Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00001051 (transcript) - C. hemisphaerica

Unique NameTCONS_00001051
OrganismClytia hemisphaerica (Jellyfish)
Sequence length2223

The following sequences are available for this feature:

transcript sequence

>TCONS_00001051 ID=TCONS_00001051|Name=TCONS_00001051|organism=Clytia hemisphaerica|type=transcript|length=2223bp

protein sequence of TCONS_00001051-protein

>TCONS_00001051-protein ID=TCONS_00001051-protein|Name=TCONS_00001051-protein|organism=Clytia hemisphaerica|type=polypeptide|length=525bp

transcript from alignment at sc0000007:1027348..1041137+

Legend: exonfive_prime_UTRCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00001051 ID=TCONS_00001051|Name=TCONS_00001051|organism=Clytia hemisphaerica|type=transcript|length=13790bp|location=Sequence derived from alignment at sc0000007:1027348..1041137+ (Clytia hemisphaerica)
TTGCAATTGACCATTGTTTGAGCGCGAAAAGGGTGGTAAACAAAGATTGA CTTTCGATTTCAACACCAAAACACACAGGACGCTAGTTTAGTGTGAAACA TCCAAACGAATTTGTCAGTTTTGTCATTAATAGTTTTATGATATGGATTT TTCCAAAGCAAAAGGAAGATCTCGTAGAAGAAACAAAATAGACGATGGTC ATCTTTACACAAATTTTCCGAATCCATTGATGATGTACAACAAGGAACCT CCGAGGGGAGATATCGCTCTGGAAGAATTTGAAACTTATGCGGTTGATCG Cctgaaatgtaaaaaattgtattttcactaacagtttattatttttttta ttatcttaaTCTTGCCATGAAAgctctttttgaaaaactgaaGATCCCTG ACCATGATATGGATTTTTccaaagtgaaaaaaagatcgaccgtcaactgc tccaacttaaGGCCGAAGTAAGTTACATGTGAGTTTACCGTCGTCAACTT ACCCgaaaatagatgcggcatgatttcattattcattattcattattttc ccaacagcaccttatccaccNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCAGATAGATG GGCGTGACGCCCGCTGTagttgtaggattgagggcggtcacattttctgt aaaaaatcttctttgtttacccgtgTTTNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA ATTTAtcgaaataatgaaattttcatgcgggtgctttttagagatgcggg cggccgacggtaaactcacATGTGACTTTCATCGgcctaatagacctttt tttaaagaggcaaccctgttgaataattatgtagtccagcataaaaataa tgatacagccatgcataattactgtttcatgcatattataataattatat tatgcatggctatatcattgtttttttgctggatggactacataattatt caacagggagGGTGGcctcatttaaaaaaaggtctatggctTGGGACTAT CTGgcgcaacatgggacggccattccaccaccatttcaccgaacctcaaa agtcatttgatttgattttaatgaaccgcgtattaaaaaatacacgattt ctacGACCCTCGgcaaaaaacttttattggaattcgcgtaaagcccgagt atggcccgagctggcccgagaattcgggccgtgttctggccacgcacggg ccacactcgggccaatttttgaaaacatgatataaacaggcgtgtaattt caggactgaatttttttaacattttctttgagaaaaacttggttttaatt atattaaatatatgaatgttatgtatgacaaaacagacaaatcttgtttt gtactattttgtttgactggacatgctgaatcaatttaacatttaacatg gcccgaacatggccccgaatgactcgggtcatgttcaggccaaaagaatt gatagggtctctcggcccgaacatggcccgaagaggcccgaacatggccc gaagaggcccgagaattctcgggccatgtcgagggtcgtcgatttctttt tcgtaacgagtaggcttttaagtcgaaataagaaaaaatctgtagtggaa cacgcgCAAGTGTCTGAAACAAAGAAGctaaaattagtggcaaaacgatg gagcattTGATATCACTCGTGCGGCAAGTTGCACACTTGTtatatttgtt