Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000992 (transcript) - C. hemisphaerica

Unique NameTCONS_00000992
OrganismClytia hemisphaerica (Jellyfish)
Sequence length993

The following sequences are available for this feature:

transcript sequence

>TCONS_00000992 ID=TCONS_00000992|Name=TCONS_00000992|organism=Clytia hemisphaerica|type=transcript|length=993bp

transcript from alignment at sc0000007:384402..393703+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000992 ID=TCONS_00000992|Name=TCONS_00000992|organism=Clytia hemisphaerica|type=transcript|length=9302bp|location=Sequence derived from alignment at sc0000007:384402..393703+ (Clytia hemisphaerica)
ATATTGACGGGCAACGTGGATACaagacaacaacaacaaaaaagaagaaa ggaaGATGAGTActtttgacccaaatttttcGCTTTATTTTATGGCTTTC TCAACCCACCTTTCGAGCAGATTTATGGTATAGATTTAagtattttcttt ctcattactCTAACATTCAAGTAAACTTATTGACCAGATGgcgataaaaa ataaaaaatttctgtgTTTCTGTGAAGCCTTTTTCTTAAGAATTTCTGCA TGCCGGTTTTTTATCTCTtatagagtcccctgcccagttggcgactggtc tagttggcgaccgaacgtctttgaacccagaaaagtcatacaaaaacaaa cctctggagaatttcttttggtagttatctgccttgacctatttcccgta gctactgtgtaaaaaaggttttagaaaaaaacgagtagaatccgaaagat ccaactttgcacacaaaaagccggatttttcaaaaaaaataaaaaatggc tacctgtggacaaaaaagctttgtaagaaaaaacgcttcaactaCAACTC CCAcgccaaaaaatacttgtccaaaacaatgagttagaaagcatttctgt aaaaatcagctcgatacagtttccttcgtgtgaaatattgataaaaaagt tgatgcaatcagcttcgaaatatgtcgtccagtctgcgaccgaccaaact caaaaaatgaaaaagaagactctacattgcgatcaaaacattccagacgc gaaaagaaaaaaacaggcataaaaaattcccgcgtttttatcaaatgaag actctccatagaccgccactttcaaaacaaaacaaaaacaaactttagaa aaaaatggcgacttgaagaaaaattctgaaaaaacatgcagaagggaaat gtaagtgagctattttaaaacaaaagaacgagtgtaaataaatttgatac gggaaagcttatgagtatttttatcatcctgatcaattaatatgacctta cctgcaagtacagcactgattttctctttttaacgatcagtcgcagactg gtacgtcggtcgggaactgggcactagtaccgctcgcttcgaaagttttt tattctaagaagatcgcctcaaataaaaaatcaaaacaaacacgaagaac aggttaaaagttgtctaaccgttggttgaaaaggattttcaaaaataagt taaaagtaagtgaaaaatttgaatccaaaaatttcggtcgccaactgggc aggttACTCTAGCGCCTCTAATTTTCACGCCTCTAATAGGATATTTGCGC TCCTTCTCATTTTCACAGATTATgaaatttccggcatattttctGAGTGT TTTTATGATGATTATAGGTAAAGAAGGGCAAAAAACACATAAAATCAGAA GTTTAACTCAATCACTTTACTTTAGGTGCCATCACCAAGAATATNcaaat atggctaattttgattgttcaattgttttacaagtttgttttggacacgt gattttaattgttctttttaatgatACGTGGTTCGcgtaatgtttacatt ttactactgtaatgtccctttaaatctGACAAGTTAAAGAGATGCGGATG CAACGTTTCAGGATAatataatatgaaaatttgtaatttgtaaGTACTCT TGATTTGGAGAAAACCCTGTTATAGTGTTTCACGTTAGTTCTgtttagta ttttgttaatattttatcagtatttttgttaatATTAGTGTTTGATTTAT TCTACAGGTGTTTTTAATTAGGTCTTAGATCAGCTTCTTGAGCATTTTGA AAGTCTTAATTGAGTATCTTTAAAGTGGCAAAGACAAATAAAACTATAAC AGAAAGTatattgttaaaatattatcttcTATTGTCTGTTAACATTTTAT CATTTGAATTCTATCTTTTTCTGATTTCACTCCAGATTTTGTTAATATGC