Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000652 (gene) - C. hemisphaerica

Overview
NameXLOC_000652
Unique NameXLOC_000652
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000007:977859..997379-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000652 ID=XLOC_000652|Name=XLOC_000652|organism=Clytia hemisphaerica|type=gene|length=19521bp|location=Sequence derived from alignment at sc0000007:977859..997379- (Clytia hemisphaerica)
TATAGAAAAGAACGGTTTATGGAGCTGGACAGACAGCAGTCGAAGTATTT ACACCAATTGGGGTAAAGAAGTGGATAATAAAAACAATAGACATGATTGT GTTTATATCGATCAAGAGGAGGGCAAATGGAAAGATGGAAATTGCACCTC ATCAAAACCTTTCCTCTGCAAAATGAAAACAGAATGTAAGTGTAGCTCTT ATTCTTTTGCACTTTGCTTTGTAAAAAATTACTGGAATTTCCAAAGGTCA AGGCATGGTTTAAATGTGTATGAGGTTCAAGATAATAAGATTTCCCTTTA AAAAAGTCTGTTTTCAGTTAGATCAGCTTTGTTTGTGATATCTGGGTTCA GCACAATGGATTGTTGATCGAGTTCATAATGAAAACTACATCGTCCACTG TCCACTGTTTCCAAGTGAAGTGTTGCAGTGTGGTTGACATTTTATCATGG TAACAATCAGAAGTTTTCCCATCAAACAAAGGGCATCAAAAACATGATTC GTCACGAAGGCGCTTTCATAGAATGTTATTCTACACTGTTTACTTTTCCC AACTATTTGACAACCTGATTAGTAAATGATTCATACTTCGAGAATGCACT TGTCTATTTACTCTAAATAAAGTCTAACGATGCGGTAGTTTTTATGTAGA CATAAAAGTCGTAGCTTTGTATATAAGAAAGCGTTGTACATGATCCATTT TACTCCATATGCCCCGAGCTCAAAGGACTACCTGATAAGCCATTTTATCT CACGCTACGCTTTAGTGACAAGTAAAGTCCAGTGCAAAATATCACTTTAT TTTTTTACACTATTACAATATTACTATCTGGCATGAGGATCTACCTTCCT CCTGCTGTAGACGCATTCTACAATCTGAGTTTGAGTAATCTGTGTTTTCA AACGTTCATTTTGATTCTCTTCTATAGCTTGTCCATCCGAATGGAACAAC TTGAAATTGAACTCTGTGGTGGGATGTTACAAACTGTTTAATGATGATAC CACATGGGAGAAAGCTGAACAACGGTGCAAAGCTGAAAACGCTCATTTAG CAAGTGTGGCCAGCGAAGATGAACAAACCATGATTTATCAGGTAAATCAA CCACTGCTGACTCTTCCGGTCTGGTATCTTCAAAGTTCAAAGCACAAAAT AAATAAAAACACAACATTCTGCAACATTCTAAAACGTACGAAGAGAGTTC GAAATGTTAGCAGCTAACTGTAGGGAAAAATTTTCTCAATGGGAAAATGT GCCGGAATGTCAACCCTATAGGAAAAATATGAAAAGTGTTATAAACTTCA ACAGTTTTGTACCATTTCAGAAACCCTCGATCAAAAATCTAAAGAATATT CATAATTCAATCTGTTATTTAGCTTGGTCATTGAGATAGGGGTGTAAAAG ATTCTAGACTTTTGGTCCTTTATCGTGCTGTCAAAACCTCATGTTTGAAA TACTGTATAGTAGTGATCGACTGACATTGGATGATTAATGCGCTTAATCA GGTTTTACACTGACATGCGACTCTCCTTTCTCTATTAAAATCATACATTA TCTGTTGGAAAAGCTCAAAGAAAAATGAAATTAGCACACAAATAACAAAG AGTCGACCTTCTGAAAAGGAATAACTTGTACAAAAACCTTCAAGGAATTT TAACAAGTGTTTACCAACTTTGTGATACTTCCGAAATCGATTAAAATTTA TATATTTGAGAAGTAAAATTTACCATACAGTCCTAAATAGCTTATACAAT TAGAGCATCGGGTTTTATCAATGTTACTGTATAGCACTAATCCACTTTCC TGTGGTGGACCACTTCTCTTCATACCTACCACATACTTGCGAGGTATTTG