aatcccatcaggtGATAAGCTGTTaggcagtctaaacttaaactcctaaa tcaggattagaaactaggctagtcttacctcttttatcttttcctttata acaatacaatgctgacaagttgacacaacacatgtgtacatgtacattga caagtaatccttGAGACAGTGTaaacctaactcttcatacaaaaattacg ggaaacgcatatttggactttgtaccctatgctgcactcaagcacttgag ccgaaatcccgcaaaggcgggacaaaaatcagttttttgaagtttgcaaa aaaacgccaaaagttaagggataatgataattgaatactatccattgatg atccacggcactatcgtaaagctagaatcgcttcgcgtactcttcacttg agaaaatgattgacagattgaagttttacATCTTGTTTTACATCCTGCGG TGCGCGCCAcgcgggagctcgggcgctctgcgagagttctcggctcaatc ctcagaccgtgctaaaaatggtagactgagctgtgatagatcatttcgat ggaagttgcaTGGCTCCaaatggggttctaggtccccccaacaaatttag gtcccccctaagttTTATGTgcccccacttttcagtaagcttcaggtccc agttgaaatctTTGTACCACCCCCTCTCGCACgcagataaaaataaaacg gtagaatatttagaaacaaaacattaaaaccaaacaaaaaattattttta caatttcttaattAGTGTAGTTAGCCCCCAGAACTTTAGTGCAGCCCTtc aggtccccccacttttttagaccccccccctaaatttgaaaaatgagaca gctcccacccacttttagaccgattttagatttacacccccccccaaata agtggggggggggggggaaattaaaaaaaggccaaaaagggggggggggg gggccccaggggtgttggaatgtttacaaggcttttgacagaatattgtt tgttttattgtcaatgatgacagtgccgttataaattttgttagatctga caaattaaTGTATGTAAGTgctctttatagttttgattcccattgaagaa tcatattcaggttttcatgttattagatgctgttttagagctttagagct acactgtgagagaagtttttatagaaatctgcaacaaaacaaataaaagt ggtctcttctactgattgcttcccagcgctcctttgcagctgtttatcaa atttcctgcaatgaggttgccgcatttcaaacggcccttctttttggcac ccgtggcctttcagtgccttgcacgacaagcggctgtaaaatcccaccca gGGATGTGGTGATTGTTATAAACACTTTATGTAACCTCAATGAACAGTAA CTcgaatatgaaaataaaatgttcttTCACCCGCTCACCATCTTTTTCAA CTCACCATCACATGTATTTGTTCAAATCTATTTGACACATATTGAGTTTT TTTATATCCTTGTTGATGtcataaatcaaaacaaagtttcaaTGACAGAA TGTGTAGCCTTTGCACAAATTGCTTACATTCAGGTTGGTACAGGCTAGCT CGACAAAGCATTTTTGCACTTTTACACTCTATTTGTCACAGAATTTAGTG TTTATGTCAACTGTCAGTGCTGAAACTTTTTATACCTAAACCAGTGGGTG AACAGGGCTGTCCTAATTATTGTACGTTTATTACTTACAGTGTTACGTGA AGTGGAAAATATCAACATCAGATTCAAGAAGAATAGTCCTGATCACTaca ctaaaatgaaaaaagccCTCGTAGATTTTAGTCCCAATTATTTTgaggta aacttttttttgtatttttgctgGTTATAAATTTAACACCATTTCTACtc ttaattcactttttttaatagTCTTTGAAAAAGCACATaagtgtaaaaaa tcattgaaggcGTCTCCTTCAATTTAAATCAACCATTGCCAAATAGCTGA TAACATAATTTGTCAATCAATAACAttagataaagaaaaataattaactC CTTCAAGCTTCAAGTTTGAGTAATTTTATAAACtttattaaaaatgttta ttatattttttctttattgctaGAAAACAAACCCTGCGGATAGTAAAGAG TTTGAATTCAAAGCagacaaagaaaagaaagagaagGAGATGAGAATCAA ACTTggggaagaaagaagaaaagattaTGTTTCTCATTTCATTCTTCGCT TAGCTTTTGCTAGAAGGTATTTTGTAATTGATTTTATGAATAGCCACGGT TACTAGTTTCCAGCCCcaataaatttcaaaagctaATCAACTTGACAAGC AGCCTGATAAATAGCTTGTGTCTTGATTGATAAAAAGGTGACCATTTCGT GATTTTGAAACAGAACAAATCATAGCAATTGAATTCTACTTTTCTTAATC TTCTCTTTTCATACTATTTCAGTGAAGACCTAAGGCGGTGGTTTTTGACC CAAGAATTGGAATTGTTTAGGTATGTGATTTTGCTAAGAATTAAACCTTA GAATCTTGAATTTTTAGATCCTTCAGTAAGAATAATTGAGGATAAGAACA GTTCTTTTTCAATCCTATTGAattgtttttctcaaaaagacGCAAATCAT TCTTTTAGATTCAAATTTACAGAGCTGAAACAACATATTCAAAGCTTCCT