTTAAGACCAAAGTTGATTTAAA GCGAACCACACAAGAAGACTGTGCGAAAGCTTGCGCAATGGCTGATAAGA GCTACTCTTACTTCGGCCTTCAAAATGGTACCTCGTGTTTCTGTGGCAAA GACCATGGGAAGTATGGTAAATTAGGTGACGAAGCCTGCAATATGACCTG CAATGGCAACGAGGCTGAAAAATGTGGTGGATCAGAGGCTAATAATGTCT TTTTTTATGGCTTAGGTAAATGAGACTTTTTAAAAGTAAAATGTAATGTT CTACTTTAGATCTTGTATAACATCATCTTTCTGTGCATACCAAAAATAGG CGTTTGTTTGAGAATTGTAAGCTTTGAACGTTTCATATTCCAATATTTCG AAGAACTTACCTACAATAACGCAATACCACCCAATACAATACTTTTCAAT TGATACTATTAAACCAAGATTATTTAACATTTTCCACTTTAGGCACCAAT TACACGGTGAAGACATTCACAGGCAAACCCCTGGGAGCGGGTACTGATGC CAAAATTTATTTCGAATTGGTTGGCGATCGAGGAAGCTCAGATTTCCGTC AACTCGACCCCAGTCCCGCTAAATATGAACCTGGAAGGTTTGTACCAATT TCTCATCGCTCTTGTAATTTATTTCGATCAATTTACGAAAAACAGAGAGA TTACAAGGAGTTAGTTTGAAATTCTCATTCGATTGGTTGCAGTTAGTTGA GACTTATGCTTGTTTAGATTTTAACCAAAACTGATCTAAAACGAAAGAAA TATGATCTTCATTTTCTCTTTCTTTCAATTCTAGCGAGGACATTCAAACG TTCTTATTACCGGATCTCGGTAAATTGAAACGGATGAAGATTCTCCATGA CAACACTGGAACAGCGCCTAGTTGGTTCTTGAAAAAGGTAAGTAATACAT CGAATTTCACTGGTGGACCTTTGAGCCGAAACAAACCTTATTTTTTGAAA GATAGTAAGATTAGTACTAGTAATCGTATGGTTTGGAGTGCAATTAACGA TTAAACAAAGGAGAAAATAGTAATTTGCATGAGTCCGAAGGACGAGTGCA AATTACGGTATTTTCTCCTTTGTTACGAGTGATTAATCGTTAAGGTGGTC GTTAACAAACTTTTTGAAAATGTCAAAAAATATTCAAATTGAAATATCTC AAAATGTATAAATGATATATTGTTGAAATTTTGTATGATGNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGAGCACTTTCACT TTCACTTTTGCGAAAACCCCGAAATACACCAAAATCAACTATATCACTAT CAAAATCCAACTAAATGTGTATGGATAGCTTCAAGATGAAGTTATGGACG TTTTAAACAATAAATTATCAATTAAATAACTAAAAAGAGAGAGAAAACAG AAGAAACATTACACGTACCTGTCACGACATTGTGTTGCGCTGAAATTTGA TCCCAATGGGAAGGAAATTAGAAAGTTTATCAAGTAAAAATGTTCCTTGG AGTTTTGAGAAGCTCTTTATATAAAAAGGAAGCATCAAACNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNATTGTTTAGCAAGGTTCAAACTTTAATTTAAACCC AAAATTGAAAAATCGACCCGAAAAAGATGATCCTATCTCAGAAGTGTTAA CGACCACCTTAATTGCACGACAAAACATACGATTCCGAAGTAATTGTCAG TAGAACAAAGTCTCTGACACAGGACTTGGGAGAGAAAAGAATAAGGGGAC AAAAGTGTCCCCCCGCCGAAGAGTGCAAAAAGTGGTAATAGTGCAAATAA CGATTAATCGCACTCCTCTAAACCAATCAGATTCGAGTAATTTTGCATGG CTGACGATTACCTCTGTAAGCGAAAGTACGATGCAGATTCGATGCAGGGA GTTTTGAATTTGAGAAATCTTTAACTTTCCAACGACGAGACGAACGTTTC CGAGTAAAACTAGACAAAACTTAACCTTGTAATAAGGCAAAAATAGACAA GATCCTAGAACTTTACTCTTTTCTCCTTCCAGGTACAAGTGACGGACGAA GAAGGTGGTTCATATGAATTTCCGTGCGATGAATGGTTAAGTGATACCAA GGGAGGAGGGAAACTTGAACGAGAACTCATCGCTAAATCGAACATACCAA CACCAAGTTGAAAAATATCGACTTTGGAATGATTTCAAGCTTAGATGAAA TGAAACGATCATCAATTACAAGCTTATGAGTACTGTGGCTGAGAAGAGGC TTTGGATCGCGTAAAGTCCGCCATTTATCGAAGTACATTTTATATACAAA AGCTTTTTTCGTACAAAAGGGACTTTTCTTGACCCACGCATCATTGAAGA GCTTACGAGTCCGAAAAACTAGAGGATTTAAGACTTTTAGTAGCTCGAGA CTTTAATAAGGAATATTTTTGTAGTGGGATTTGTAATATATTATGCTTGT AAATATTAAATTTTATATAACCGCTTTATTTATTAGATGATTATTTCCTA TTGCGTCGTTGTGCGTANCTTGTAAATATTAAATTTTATATAACCGCTTT ATTTATTAGATGATTATTTCTTATTGCGTCGTTGTGCGTAGATTTGTTTT CCCACTTTCTATTATTGTCTGGTAGGGTTAGAAAGTCGTCAAAGACAATT AAAGCACATAGTGCCTGTCTCATCGGCCAATCCTTCTCTCAAAGTTAACG TTTGAAAGGTCTTTAATCTCTCTATTTTGAGTATAGCTCATTTTGGGCCC GTATGTTTTGAGAAACCTCGGGATTTCAAGCTTAGCAATTTTTGTATTAT GGAGAAAAAGTTTTAAGATGTTCGAAGTAACTCTTTTTAACAGCAAGGAT ACCTCTCCTCAAACGCACCGCTGGAAAACCAGGTTTCCTGTCATAAAAAA TTAGCAAGCTACAAGAGAATTTTATCCGTATAGGGTATAGTGCGTTTTTA GTTTTTATACACGGGCTATTTTGTATAGGGAATTTCAATGTTTGAAAAAA GACATTATTTTTGAAATCTATTTGTTTATTCACTTTTGACATTGGTACAT GCATCGACTGTGTGCTTTCAAGCAATGTCGGAGATATCCTTTGTTCCTTC TGCACTCAAGGTAGTCCATAC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000652XLOC_000652Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001200-exon-sc0000007-1575043694:997195..997379TCONS_00001200-exon-sc0000007-1575043694:997195..997379Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:996289..996452TCONS_00001200-exon-sc0000007-1575043694:996289..996452Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:992765..992975TCONS_00001200-exon-sc0000007-1575043694:992765..992975Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:991394..991519TCONS_00001200-exon-sc0000007-1575043694:991394..991519Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:990993..991207TCONS_00001200-exon-sc0000007-1575043694:990993..991207Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:990383..990726TCONS_00001200-exon-sc0000007-1575043694:990383..990726Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:989934..990100TCONS_00001200-exon-sc0000007-1575043694:989934..990100Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:988886..989786TCONS_00001200-exon-sc0000007-1575043694:988886..989786Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:988410..988582TCONS_00001200-exon-sc0000007-1575043694:988410..988582Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:987729..988050TCONS_00001200-exon-sc0000007-1575043694:987729..988050Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:987200..987411TCONS_00001200-exon-sc0000007-1575043694:987200..987411Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:986997..987104TCONS_00001200-exon-sc0000007-1575043694:986997..987104Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:986465..986733TCONS_00001200-exon-sc0000007-1575043694:986465..986733Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:985403..985709TCONS_00001200-exon-sc0000007-1575043694:985403..985709Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:984752..984808TCONS_00001200-exon-sc0000007-1575043694:984752..984808Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:983755..983871TCONS_00001200-exon-sc0000007-1575043694:983755..983871Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:983445..983576TCONS_00001200-exon-sc0000007-1575043694:983445..983576Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:982865..983194TCONS_00001200-exon-sc0000007-1575043694:982865..983194Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:982493..982637TCONS_00001200-exon-sc0000007-1575043694:982493..982637Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:982193..982295TCONS_00001200-exon-sc0000007-1575043694:982193..982295Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1575043694:977859..978947TCONS_00001200-exon-sc0000007-1575043694:977859..978947Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:997195..997379TCONS_00001200-exon-sc0000007-1510915933:997195..997379Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:996289..996452TCONS_00001200-exon-sc0000007-1510915933:996289..996452Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:992765..992975TCONS_00001200-exon-sc0000007-1510915933:992765..992975Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:991394..991519TCONS_00001200-exon-sc0000007-1510915933:991394..991519Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:990993..991207TCONS_00001200-exon-sc0000007-1510915933:990993..991207Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:990383..990726TCONS_00001200-exon-sc0000007-1510915933:990383..990726Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:989934..990100TCONS_00001200-exon-sc0000007-1510915933:989934..990100Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:988886..989786TCONS_00001200-exon-sc0000007-1510915933:988886..989786Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:988410..988582TCONS_00001200-exon-sc0000007-1510915933:988410..988582Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:987729..988050TCONS_00001200-exon-sc0000007-1510915933:987729..988050Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:987200..987411TCONS_00001200-exon-sc0000007-1510915933:987200..987411Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:986997..987104TCONS_00001200-exon-sc0000007-1510915933:986997..987104Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:986465..986733TCONS_00001200-exon-sc0000007-1510915933:986465..986733Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:985403..985709TCONS_00001200-exon-sc0000007-1510915933:985403..985709Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:984752..984808TCONS_00001200-exon-sc0000007-1510915933:984752..984808Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:983755..983871TCONS_00001200-exon-sc0000007-1510915933:983755..983871Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:983445..983576TCONS_00001200-exon-sc0000007-1510915933:983445..983576Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:982865..983194TCONS_00001200-exon-sc0000007-1510915933:982865..983194Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:982493..982637TCONS_00001200-exon-sc0000007-1510915933:982493..982637Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