AAGGCTTAAAATGAGATCATCTGTTTACAAAAGACCTCAACTTTGTTTTC ATTTAGTATTTAGTGACGTAGAAAACAAAGCAGTATTTGCATAATGGCGG AGGGGGTAAAGTTTTGTGACTTGGGGCAATTTGAAAAAAATTAAATCCTA CTAGGTAACTGGATTGTTCCTCGACGGACGAAGAAAATGGTCAACCGGAT GTCTCCCCGAACTGACATTTCCGCGAACTGACAACCAGTGCCGGATATTT CCCCGAATGGATGCTTAATAATCCTCTACTCTACTACACTCTTCCTGGAA AATGCACCTAAATGTACAAAGATTCAAGCAAAAAATATTTAATATCTGAA AAAATTAATCTCCCCTCCTCAGTTGCTAAGACACTTCTTGACAAACGTTC TCACTGGGTATAAGGAGTATTGTGTGTTCTAAAATTTATTTCGCTAAAGT TATTATTGTGTATGAATTCTAATATGTACATAAATAATAATGATGTAAAA GTTACAAAAGATGAAACCAGGAAAATAAATAAGATGTTATTATAAAACTA GCAATATTCATGGAACTTGCACGCCACACGTAAACCAACGAAGAGAGCGA ACAAGAAGAAGAAGACTCCGAGAATCATAAAACAACAACATGTCTCTTTC GATACACACCGCCCGTGAACATTCCTGTTTTTACGCGCCCTGATGATAAA CGCCACGATAACGCCAATGGTGATAACCACGCCCAAACATACGCTCAAAA TAATAAGAAGTGTATATTCAGTGTCTTGCCTTGCTTTTTCACATTGGTCT CCATAGAAACCTTTTAAACATTCACATTTGTATACAGTCTCGTTTACTTG TAGACAAGAAGCCTCGTTTTGACACAAATGATCTTCGCACGAGTCATAAG TTTTACATAAAGGTAAATGGATTTTCGATAACTGTCTGATATTCCGTCCT TTGAGACGGGGTGGTGTTGCGCAATCACCTTGGAGTTCACCTTTCATGCG GAGGTCGATGATATTCCTGTGCATAAGCCAACAATCACATACTAACGGAT TTCCTTTCATGTTTATTTTGCCAAAGATAACCAGACTTGAAAACACATTA TTTCGAATGGCTTTTAAACGATTATTTTGCATGTCTAAAACGTGAATCTT TAAACCTTGGAAACTACGGTCATCCAAAGTAGATATGAAGTTGTCTTTCA GAATGATGTCAGTTAAATAACGAAAATTATTCATCACTCCTTTACGAACA CGTTGTAACTGATTATGAGCTGCGTTGAACTTTTGTAACGAGACCAAACC GTTGAGTACTCCTGCATAAAGAACGTCTATCTCATTATGATCAAGAAATA GCCTCTGTAAACTCGTCAAGCCTGTAAAAGCATCAATGGTGACTTTATGG AGCTTATTTCTCGACAGGTATAAAGTTTTTAAACCATGCATTCTCGCAAA CGAATAGGGCGCCAAATATGTAATATTATTCCGTGATAAATCCAAGTCTG TGAGATTGGGCAAATCCAAGTTTTGTGGAATATGTTCTATATTGTTCTTA GTTAGCGTCAAGTGTTTCAAACTGAATAGATTCTTAGACATGTTCTTAGG AAAGTTCTTTATGTTGTTCTCATCTAAGAATAAGAACTTCAATTTATGGA AACGCCTGAATAATACAGGATCGAAAAGATGAAGGGAATTCCGTTTCAGA TTGATCAATTCTGTGCCATTTTCACATCCCTCCAAAGCTGTTGAAAGCTC TTCATCTGTGATATTCTTCTCTGATAATCTACAGTCTTTGCTCCAAACTT CAATTAATAAAAAACTTGAAATCAAAAGCAAAACCATGTACAATTTCACA CAAAACATTATTGCTTTTCTATCATATAACCTCTGCAGAGATTCTTCTTG TCACAGTTTGTTCGTGTCTTGGTGTTCGGTCATATTTTCTTTGTCTGTGG TTGGTGGCCTTTCGGAAAAGTTGTTTTATACACGATACTGTAATGTGTAC TCTTCCGATTGTTTGTGTTTCAATCTCTCCATCTGACTGTTTATTTTGAT GAGCTTATCCTTTCACTGTAGTCTGTCAGTTTTTCTCATTCTTGTGTAAT GTTTCTTTCTAAATCACTTATCAAAACATCAGTTTAGTACACTCCGTCAC AGTAGGCTTTCTCCTCAAAACGTTTTCAAACTCTCACAGTATCTCCAGGC GTGATAATCAAGTAACTTGAAAGTACTTGTTAGCAGAACAAAGATTCCTT TGTTCATCCATATAGTGATATGCTTACATGAACTTTCGTAGGTACAGGTC