TCAAGAAAATCAGCTCGAGTATAAACCAGTGAGTAAACATGAATGgagtt ttctttgtatttgatAAGAGATGTTATTAAGGAATTTCATGTATATTTAC TAAATTTTGTGAATCCTTTTTCAGATTGATGATACAGAGAAAAACAAACT TGCCAATAAACTCAAAGCAGCAATGTTCAATGCAAAAGAAGTCAATTTTc cggaaatgaaattttataaaGTACCTTTCACAAGTGTGTTGGATTTGGTT CGCTCCAGGAAGGTCTACCTAGAGAAGGTATGCTAATTTTGGTTCTTTGA TTTgtgtatttcattttcaaattatttgacCTACTTACCATTGAGACTGA GATTTCGTTCTCTTAAAGGGTTTCGTTTTGCATTTCTAGGGCGAGGCTTA TGTTCCTGAAACAGAATTAGTTTCCATCATTCTGGGAATCTATCGTACGC ATTTATCGCAAGCACTTGCTGTAAGTAAATTAATCCATGTTGAAACTAAA TCTTTCTTTCATTGCAAGGGATTACATATctgcttttttttctttgctat GCTAAACCAGACTATTTTCGATTGATTTTTTAGTTAACGGCAAAGAAACT ACCATATATCGAAGAGGATACAAGACTGCTACCAATGCTGAAAAATTTGA GGTAATTCTTTAAATATATAACAAAACGTCATTTGTCCTTTCCCTGTACG TTACTTCTCAAACTTTATGTTTTCTGATCCTAGCTCTGCATACATCGGAG ATAGCTACAcctcgaaaaaagaaaatgCAGATGATAAACTGAGCTTAGCC AACATGGAAGAGGTATACATACTTTAATTCTTTTGTATAAATTATTTatc aatttataaaaaaattgtgtgtCATCATGGtagaggagtgaaatgtagag atgacaattcttcaggaaaaagcGGGACATCCACAAAGAATAGCGcatct ctttgtttttatcatattaaaaaaataataagacaaTTCTAAATTGCTTA CGAATTAAATATGTAAAACGACGTCcacactttttaacagtaacgacgac tcgaatgtttttatgtgaAGAAAGAGGTGGACTAATTCTCACATTCTcct tttgctttttatcgccctttgaagGCTGTTGTTGTCgacaaacttttgat ttttatgttttgatttttatgttatgATTTTACATTTGAAaggattttgt tttgttttgaaaagaattcgaatgtcattaatatatacgatcgttaaata cattcgaaaacatttaaaacaaaagaaaagagaaaaacagcgTCGGGCAt gtctgggcagaaattaaaattacttaatgtagatgggccttaaatttcaa aacaaaggatgaataaagtctaaaccaggctctatccgatctgtcaatca aaacaaacttatcgagaacaaaaaaatatattgctggcgaaaacgaaagt gacacacaaaaaacaaacagacatacagactacggctattaatatataga tatggAGGATCTTCTTCGATTCTTCTTCATCGCAGTTGTTCTCAGAAGta taaaaaagtatttctacTTTTCTACCAGGATGTTGTAAAATCTTACCCGA TCTGCATGCGAAATTTACACGAAGGTCTACGCAAAGACCATCATTTGAAA CATTGGGGTCGTCTGCAGTATGGCTTGTTcataaaggtttgttttttgga cctaccccggtggggtggaggtcctataaattaacccgtgttcgttagtt agttagttcgttcgttagttaccaacttttctcgagaNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgatat ataaatcgaaatttaaaattatacattacttccattaaattctaattatt cgttttataaataggtaggtccattaaagtattacttgtttatTTGTGTA ATAATAATGATTAAAAATATAAGATCGAAGAAgaagagtctgctaaatcg cgtgccacgcgtgccagcgtgccatcggTTTTTAAGCGTGTCAGCGTGCC ATGCGTGcctgcgtgccaacgtgccttggcgtgccagcgtgccaacgcgc tttggcgtgccaacgtgccagcgtgccatccaaattcgGCGTGCCATtaa aatttcggcgtgccattttcggcgtgccatccgaatttcggcgtgccatc cttattccggcgtgccatccgaattttggcgtgccatccaaattttggcg tgacATCCATGCGCTGAtaattgtttttgaaacaagagccgcaaagatgc ggataaatatttcctttacaaatgttaaaataataattgtcctcaaaaga tttcaaagtgctttaaatctcagataacacaaagcaacacaagtccctaa gaatttcaaaattccatttatgtaattgccagtatttacaggattattca taagatgactgtaggttcaaagctacggatcNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNgactgagaacaacaatgcagtaatca aattggctggaactttaattttcgttaggtggactttaaatggattttag tattatactagcggtcacccggcgtcgaACCGCCAattagagtgttgttg