:982193..982295TCONS_00001200-exon-sc0000007-1510915933:982193..982295Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1510915933:977859..978947TCONS_00001200-exon-sc0000007-1510915933:977859..978947Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:997195..997379TCONS_00001200-exon-sc0000007-1491911889:997195..997379Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:996289..996452TCONS_00001200-exon-sc0000007-1491911889:996289..996452Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:992765..992975TCONS_00001200-exon-sc0000007-1491911889:992765..992975Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:991394..991519TCONS_00001200-exon-sc0000007-1491911889:991394..991519Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:990993..991207TCONS_00001200-exon-sc0000007-1491911889:990993..991207Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:990383..990726TCONS_00001200-exon-sc0000007-1491911889:990383..990726Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:989934..990100TCONS_00001200-exon-sc0000007-1491911889:989934..990100Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:988886..989786TCONS_00001200-exon-sc0000007-1491911889:988886..989786Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:988410..988582TCONS_00001200-exon-sc0000007-1491911889:988410..988582Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:987729..988050TCONS_00001200-exon-sc0000007-1491911889:987729..988050Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:987200..987411TCONS_00001200-exon-sc0000007-1491911889:987200..987411Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:986997..987104TCONS_00001200-exon-sc0000007-1491911889:986997..987104Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:986465..986733TCONS_00001200-exon-sc0000007-1491911889:986465..986733Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:985403..985709TCONS_00001200-exon-sc0000007-1491911889:985403..985709Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:984752..984808TCONS_00001200-exon-sc0000007-1491911889:984752..984808Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:983755..983871TCONS_00001200-exon-sc0000007-1491911889:983755..983871Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:983445..983576TCONS_00001200-exon-sc0000007-1491911889:983445..983576Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:982865..983194TCONS_00001200-exon-sc0000007-1491911889:982865..983194Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:982493..982637TCONS_00001200-exon-sc0000007-1491911889:982493..982637Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:982193..982295TCONS_00001200-exon-sc0000007-1491911889:982193..982295Clytia hemisphaericaexon
TCONS_00001200-exon-sc0000007-1491911889:977859..978947TCONS_00001200-exon-sc0000007-1491911889:977859..978947Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:977859..997379 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0.00900305 0 0.32024 1.34302e-07 2.44441 2.72666 1.58278 1.7762 0.932293 0.472174 0 0.148658 0.376222 0.945684 2.05923 0.862422 0.583443 0.0634898 1.07213 0.890159 8.76881e-06 2.29616e-08 0.88143 0.385928 0 1.52602e-09 0.000177877 0.242764
Blast
BLAST of TCONS_00001200 vs. Swiss-Prot (Human)
Match: NCAN (Neurocan core protein OS=Homo sapiens GN=NCAN PE=1 SV=3)

HSP 1 Score: 96.6709 bits (239), Expect = 1.093e-19
Identity = 55/146 (37.67%), Postives = 75/146 (51.37%), Query Frame = 2
Query:  164 LCKMKTESCPSEWNNLKLNSVVGCYKLFNDDTTWEKAEQRCKAENAHLASVASEDEQTMIYQF-HSSTSYWIGFNDRENEGDWLWSDRLTSSYTNWADNAPNN---GGYSCASV--GKSGKWHDGKCNEKLNVVCKKK----GPKP 571
             C+  TE C   W+  + +    CY+ F     WE AE+ C+  + HL SV S +E + I  F H +T  WIG NDR  E D+ W+D     + NW +N P+N   GG  C  +   +SG+W+D  CN  L  VCKK     GP P
Sbjct: 1080 FCEKDTEGCDRGWHKFQGH----CYRYFAHRRAWEDAEKDCRRRSGHLTSVHSPEEHSFINSFGHENT--WIGLNDRIVERDFQWTDNTGLQFENWRENQPDNFFAGGEDCVVMVAHESGRWNDVPCNYNLPYVCKKGTVLCGPPP 1219          
The following BLAST results are available for this feature:
BLAST of TCONS_00001200 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
NCAN1.093e-1937.67Neurocan core protein OS=Homo sapiens GN=NCAN PE=1... [more]
back to top