AAACAATTGGTCATTTTTAACCATTTATgtcaattttgataatattttaN AATAATTTATTACTATGTTTAATTTAGCCATATattaaatatttacaaaa tttatcagagcgttaacaaaatattgataaatttgTAACACTATGGTACA CTCAGAAAATTACGAAAATGGTTTGCTGCCCTTGGAACCTAGCAAATTAG ATTTTAGACAATTTCATGAGAAAGTGAATTTATCAGATAGAAATAACGAT TGTTGCATGTATTTTGGacacaaaaatgataaatttttaacaattttggc aaaaattgaacttaatcttagcaaggaaaaaatataagatatcaaGTTTT AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTTGATT TGATCGTTGTGACACAGGACCTCAACAGTGTTAaagatttatcaattttt gaagataacataTCCACTGATATTTGTCAATATTCACTATgtttaaataa ttgataaaagtttaacacaTGGTATCAATGTCCACAAGTAGGCCAAAATT GGTCTCATATTATTGATCGTGTCCATATTCTTGCCATCACCATCAGGTGC CATTTAAGCTAAAAATTTTACATCCCAGacagtcagtcagtcaggagttt ttgcctaattaggaaagtatagaccttttttcaaagaggccaccctgttg aatgaataattatgtagtccagctagcagaaaaacaatgatacacccatg cataattattacaatatgcacaaaacagtaattatgcattgctgtatcat tgtttgtatggctggtagttagtcacactagcgtcccgcgaagcaaaaaa atgcgccgcaaaacttctaaagggattcatgaaaaaataacccagggctt tttaatgaaattagcagtccatcacaaactgccatataaacaaagctcaa cattctcacaaaagttgtctttttgatttcccaaattTCGTCGTAAGCGT TCACTTTCACAATAataacaatccgggggtaagtggcgaagcaacacatc agattattcgtaaagtaaagaaatatattttgacaTTGACAATCGAATAT gatatattacattatatttcctttaattcaaaatcaaaaattcattttgc attAATTcgcgaaaaaagaaaataataataatgaattaatattacatact aagacgcccccgtcttttactctggCCTAACTTCTGATCTCGGAACGTga aaaacgcccgtccgcccaatatctaCCTAATCAGCTTAAATTTACTTTAA TTGtactttgactttcaaaaaatagtatttaaaaattatgaatttataat aattacaaaaaacaaaaagttagatacttcattagtgaaatattcaataa attcctagtttcaattttcactgggcgtttttctagggcttcgtttattg cgcaatttttgcgtcacacaaactttctgggccgctcgtaataattatga attgccaaatttggttcaaCATTGTCAGgacaggatcgatggtgacatca cctaagcataaaaaagaaaggattccGTCAGGTTTATGCATATATAtaaa tttgcgagatattctattcgccgcgcgagcgcatTTTTCGTAaactagtc ggaatactttctttttttactcgcgggattgatggtaacttttcatcttt gtttttttttaaatgaagcacaaccgaataaaatgaaacttcaaaaagtt gcgtatttccagtgagtaaacgattctgacaattaacaaaattgatgatg atgattttttttcggtcaggcaaatgtctcgtNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNcaggcaaatgtctcgtattgggggttctagtcttgaccc ctaagcctacgcgagattgaagcgtttgggtaaacaagacaaaactccaa aaaagctggtggtttgaagcgcttccgtgcgatcgaaatattgctgtttg tgacggactgattagcattttcaaaaactttgagaaattacctaaaattt gagccatagatgaaaaaatttgagccaagccaaccttgaaaactaatttg aagatcaacttcacaagaaaaagatctacggggaaggcggaacccaccta gatccacgcaccgccggataggctatttcccggaaattttgccggacctc agaCCTGCTCagacaatgacccatttacatgtgcggaattatttttactt gagcgtataaacaaggccttaaaaatcaaagcgctgtctcgggaattgaa tgacaaaatttggtttgttgatatttggctgctgcacgttttattttgtt tcaaactttcaagttttaattaattgatttgcgaacttgattcaggtaac tctcatccttgttgtgcaaatacatcctgtagatgactgatgttgttttt tctgaaagctagatttcctagtgtgactaactctaactggctggactaca taattattcaacagggttgcctctttgaaaaaaggtctattttatgattt tcctGACTTTTCTAATCAGGACACAGGAGAGCCTTTCCTAATAGATGCTT