aacacatcaaaagacctgataGTGCATAATTTAATAAttatatcattatt attttaagcgctgatttccagaaatattatatagccaaaaagggcaaata tctaaaatgaaagaatgacaaaaaggagaatatttcacagtaagaaaacc aaaggaaattttatatattttcaaaatgagatgaaatattttgcattata cttataccgggtgacccacgaaaaagttcagacgtttcccgacgtcttga ggccgaaaaaatgtcccaaagtgcttggagttttgatatttagaaagNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNg agcttttaaagtcaaaattcactttgcggaaagtgtaaaaaacacgtaaa aaaggggtatcaaatttggtatttttagacgtttttgatgtacagttttt gaaaaacatttatgaaagcgccaatttttataaaaactagtcttgtttta aacaaaaactactttcaaaggtttttttattaattattaatgtcataaaa ctcgttaaataagtcaattcgtaagtgattttctaattgattgcatgaat ttaatacctcttttttacgtgttttttgcacttttcgaaaagtgaatttt gacttaaaagctcataagtagagaacaagttggtcaaatttaaaaagtga tggctcaaattttaagttaggatatctactttctaaatatcaaaactcca agcactttgggacatttgttcggcctcaagacgtcgggaaacgtctgaac tttttcgtgggtcacccggtacattatactataaaaaatgtaaaaattta aagtaacttttgctttggagttttttgaaatactgtacgtgccaaaaagt aaaaatctttcaaaacagggaaacaatttcataatttccgacagaatgca aaaaaaaagaagaaaagaatctcatttttatatatatatactgggaaaca tttcataatctgaaagaatgtcgataggaaaaaattccccttacagaagc cattttatgatttccaaaagcatgctgcaaaaagtcacatacttggaaac aatcataatttccaaaaaaatgtcagaaaataaaataaattgtcatgcca ggaaatcacttgagttttgttcattttttaaatgcatgtggaaggaAATG TCTatttcatgacaaaagttttccacgttttgaaagcacgtgtaagaaaa tctccaaatttatcacaaaagtttccacgttttaaatgcacatactgtca actgctctaacttgggacgattggtcgaaacatgggactgtttgatatct ggcctgtattttcaggagtttatcaatcatacttcctgtcataacatgtc acgataactttcaatgatagcgcgcccttttaacttttttgttttcattc aaaatcaccggacgccgattggagaattagtgAACGctcgccgcctaacc gcctaaccgcctatttcccgatgggattaacaaataatgagtgtgtaact tgccgcgcgagtgacttGACGcgccactaatttgttcttcttcgttcttg acactcgcgtgtgttccactacagatttttctatatttcgatttaaaagc ctgcGCAGAGGGAAAGAgaaatcttgttttttttaatacgccgttcatta actcaaatcaaatgactttggaggttcggtgaaatggtggccaaattgcc gtcccatgttttgtcagatagtcccaagttggagcagtttacggtaagaa aatctccaaattcacgacaaaagtttccacgtttgaAACGCACGTGGCAA AAGATCcctaaattcacaactaaagttttccacgttttaaatgcacgcgg ggaagaaaatctccaagttcaagaaaaattttaattgtacattTGAGGtg attttcaattatttacatccatattcaatgcaataaaccttttcagaaat ataacataacattcttcatattggcgCCGTGGTGttccggttatcagctt taaaatttgaaatttataaccgcaacaTAATTTTCCTCACAAAGAGTTTT CACTAATTGTCACTaaccagttaattcattgttgtagataaaaacaccaa gggaaattcaatcattaaccagtcagtTTTTCTCCATGTTTGAATTTTTA GctaatcagttcatcaaccattcccattgcATTGTTGCATTTTGTCGCAT TGCATTGCATTggttgggtgcaaacttttttgatgttgcgCAAGTatata tgtaatttttcaggtataacatggtcagatttattcacagtcacttgcct tcttacaatttatgtaaatatacaagcaaaattgaagttagtttgttgtg aaagtcgataaaatgtcctgtttttccaagaccaagaccaagagattgta tctctcattccaaaccaacagaatgtaaaagaaacatcaaatccagaaag gaacAATAAGAAAAGTTCACCATCGACtattccttgtgacaatcgtacaa aaatcatgatccaattcaactcattaaagcataaaaaccaaagcaaagaa aagtagcgaaagagcaaggagaatagagcgccgtacggatattttccaca