AATGAAGAATGGACTGTTTATAGAAACGCGACTTGTCTATAAGAATATTA TCATAGTACTACTTCCTGTCAAGTTTCCCCCGGGCCCCGGGTACTTAACT ATGATAATCTATGGGCAAGTATTCTTTTAAGGTGGGGTTGCTTTCTCTAA ATCCAAAGTTTGGATTATGAAACTTTTTCACATACATCCCTTGCACCCTG AAATCTTCACGAAATTCCTGACATTTTTTGACAAAGTCTCTTTTCCTTTT ACAGTTCCACTCGTCCACCTCTTATTGGATTGGATTTAATGATCGCGAGA ACGAAGGTGATTGGTTATGGTCTGATAGGCTGACGTCATCATACACCAAT TGGGCGGATAATGCGCCAAATAATGGCGGATATAGCTGTGCGTCGGTTGG TAAAAGTGGGAAATGGCATGATGGGAAATGTAACGAGAAGTTGAACGTGG TCTGTAAAAAAAAAGGTTAGTGGTTCAAACGTACATCAAATGGCTTGTTA AAAAACCTTGATATCTTTTCCCTTCTAAAGTAAATGAAGTTGCTGGCTGC CAGAGTAGGATGGATTTCGTAGTTTTTGCACTATTAAATGAAGTAAGGGT TTTTCAACGAAATGGTTGGATATTCCGAACGTCAATGAAAACCCCCCAGA AGGAGGGCTGGTAACTTTTGCTAAGATTAGGCGATGAGACAGTTAGATGG ATATTCCCTCTAACGACAGGACATTGTTTTGTTTACTTCTCTTCAATTGG CATAAACAACACCATTAACTGTCTAACTTGTTTCCAATCAAAACTCATTG AATATCGCCCATTTCAAAATGGTAGATCTCGTTACCATGGTGACATAATA ATCGTTACGTCATGTAAGTTGTGACAGTAATTTATTACGCGTTTTTGTTT CAATTAAAAGATTTAGTTAATCCGTGTGTAAATTTTGACGTCGGACTTAG ATTAACGACCACACCGTTATTCGAAAAGAAATATAGATTTTGACTCATCT TTCGTTGAGTCTTTCGTGACTCAAACTGAAAATTAAAACCATCAGAAAAG TGCGCTCGTTCGATGATTTTGATAGATTAAATTTTGGTCAAATATTTTTC TCCTCGCTTTCTTTTGTGGTTTGCTTAGGCTGACCTCCTTTATGACAAAG CGTGCTTAGCGGCCCGAATTGAGCTGTTTAATAAACCTCAAAAAGATGAT CGGTCTACAAAACACATTTTCAGGCTGAACTCATATACCAAAGCGGCTTT TTAAAGTGGTTCTTTGGAGTTTATATATGTCACAGGGATTACACGTTTAT TTTTTATTAGAACAAACTATATAAGAACATACAGGCTTCGATGGCCAAAA TATTAACAACAAGTTAAGAGCATTTTAAGGCATTTTAAAATTTCGATTTT TATCAAAGTAATTCAAGATCTTCCACCGAGTGAAGAATATGTAACGGTTT TCAGGTTGGTGACCGTCAGATTTGGGTGAGTCACTGAAGTGTTTTGAACA GTCCCAATACTCAAGTGCCTTGTGATATACTATGCTATGGAAACCGAATA CGTTCTCTCAAACATTGTTGGGATTTCTCTGGATTTTCACTCAACAGTTA GCACAAGTTTAAGAAAGAAGACACGTTGAATGATCAATAGATATCATTTC AATTTTGCACCCCGCTCCTTCTTTTTCCAAAAATCTCGATTCCACCTTTT GCTTTTTCAGGACCGAAACCAGAGAAGACAGATGGTTACAATGAAGATGG TGTCTTGTTACCAGTCTCTCGTTTACTGGAGAACGACGAGACTGCACCAA GTCATCTCTATGATGATAAGGATAAATCAAGTCCAGGTTAGTGGTTTTAA TCCTGATTTTTTAGTTCAACGAGGGTAAAAATATTATTATATAACATCCA AATTCTTTTGCAAGTTTTGAAAATTTGAATAAGATTCTGTTAGTAGTGCT TTTAAAATGTATGGATTTTTTCTTTGCCCTGATTACATGCTGACTATTTT AATATCCTTTTTTCTTTGATAGTTGTACCACTGAACTTCTGGCCGCTTTT GAAAGATTCTAAACTTGGAATGGCTGGTAACCACCCATTGGCCGTCAATG AGCCACAGAACGTCAAAATCATCCCCGGAGGAGTGTTATTAGATGGAGAG CGCTCCTTCTTAGATGCTGGTGACTTCCATGGACATTGTATTGGAGATCC TGAGAAATGCAACAAAGGCTTTTCCGTTGCGTTACAGGTACGTTTGAAAT GATCTTCCCGTAAATATTATTTTCGATTTTCATAAATCTTGTTTCTTGCA