TGGCTAACGCGACGGTtatttgaataactaattactccacagcagTTTAG CCTGGGCGGTCGAGCGCTTAAGTACTGTacaaaagcgaataaaatctaat acaattgaatcaattgaacgtaatcgaacataatcgaatacaattgaACG TAATTGAAGCAATCGAATTGACTCGGCAttcgatttgttcgattgacacc gtcgtCTGGCCATTACTTTTAGTAAGTCAAAATTGATCTATGTGaagaaa tgtttaaaaaaatatgaaatcaaaTGGGCGGAGCATTGAGATACCATTGG ATACCCCTTTAAAAAACCTGCTACAAAAAAAGGTACCCCCTATATCCTGA TAGAGAAAACAGTAAgggctgaaactttttctggtgagtctaggctatct atgaatttcttccctgggtatggtattttataaaagctgctaagaaaatt tttattgcttggtgaaaaaatgcaattttagcaATTTACCCCTTAACACC gacaaaatggttttcttgaataactttttataaaatagtccttttggtct caaattttgaacatggattcactgcaaagttactaatgctacaattagat cattggtacctaaatattttcaaaactgtacgttGAAATCAAATTACATG GTGAATTGCAGAAAAATAGTACAATGTCCCTTCTGCATCAGTCTCTTTTT GAGGACCCTGGCAAATGCAATTTCTAAGAACTTCACATTTTTGTGAACTC TACTAAATAGCCTTCCTTGGATTGttatagaatttttttgttacagcccc aatcttgagaaaaatgtTGCGGACGGGACACTTTGTTGCAGACGGGACAC TTTGTTGCAGACaggacaaaaagtttttcactCATAGCTAGTACATgtaa agtcaagaaaaatgataCTGCTGCAAAAAGCATGTGGTTCCCTATAGTTC ATTGGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGGACAA ATTTTTGGACCGTATTAGTTTTTACcagttaaaaaattcaaaatagatTA TTTAAAGGCAATAAATGTCTTTAACGCAAGAAACCATTTAATATGccaca acaaaacaaaaatggggGTCCTCTAGTTCCCAGATCTTGACTTGTAAGCA TAAATGGAGCTTTTGTTGCAGATGGGACATTGTACTATTTTTCTGCAATT CACcctacaccttaaaacctacaaacattgaaccccttgctcacaactta ctgaaactgtaaaattgcaattcaggtgctaaaccgtgattcaattgatc aaatacttgctagaaattcattaccaaaacaatatttgtattttatcagg attttttttttaccagaTATCTTTCTATGTCTAAATCTtgagataattca tttttaaggtgggtaagtatgctgaaaaactgctgactcagcaaaaaata tatttggatactactaattcagggctatccagccgtgggaatgatttttt ttctgaaaatgctcctaggaaaatgctgacgtcatcggaaaacgcccaaa acatcgatttttcgccttaaaaatgtcatttctcggcaccaggtggttga aacttaacaaataactccattttctttatctacttttcacgctggaTCAG TTGGTAGCATCAGGTATTTGATTTGTAAAACCTTGTAAAATCTTCATTCA CAGCATTGGCAGATTGATCACATCTTGCCAATAGAAATATTGACATGTTA AAATAGTTTgatttttggctgttttttgtGTAAATCTCTCAACAGTCTGG ACAGGTGGGGTGTAGCCAACTTTTTCAAGCCACTCAGTGatttttaactt gaaaaagtCCCAAACTGGCCCAGGCATGTTCAGACCAGGTTTTCaacaaa gaaaagcaaaaatttcaggGTAGCTATGTTGGGGCCATGCCATGGGTCGT GTGTAGGACATCAACTATAATCATGGATGTATATATGATGACACTTGCCC CAAAGGTAGCAAGGACaggggaaaatttttaattaaaatggTGCGTAGAA TAGATCTTTATCAGCTAAACTACCTAATTTGATGGTTACCTTATtgctaa attttgattgggCAGTAGATAAGTATTCCAGCTAGACCGtaagatttcca gggggtttgatttactttttcttgagttgatttttactttagatttttat aagaatgaattTATGAAATAAATCTGCATTTTTTAAAGGACATTTTCTCT CTactattcttaaaaaaaccatTTTATAATTACCCTGAGGATATGAGATG ATTTATAAGATACTATAAGGGAATAATTTATTGGGAAAAAAGTGTTGACA AACAGTGCTTGATATCAAGAGGAGTACATTGAGGAACtgattttggctga aatttcttaaaattggaaaaaaaaggTAGATGCTAAAAGGGTTAAAAGAG TGCTGTATTTTCATTTAAATCTCTTGAAATAAATCTTCAACATTTTTACT ACTTAGACTACAATGGAACTAATTTTACACCTCAAAATTATCAATGTCCC TTCCTTACTGATAAATACTCTTATCATTTTGATtagataaaagaaaaatg