gacgtttctcgaagaaatgacgtcttccgcctcgaaaaaagaacatccta ctgtttttaccgccggagcttgatttaaaaagagactcatgtacaaactc acgaaaatGACTTTTTCTAAACCTTGGAAAAGAATAAGAAGGAGGAAAAT GCGGAGAAAAAACGCCCGTTTTAACAAACATTTCCTTctcaaaggaaata tttaaaaaaaacctggGTAAAAGAATAATAATTGTAGAGAGCTAGCTAAA GAGAACGAGAGAACGTCTATGatattttaaatcaattttttataatcaca aaagaaaaacttagaTTATGTGATTActgtaaatgcataattagaataac tAACATAAATTATGCATGGGTCGcgcatcgtgcatcgtgaatcgttggat cgcgcatcgcgAATTACACAAACCCCAATATTTATCTATCTATTtatcaa aggcatctcattcggtacaattgaaatatttggtgtaataaagctTGCAG GTAACCCACTTAATTGTCATGtcaataattttgtcaaaaagtgtcacttt gtcaagaaaatgacaggTAGACTACTGCCTTTCGCGTGGAAGAAACACGT GTATCtccttcaaaacttttaaagttatgtaatgttctgttcatataaaa atgaaaataataaaataataataaaagtgctactattttcatatctctaa tgTTTTCACTGCATGACAATCTATATCCATTTGCACcgccagcatcctat tgagcatgagaaaacatcttgttgtaaattggtgtatacACCTCATATTT TGTGATAATGCCATTATTTACATAATTTAAGTGTCATTACATAAAATAAT CTTGAAAATGCTTTCCCGCTaattttgagggggtccatattggggtccat attTGGGGGGTCCAAGTTGTGTCATCTTCTCCCCCAAGCTTTACCGAAGT TGTGGTGAAAATTCGGAcgagcacgccgaaattcggatggcacgccgaaa ttcgaatggcacgccaaaattcggatagcacgccgaaattcggatggcac gccaaaattcggatggtacgccaaatttggatggcacgctggcacgttgg cacgccaacGCACATTGGCAcgtaggcacgctggcacgcataGTACGCTG GCAAgcgtggcacgcgatttagcagactcgaaGAAGAAGGACCCATGAAG tagtttttcaaagattatCTTGTACCTCCAGCATGGTGTAGTTTAACTGA GGCTGAGCATTAATgctgaaatttcaatttttctattaAACATGAaagct tttatttgaaatcaataTGATGTTACATTGTAAATTTGTGATTACATATA GGCCGCTGGTTTAAGTTTGGAAGAAGCACTGTTATTTTGGAGATCAGAAT TCACAAAGAAAATGGACCTTGATAAGTTCGAGAAGCAATACGCATACAAT GTGAGACACAGTTACGGGAAAGAAGGCAAGAGAGCTGACTACACTCCATA CAGTTGTATGAAAATCATCACCACAAATCAACCAGGACCTGGAGATTTCC ATGGATGTCCCTTCAAACATAGCGATAATGATATTCTTAAAAGAAGATTA CAAAATTACAAGATTCCCAATGATAGCATCAAAGAGGTTGGTCTTTATTG GTTTAAATGAAAAGGATTGGAATAATTTGCATGTTGGAAAGTCATTGAAA ATTCGTTCTAGTCTTAGAATGACGATGACAATatgttaaatgattttttt gtatttcttaTTTCATAGATTTTGGACCTTGCGAAGCAACAACACTACCA AATAGCATGttccagatattttgaagtAACTCATAAGGTCAGTTGATTGC CTGCTTCCTTATCAATTGCCTGTTCGTTCTTAACAACTTTCTACCGTCCT GAATCTTCATCCATCATCCATTGAATTTCTTTACTTTCCAGCTTCCGAAC GGCGTGACTATGATAAATCATCCCaatcaatattttgatgaaagcAAAAA GTTCTTGTCTGGGGAGAAAAGGTAAGCCTTTCAAGCTCTATTAAAGTAAT CCAGTTATTGAAACTAATCTTACGTACCTATTAAACggaggggttggaat aagcggggtgggtggaaattttttgaaagaggaggctaatacagcagaat tagggcataGGGcataactttcaaaaacatttttttcccaaaaattaata aacgggggggggggggttaaacttTAAAATTCACGTTACAATAataaccg tttttttttttcccaaaaaaaaaaaaaggggggggggggggggttgaatt TAGGCTGTCCGCTTAATATAATGACGCTTATTAGGTTCCCGAAAGTACTA AGAAATATACGCTGTCAAATCAAAGTATGTCTATCCTCGAAAAGACTTGC ATGTTGTCTAACTCTAATTAATAATCTGGTACTCGTTTTACATTAAGATT TTCAATTCTCTTCCAGTTTCACGAACATTTTGAAAGAAGAGAAAGTGATG GTGAAAACGGAAGTGAAAGCGGAACCACCCCCGCCTCCGCAAGAAGCGAT GGATGTGAACTTCGACGAAGATATGGAAATGTGCTGAACCCATAATTTAG AAACAATATGTTATGTTTTAACCATTTCCACTCAAGTTCTCTTGAGCAAA