CAACCTCTCTTAGGTCGTTATTGGATTTTGCAAAAATCATTTAATTAGTG TTTTGAAAACGGTTATTGATAATCATTAGAGATTTTTAGGGGGATTTTGA TCATTTAGACCTTAATTCACACAGCAGAATAAACAAAACAACAAATTAAA CCCTGTTTGCACTCCCCACACGAGACATCACAAAAATCATCATCCGCTTT CAGGTCAAATTCGATCCAGTTGTCCTTGGTTACAAGAAACCTCATTACGT CATTGATACATCAGGACGAGGCCGTGGTTTTGCCATCTACATTCAAAACG GTAAACTTCATTACAAAGTGGTCACTGATGGAGGGTCCTGGGAACTAGAG ACACGTTTGACAGTCTCGTTATGGCAAGATATCGTGTTGACGTGGAAGAA TCCATCAGGTCTACACGTCTACGTCAACGGCGCGTTCATGGATTACACGA ACATCACGAAAACTGTGGACATCAACACCAAAATGGTGACCACCACCAAA TTGTTGATCGGGAGAAGAAGTATCGATGATCGAGCTCCTTGTACTAAGTA TGTTTGTTTGTTCACCATTTTGTGATCTTTCTTTCCTCTCTCGTTAAAAT GTATTTATTGGATATTTTTCGAGTGATCAATGTATAGGATGGGGATGTCT TTCTATCAAACTTCCCTGTGGTGATTTAGCATGTGTTTCTGTTTTTCATG ACCAAGCTTCTCCATGGTATTGGCTAGATTGCAAATCGTTTGCCTGATAC AACTGGATTTCATTCGAATTACATACACGAAACTTTCATTGAAATTCGGT TCAATCTCTAAACACTTTTACTTTTTCAGGATGGCAGTAGGTTCAGTAGT TTTGTTCTTCAAACAACTTTCCGTTGAAGATGTTCCTTACGCGTTCACGT ACGGAGATACGGTGGTTGCATACACACGTTTTTTCATGACAGATATCGAG AATTCGGAAATTCCTGGCGCTGCTGAGTTTGTTGAGAAGTCTATCAGTAA GTGCATTTTGATAAAATCTGAAAATATGAAATTTATTTTTTAGAACTAAA GCTGCGTTTTCTGTCTATTTTTTAGTTTATTTTGAAAAAGATTATCTCTC TTGTTGCGACCCTTTTTTTCAAAATTCTGTTTTTCCTTTATAGCAAACAT CGATGGAGGAATATTTGTTGACGGTGACACTTCAGATTCGGTCAAACCAC ACGCTTACCTGCAACTCGAGGATTTCCCTGATGTCATCTACAACGTACAA AAAGCGCGACATGGGTTTGCAGTCAGTTTCAAAATCAAATTCGACCAACG TGACCGTGATTATAAAGAACCACGATACATCTTGGATACGGGTGGTCATA ATGGTGGAATGAAGGGTATTTCCGTATACCTTGTCAATGATAACATGTAT TTCCAAGTCATCCGCTCTTCGGATGAAGACATCATGATTTGGAAAGTTCG CGTTCCTATCTACACCATCCGTTGGCAAGAAGTGGTCATGACATGGCGCT TAGACAAAGGTTTATGGATTTACGTGGACGGCATGTTCCGCGGTCACACG CTCTCACCACAACCTCTACCTAAAGATGATCTGAGCACACCAAAACGTTT GACCATAGGACGTAAAAATTCAGGACCGGAAAAATCAGGAGCAGTGTTTG GTTTCAGTTCACTGGCAATCTTTGGTCGATATTTGTCGAGAACTGATTCT GAGAAAGTGTTCGGGAATACAGACAATCCATACCAAGGAATCATTCGGGA GGTTTGGAAGAACACTCCAGGCGAAGAGCTGGATAAACTGGAAGACAACC CTGACTACCCGAACAACCCGACCACTATCGAAATCATCGAGAACTTTGAT GCACCTTTTAACGTTGAATCGAACTATGGTTCCAAACTGAAAGGCTACTT CATCGCACCTGAGACAGGGAATAATACTTTCTACTTGTCGTGTTCTCGCG CATGCGCTTTGTACTTGAGTAAGGATGAGACAGGCAAAACAAAGCAGAAG ATCTTGACGCTTAATAAACCCACAGAACATAACGTTTGGAATAAGTAAGT ATTAATGTTCTTTGTCAGGTTCAGCGACTGAAATGGTAATCCTAAAGCTT TGGCTTTACGAAAGTTATTAATCGCCCTCATGTTCCAACGGGGATCAAAT GGTATAATATACTACTCGATTAACTTCAATTGAATCATACTCAACTCATG CGAAGACTTTTAAGGAAAAGTAAGTGGTACTTTTGTCTATTTGAACTCCT GCTTTTTTGTGTACCATGAAAACTAAGTCACAGCTTCCAACCTTAAAGTT