tcGAGCTCTGAAGATGAAGATATAAATGAACAGCAACTGAAAATCACATT GGTTGGAGATGGTACGGCTGGTAAAACTTCTCTTTGTACGCGGCTTGCTc aagaaaattttgacaaaCAATACAAACAGACTATGGGTTTGGACTTCTTC ATGAAACGCTTTTCTTTACCTGGAAATACAAATGTCACATTACAAGTTTG GGACATTGGGGGACAGCAGATTGGTGGTAAAATGTTAGATACATATCTGT ATGGGGCCAATGGAATTCTGTTGGTCTATGATGTCACTAATCAtaatagt tttgaaaatttacaagaCTGGTTAGAGGTCATTAAACAAACTTATGCCAA AAGTGAAAAGAAACCATACCTTGGTTTGATTGGAAATAAAAAAGACTTGG AGCATTTGCGCACAgttaaaagagaaaaacatgTTGAATTTGCCCAAGAA AATGGGATGGCAAACTTCTTTTTATCTGCAAAATCAGGTGATCaagtgaa tttttgttttcaaaaaattgcagCTGATATATTGGGGATCAGATTGTCAA AACAAGAGGTTGAGCAATCTAATCGGGTGATTAAAGCAGACATTGTAAAT TACAAAGAGATGGCCACACCTGCACTGCACACTGGATCGAGTCATACCAA GAGCTCACTTTGTTCTattcaatgaatttttattacttcaaaaaactaaa aactataTATCAGAGTGTGTTtaaattttaatcttttttaacTCAAGCAC ATCTTAATTTATTGATTTTAGCATTTTATTTCTTCTAGAAATGacaaata tttatttattttcaaccAGATTGATTAAAAGACACATATTCGCTTCAAAC AT
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000577XLOC_000577Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000992-exon-sc0000007-1491911889:384402..384528TCONS_00000992-exon-sc0000007-1491911889:384402..384528Clytia hemisphaericaexon
TCONS_00000992-exon-sc0000007-1510915933:384402..384528TCONS_00000992-exon-sc0000007-1510915933:384402..384528Clytia hemisphaericaexon
TCONS_00000992-exon-sc0000007-1575043694:384402..384528TCONS_00000992-exon-sc0000007-1575043694:384402..384528Clytia hemisphaericaexon
TCONS_00000992-exon-sc0000007-1491911889:392838..393703TCONS_00000992-exon-sc0000007-1491911889:392838..393703Clytia hemisphaericaexon
TCONS_00000992-exon-sc0000007-1510915933:392838..393703TCONS_00000992-exon-sc0000007-1510915933:392838..393703Clytia hemisphaericaexon
TCONS_00000992-exon-sc0000007-1575043694:392838..393703TCONS_00000992-exon-sc0000007-1575043694:392838..393703Clytia hemisphaericaexon
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000007supercontigsc0000007:384402..393703 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
2.80643 2.68001 0.05429 0.102067 0 0 0 0 1.65697 1.06444 2.22672 0.772948 0.318745 0.217692 0.401809 0.573999 0.662514 0.615639 0.169065 0.78016 0.475729 0.150185 5.92412 2.68989 0 0 0.626273 0.660526 1.44467 1.88941
BLAST of TCONS_00000992 vs. Swiss-Prot (Human)
Match: RAB28 (Ras-related protein Rab-28 OS=Homo sapiens GN=RAB28 PE=1 SV=2)

HSP 1 Score: 294.278 bits (752), Expect = 1.424e-98
Identity = 137/225 (60.89%), Postives = 178/225 (79.11%), Query Frame = 1
The following BLAST results are available for this feature:
BLAST of TCONS_00000992 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
RAB281.424e-9860.89Ras-related protein Rab-28 OS=Homo sapiens GN=RAB2... [more]
back to top