TTTTTTAActacttttataaaaaaatcacaataatgattttgaaaattcc gCATAATGAAAATGGTGCTTCCATATATAACATTTTTTCTTGGCAAAATA AGGTTTGAAATATAGGTTCAGAAAGTATCTTTTAGATATGAGCGAACGTT TTATAGCCGTTTTAAGAGGCCCTATTATTTCTACAACGGCCGTAAAATCC GCTAAGATTATATCTAAAAATAAATTACAAATTTTAGTAAGAAAtgattt tttggtaaatttttgttgACAAAAGTCTTTGTAAGTAATTGTTTTAGATT TCCTCTGTTTTAGCTTTTTATTGTTGCTTAATGATGATGATTTTATGTAA TGTAAATATAACCCTATAAAAAATTGGAATATCATTGAGCTTTTTCAGTG AAACATAATCGAACCTAATTACCGGAGCAGAAAGGCCCCC

Coding sequence (CDS) from alignment at sc0000007:1027348..1041137+

>TCONS_00001051 ID=TCONS_00001051|Name=TCONS_00001051|organism=Clytia hemisphaerica|type=CDS|length=22092bp|location=Sequence derived from alignment at sc0000007:1027348..1041137+ (Clytia hemisphaerica)
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000596XLOC_000596Clytia hemisphaericagene
The following polypeptide feature(s) derives from this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001051-proteinTCONS_00001051-proteinClytia hemisphaericapolypeptide
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00001051-exon-sc0000007-1491911889:1027348..1027655TCONS_00001051-exon-sc0000007-1491911889:1027348..1027655Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1027348..1027655TCONS_00001051-exon-sc0000007-1510915933:1027348..1027655Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1027348..1027655TCONS_00001051-exon-sc0000007-1575043694:1027348..1027655Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1031488..1031594TCONS_00001051-exon-sc0000007-1491911889:1031488..1031594Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1031488..1031594TCONS_00001051-exon-sc0000007-1510915933:1031488..1031594Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1031488..1031594TCONS_00001051-exon-sc0000007-1575043694:1031488..1031594Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1031871..1032013TCONS_00001051-exon-sc0000007-1491911889:1031871..1032013Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1031871..1032013TCONS_00001051-exon-sc0000007-1510915933:1031871..1032013Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1031871..1032013TCONS_00001051-exon-sc0000007-1575043694:1031871..1032013Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1032220..1032267TCONS_00001051-exon-sc0000007-1491911889:1032220..1032267Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1032220..1032267TCONS_00001051-exon-sc0000007-1510915933:1032220..1032267Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1032220..1032267TCONS_00001051-exon-sc0000007-1575043694:1032220..1032267Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1032406..1032475TCONS_00001051-exon-sc0000007-1491911889:1032406..1032475Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1032406..1032475TCONS_00001051-exon-sc0000007-1510915933:1032406..1032475Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1032406..1032475TCONS_00001051-exon-sc0000007-1575043694:1032406..1032475Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1032572..1032724TCONS_00001051-exon-sc0000007-1491911889:1032572..1032724Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1032572..1032724TCONS_00001051-exon-sc0000007-1510915933:1032572..1032724Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1032572..1032724TCONS_00001051-exon-sc0000007-1575043694:1032572..1032724Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1032837..1032917TCONS_00001051-exon-sc0000007-1491911889:1032837..1032917Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1032837..1032917TCONS_00001051-exon-sc0000007-1510915933:1032837..1032917Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1032837..1032917TCONS_00001051-exon-sc0000007-1575043694:1032837..1032917Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1033031..1033098TCONS_00001051-exon-sc0000007-1491911889:1033031..1033098Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1033031..1033098TCONS_00001051-exon-sc0000007-1510915933:1033031..1033098Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1033031..1033098TCONS_00001051-exon-sc0000007-1575043694:1033031..1033098Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1033181..1033259TCONS_00001051-exon-sc0000007-1491911889:1033181..1033259Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1033181..1033259TCONS_00001051-exon-sc0000007-1510915933:1033181..1033259Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1033181..1033259TCONS_00001051-exon-sc0000007-1575043694:1033181..1033259Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1034026..1034133TCONS_00001051-exon-sc0000007-1491911889:1034026..1034133Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1034026..1034133TCONS_00001051-exon-sc0000007-1510915933:1034026..1034133Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1034026..1034133TCONS_00001051-exon-sc0000007-1575043694:1034026..1034133Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1039399..1039683TCONS_00001051-exon-sc0000007-1491911889:1039399..1039683Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1039399..1039683TCONS_00001051-exon-sc0000007-1510915933:1039399..1039683Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1039399..1039683TCONS_00001051-exon-sc0000007-1575043694:1039399..1039683Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1039816..1039884TCONS_00001051-exon-sc0000007-1491911889:1039816..1039884Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1039816..1039884TCONS_00001051-exon-sc0000007-1510915933:1039816..1039884Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1039816..1039884TCONS_00001051-exon-sc0000007-1575043694:1039816..1039884Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1039989..1040068TCONS_00001051-exon-sc0000007-1491911889:1039989..1040068Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1039989..1040068TCONS_00001051-exon-sc0000007-1510915933:1039989..1040068Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1039989..1040068TCONS_00001051-exon-sc0000007-1575043694:1039989..1040068Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1491911889:1040514..1041137TCONS_00001051-exon-sc0000007-1491911889:1040514..1041137Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1510915933:1040514..1041137TCONS_00001051-exon-sc0000007-1510915933:1040514..1041137Clytia hemisphaericaexon
TCONS_00001051-exon-sc0000007-1575043694:1040514..1041137TCONS_00001051-exon-sc0000007-1575043694:1040514..1041137Clytia hemisphaericaexon
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:1027348..1041137 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
5.81429 7.30939 28.2892 34.2054 30.426 26.275 21.933 23.6195 20.4851 23.278 12.9548 8.64308 6.78331 6.59436 12.5734 12.774 18.8803 18.3116 1.92875 3.11563 7.79193 9.39576 12.5023 11.5142 15.452 16.2043 3.79225 2.91294 9.16984 10.5777
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
Vocabulary: Molecular Function
GO:0003896DNA primase activity
GO:0016779nucleotidyltransferase activity
Vocabulary: Biological Process
GO:0006269DNA replication, synthesis of RNA primer
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006269 DNA replication, synthesis of RNA primer
molecular_function GO:0003896 DNA primase activity
molecular_function GO:0016779 nucleotidyltransferase activity
BLAST of TCONS_00001051 vs. Swiss-Prot (Human)
Match: PRI2 (DNA primase large subunit OS=Homo sapiens GN=PRIM2 PE=1 SV=2)

HSP 1 Score: 431.024 bits (1107), Expect = 3.308e-142
Identity = 223/487 (45.79%), Postives = 320/487 (65.71%), Query Frame = 2
            M+FS   GR  R+ ++       ++P+ L  Y  +PP  +I+L EFE  A+DR+KLL+ VEN+ + + K +  + +K++  L     +Y E  N  D                      E RR+D++SHFILRLA+ +SE+LRRWF+ QE++L RF+F+ L K  IQ FL+++QL+++ I D EK     ++ A+  +   +       YK+PF   LDL R RKVYLE G AYVP  ++V+IIL  +R  LS+ALALTA+ LP ++ D RL P+L +LS +Y G  Y+++      K+SL  ++    KS+P CMR LH+ LR++HHL+H GR+QYGLF+K  GL+LE+AL FW+ EF K KMD DKF+K Y+YN+RHS+GKEGKR DYTP+SC+KII +N P  GD+HGCPF+HSD ++LK++LQ+YKI    I +ILDL K  HYQ+AC +YFE+ H + +    +NHPNQ+F ES++ L+G K
The following BLAST results are available for this feature:
BLAST of TCONS_00001051 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
PRI23.308e-14245.79DNA primase large subunit OS=Homo sapiens GN=PRIM2... [more]
back to top