ATATTGGGTACACTGACAGATGAGTGAATCATGAATTATAATTTCAGGTA TGACAACCAATCATCGGAGGCCATCTTCTTGGTAGCGGGGAAATATTATT ATTTGGAAGCCATTCAGAAGGGCGTCGATAGCAGCGATTCGTTGAGTGTG GGCGTCAAGTTACCAACAGGAAGATATCAACGCCCTATCAACAAAGAGAA CTTGCAGTGGAGACTACCTGGTATGTGAAACCTCTTTTATAATCTGCATT ATAATTGTTCTCACTGTCGCCCCTCTTTTGTATGAGCTTGCAGTAGCGTA GACAGGGGTGAAGAACGATCTGCGTAGGAGAGCAGACTTTTACGACAAAG CACTTACGTGGTATAAAATCATATTTACTTTGTCGTTTAAATCTGCTCTT CTAAGCAAATATTCCTTAACCCCTGTCTACGCCTCTGTTAGTGGTAAAGC TTGTGATTCTGTCCTGTGCTTCCCTATGAAGATTCTGGTTGGTGCTAAAA GATTGTCATTTCATTGTATTGACTCGTATTGATTTGGTAAAAACACTTTT TCATCGCTTCTTATATTTTTTCACTCCAGGCAATCCACACGCAGGGCTTG TACGTGAAGTATGGTACAACATCCCTGGTTATTCCATCGAAGATTTGACT TCAGATTCCAACTTCCCAAATCGCCCTTCATCAATTGAAATCCTTGATAA GTTTGATGCTCCTTTTAATTATGAGGATAACTATGGATCAAAGGTTTCTG GATATTTCCACGCACCTTCATCAGGCGAATATACTTTCTACATGGCCACT GACAGTAGTGGTGAGCTGTGGTTGAGTAGTAATGAGAATGCAGATAGTCT GAAGAAAATTGTCACCTTGAGCAGTTGGACTGATCATAATCAATGGACAA AGTAAGAAAATGCTTAATTCATACATCATCGATCTTTCTTCTGTGTAAGG GTTGACCTATACGGACGTTCCTTTTCACTCCGGAAACATTTACAATCTTT TAAAAATAAATTTGTAAGACACGATACTACATCAAAAGCCCATCAAAAGT CAAGTGTGCGTACACAAATGAATCCATAACACTCACTCGTGTTGGGAACC AAAGTTCTCGAATGTTCCTTCAAAGACCCTTTAAAAAAAAGATATTATTT TACACTTCTGTGTTCTGTAGGGTATCTGGAGTTACCAAACACTAAAAACT TTTCTTAATCAACCATAGATATCCTGAGCAGAAATCTGACAAAGTGTTTT TGGTGGCCGGAAAATATTACTACATTCGGCTGTACATGAAAGCAGACAAG CTGGGTGATTGTGCTTCAGTGGCTGTCGAAATGCCTGATGGAACTTTCGA GGGACCAATCAAAAAGAAGCATCTATCCTGGAGATTGATTGGTTCAAATG AAGGGCCTGGACCCAAAGAAGTTGTCGAAGGTCCGTATAAATATTTAGTG AAAATTGTCAAGTTGACAATTTTGTGGGTGTTTGTTATAGGCAAAGTATA ATTTAGTATCATCTGTTTTTTCCAGAGTTACCTAAACCAGTTGGTTTATA CCCCCTGAATGAGAATACGCTGAAAGACATGATCACAAAAAATGTCGAGT TGAAAAATGCTGAAGTCACAAAGGGACCTGGAGGTAAGTGATTGAATTAG ATGCGATATTCATTTTACCCAAAGTGTTTCTTAATTCCATGTATTTTCAA TTTGACGTCATTCAAATAGGGTGGTCTCAGCCATGCGAATAGATTTCGTG GCTATTAAATAAAAGTTACATTTTTTAAATCAACATTTCTCATTATAAGC AAAAAAAGTTACAATAGTAGTTTAGTAAATCATTCCTTCGTGTTAGTGAT TTCATATCAGCCAATCAGGTGTCAAAGAAATGTCTTTCCACTTTAGATCT ACCAAAGAGCGCAATCGAGTTAAAGGGAAGTCAATCTTCATACCTTGAAA TTGCTAATAATGGAAAACTAGATGCTCGTAAATCAATTACAATTCTCACC AATATCTTTCCAACGGGAGACAATGGTCCTATTGTTGCTTATGACCCAAT GGGAAATGGTGTTCACTTATGGCAGTACGATAAAACACAATTGTTCGTCC GTTTTACTTTACGTGGCTCGAATGGAAACATGACATTGGAACCATTAGCT ACACGTGTTTTGCAGGTAAGACATGTGTTCTAAAAAGTATTCGAAAGAAG TTTGGAGCTGCAACCATGGTCGTAATATTTGAGAAACAATGGAAATTCCT ACGAAATCTTATAGCCACATTCGATTTGGNTCATGGTCGTAATATTTGAG AAAAAATGGAAATTCCTACGAAATCTTATAACCACATTCGATTTGAAAGC GCTCTAACTTAGGTTGGAGTTAGGTTAGGGTAGAGTTTTAACTCTGAGTT TTAACATGAGACTTAACACTTAGGACCTTAGGATCTCAGGATCCAAAAGT TCAAAAGTGGTCCAATAAGGCTCATAATATAGCCTGGAAGTCTATAAACC CGTACCTAATTGAAATATCCGATTAAATTTAAGAGATATCCCAAAATCGA CTTTCTCGCCCTAACTCCAAATTTCGAAAAACGAGGAAATAAGCTTAATT CTCAATAGATTTTGACCATGATTGTGTTCTGGAACTGCTCACAAATTAGA TGATCCTAGCACCCCCGTGTCACAGACCCGTTGGACCCCACCCTCGCCGC AAAACCACTCTTAAATCTTCCTTTCTGGCGTTTTTGAACTGGAAACAATA GATTTTCTATCCCATTGGGATTTCATAGAAATTTTTATCTCCACCGAGAG AAAAGATTCCACCGAGGCTGTGAGACAGGGGTGTATCCTACAGCACAAAC TTGTGTTAAGCGAATCAAGTTTTGTCCGCTTTTCTCGCTCGCTTTCAACT TCTCGTTCCTTCATCCTCAGATGAAAAAGTGGAATCAAGTTGGTGCTTCA TACGATAACAACACAGGAGTTGCCCAATTGTGGCATGATGGCAAGATGGT CAAAAGTCGAAACATCGGGCAAGTTGACTTGGCAACCGATCAAAACATTC GTATCGGTGCCGTACAAAACGACAAACGATATTTCGAAGGGAAAATCTCA TGCTTACAAATCTACGATATCGCATTGCGAGAGAAAGAGATCGGTGAACT TCGTGTTTGTCCGAAAGCAAACCTTAAAGATGAAAAGCAGGACGCAAAAT CTGCAGTTAACAATACGCATAATGCAGGTAGGTGTTTCAATCCAAATACC ATATATTTCAATCAGTTTTTTATTCTTAATAATATTTCAACTTCTGATTG TCAACCATAAACATCCATTTAATCTACAACCCATATTACCCAGACTTTTT ATATCACACGACTCGTTTGAGTTAAGTAGACGTCTCCATCTCCATATAGA GAGTCTCCATTGCATTTCGACTTACTGCTGTCAGTCATCCATTATATCCC AATGTAATTCACGCAGACTTTTTATATCATACCATCATATATTCTAACAT ACACTAACCATCCATTAACACTTTTCATTCACAACTGAAGGAGTGAGCAA GTCGAGCCTTCCAGAGGCTTTGTCAAGTTTGGATGCAGATGTGGCAAGTG GAGCCTCAGAGTGGTTCGATGAAGGTAAATGATATAAATTGACAGACATG TTACCATATATATGGAGACAAAATTGACAACAGAAACAGATATAGTGAAT AAGAATTTAATGACGTAACTAATATAAGTAACATATAATCTACTGAGTAG ACCCAAATCATTTTGAGTAAAGTTATTCTTTGGTATATTGAAATTGAAAC AACACTTTTTTGTTTCCATAGCGACGGAGGCAGGAGCAGAAACGCGGATA GGTGATGAAACCGAAGAAGAGCTCGTCGGTAAGTCTCCATCTTGTAAAGC CTTTCAATCAATTTATATTCAAATATTTCGTGTGTCCCTTTCTTCAATTC ATCCTAAANATCTTGTAAAGCCTTTCAATCAATTTATATTCAAATATTTC GTGTGTCCCTTTCTTCATTTCATCCTAAATAAAATGAAAATGAAAATGAC GTTAAGTGCTAACCCAATTCTTCTTTATCTGTGTACCAACAACTACCGAC GAACAATTAAAATTCAACAAAATTACAACTATAATACGTACGCATTGTAC AAAGATTACGTCATAAGCACAATTTCCTTTGTAAGTGAAGTAAAGAAGGC ATCATCAACGGCCATCATACTGTGGACCTCTTGCGACCAAATTGACATAG AATTTTATACATACCATGACATAGAATTGTATACCATATAGACGTAAAAA TGTTCACTTTGAAGTCATCCACCGAACACAGCACGAGCAACAACAACAAC AACATAACACAACAAACAATGACAAAACCATGACAGAAAAACACAATTAC GAATACAAAATATATTCACCATGAACTTTTATTCATCGATTTTCGATTTT TTTTTTTTCAAAATAGCTGAAGACGCAAAAAAAGAAGGTAAAACATCGCA CCCAAAAGTCACGAGCAGTGCCGGAAAACTATACATTGTTTAAAAATTTG AAAGCTATCAATCCTATTTTTAAAATAGCGTATAATTCATGTAGTGCTAA GAAGCAGAGGAGGTGTGGAAAAAGAATGTTATAGGTGTAATATTAGTTTC ATTGCATCCCATAATGTAAGTCTCAATGCGTACATGGTCAAGTATTTTAT CTGAAGCCTTTCTACCTCGAAGCCTCGTTTTCATCCATTTTCTCTCTTAT CACCATAGCAACACGTTGCCAACCGAATCCATGTTCGAATGAAGGGGTTT GTCAAGATGATGAGAAAAAGATTGATGGATATGTCTGTATGTGCCCTGCT GAGTTCACCGGTAGACGTTGCCAAGGTAACTGATCATTCTATCAATAGTT ATCTTTTGTCTCATATGTAAAAACAGATGAAATTTGGATTATTCCATAAA TCAGAGTCTTAGAAATATAACTCATTTTGTCGTATGCTCCGAATTTGAAG GTTAGAATCAAAACACGTCCGATGCCTGAACATGGCGTTACTTCTCTTTT CAGTTTCCAAACAGAGGGCCGAGAATCCAGTGGTGAAACGAACGGCCATT CCCACCACCACCGTCACCAATGACAACACCACCACCAATTTGCTTAATGC GATTACCACAAACCCCACTAACGCTTCAATTGCTGGTACGTAACATTTGA AATTTTTCTATAATTGCCATTAAGACTAATTGCTCGGTTACACTGGCCGG CTTCACTTTTTAACAGAAACTGTTGTTATGGAGAAATCCGCTCAAATGAC ACCTAATCTTATTAAGGTCCCATGTTGTATAATAATTTGTTTTAAAAATT TACAGTACAGTATATTGCCTGAATATGAAGGAACGTTCACGAAACACCGT GTATTAGTTGTAATCTTTCAATACTGTGATTTCAGAAAATGTCACAAAGA GCGATGAAAGCAAAGAAGATATTTCACTCTTGTATCAAAAACTTGGTTGC TATAAGGATGATCCTTCAAACCATGACCTTAAGACCAAAGTTGATTTAAA GCGAACCACACAAGAAGACTGTGCGAAAGCTTGCGCAATGGCTGATAAGA GCTACTCTTACTTCGGCCTTCAAAATGGTACCTCGTGTTTCTGTGGCAAA GACCATGGGAAGTATGGTAAATTAGGTGACGAAGCCTGCAATATGACCTG CAATGGCAACGAGGCTGAAAAATGTGGTGGATCAGAGGCTAATAATGTCT TTTTTTATGGCTTAGGTAAATGAGACTTTTTAAAAGTAAAATGTAATGTT CTACTTTAGATCTTGTATAACATCATCTTTCTGTGCATACCAAAAATAGG CGTTTGTTTGAGAATTGTAAGCTTTGAACGTTTCATATTCCAATATTTCG AAGAACTTACCTACAATAACGCAATACCACCCAATACAATACTTTTCAAT TGATACTATTAAACCAAGATTATTTAACATTTTCCACTTTAGGCACCAAT TACACGGTGAAGACATTCACAGGCAAACCCCTGGGAGCGGGTACTGATGC CAAAATTTATTTCGAATTGGTTGGCGATCGAGGAAGCTCAGATTTCCGTC AACTCGACCCCAGTCCCGCTAAATATGAACCTGGAAGGTTTGTACCAATT TCTCATCGCTCTTGTAATTTATTTCGATCAATTTACGAAAAACAGAGAGA TTACAAGGAGTTAGTTTGAAATTCTCATTCGATTGGTTGCAGTTAGTTGA GACTTATGCTTGTTTAGATTTTAACCAAAACTGATCTAAAACGAAAGAAA TATGATCTTCATTTTCTCTTTCTTTCAATTCTAGCGAGGACATTCAAACG TTCTTATTACCGGATCTCGGTAAATTGAAACGGATGAAGATTCTCCATGA CAACACTGGAACAGCGCCTAGTTGGTTCTTGAAAAAGGTAAGTAATACAT CGAATTTCACTGGTGGACCTTTGAGCCGAAACAAACCTTATTTTTTGAAA GATAGTAAGATTAGTACTAGTAATCGTATGGTTTGGAGTGCAATTAACGA TTAAACAAAGGAGAAAATAGTAATTTGCATGAGTCCGAAGGACGAGTGCA AATTACGGTATTTTCTCCTTTGTTACGAGTGATTAATCGTTAAGGTGGTC GTTAACAAACTTTTTGAAAATGTCAAAAAATATTCAAATTGAAATATCTC AAAATGTATAAATGATATATTGTTGAAATTTTGTATGATGNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGAGCACTTTCACT TTCACTTTTGCGAAAACCCCGAAATACACCAAAATCAACTATATCACTAT CAAAATCCAACTAAATGTGTATGGATAGCTTCAAGATGAAGTTATGGACG TTTTAAACAATAAATTATCAATTAAATAACTAAAAAGAGAGAGAAAACAG AAGAAACATTACACGTACCTGTCACGACATTGTGTTGCGCTGAAATTTGA TCCCAATGGGAAGGAAATTAGAAAGTTTATCAAGTAAAAATGTTCCTTGG AGTTTTGAGAAGCTCTTTATATAAAAAGGAAGCATCAAACNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNATTGTTTAGCAAGGTTCAAACTTTAATTTAAACCC AAAATTGAAAAATCGACCCGAAAAAGATGATCCTATCTCAGAAGTGTTAA CGACCACCTTAATTGCACGACAAAACATACGATTCCGAAGTAATTGTCAG TAGAACAAAGTCTCTGACACAGGACTTGGGAGAGAAAAGAATAAGGGGAC AAAAGTGTCCCCCCGCCGAAGAGTGCAAAAAGTGGTAATAGTGCAAATAA CGATTAATCGCACTCCTCTAAACCAATCAGATTCGAGTAATTTTGCATGG CTGACGATTACCTCTGTAAGCGAAAGTACGATGCAGATTCGATGCAGGGA GTTTTGAATTTGAGAAATCTTTAACTTTCCAACGACGAGACGAACGTTTC CGAGTAAAACTAGACAAAACTTAACCTTGTAATAAGGCAAAAATAGACAA GATCCTAGAACTTTACTCTTTTCTCCTTCCAGGTACAAGTGACGGACGAA GAAGGTGGTTCATATGAATTTCCGTGCGATGAATGGTTAAGTGATACCAA GGGAGGAGGGAAACTTGAACGAGAACTCATCGCTAAATCGAACATACCAA CACCAAGTTGAAAAATATCGACTTTGGAATGATTTCAAGCTTAGATGAAA TGAAACGATCATCAATTACAAGCTTATGAGTACTGTGGCTGAGAAGAGGC TTTGGATCGCGTAAAGTCCGCCATTTATCGAAGTACATTTTATATACAAA AGCTTTTTTCGTACAAAAGGGACTTTTCTTGACCCACGCATCATTGAAGA GCTTACGAGTCCGAAAAACTAGAGGATTTAAGACTTTTAGTAGCTCGAGA CTTTAATAAGGAATATTTTTGTAGTGGGATTTGTAATATATTATGCTTGT AAATATTAAATTTTATATAACCGCTTTATTTATTAGATGATTATTTCCTA TTGCGTCGTTGTGCGTANCTTGTAAATATTAAATTTTATATAACCGCTTT ATTTATTAGATGATTATTTCTTATTGCGTCGTTGTGCGTAGATTTGTTTT CCCACTTTCTATTATTGTCTGGTAGGGTTAGAAAGTCGTCAAAGACAATT AAAGCACATAGTGCCTGTCTCATCGGCCAATCCTTCTCTCAAAGTTAACG TTTGAAAGGTCTTTAATCTCTCTATTTTGAGTATAGCTCATTTTGGGCCC GTATGTTTTGAGAAACCTCGGGATTTCAAGCTTAGCAATTTTTGTATTAT GGAGAAAAAGTTTTAAGATGTTCGAAGTAACTCTTTTTAACAGCAAGGAT ACCTCTCCTCAAACGCACCGCTGGAAAACCAGGTTTCCTGTCATAAAAAA TTAGCAAGCTACAAGAGAATTTTATCCGTATAGGGTATAGTGCGTTTTTA GTTTTTATACACGGGCTATTTTGTATAGGGAATTTCAATGTTTGAAAAAA GACATTATTTTTGAAATCTATTTGTTTATTCACTTTTGACATTGGTACAT GCATCGACTGTGTGCTTTCAAGCAATGTCGGAGATATCCTTTGTTCCTTC TGCACTCAAGGTAGTCCATAC
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001201TCONS_00001201Clytia hemisphaericatranscript
TCONS_00001200TCONS_00001200Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001201-proteinTCONS_00001201-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:977859..997379 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
1.04 0.95 0.45 0.25 1.46 1.03 7.33 9.37 2.93 3.32 4.06 2.65 12.28 11.77 6.81 18.57 10.97 12.27 1.6 1.41 8.31 8.4 4.97 5.7 11.2 13.69 9.82 10.66 1.04 0.72