TCONS_00000113 (transcript) - C. hemisphaerica

Unique NameTCONS_00000113
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1126

The following sequences are available for this feature:

transcript sequence

>TCONS_00000113 ID=TCONS_00000113|Name=TCONS_00000113|organism=Clytia hemisphaerica|type=transcript|length=1126bp

protein sequence of TCONS_00000113-protein

>TCONS_00000113-protein ID=TCONS_00000113-protein|Name=TCONS_00000113-protein|organism=Clytia hemisphaerica|type=polypeptide|length=242bp

transcript from alignment at sc0000001:2147059..2156560+

Legend: exonCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000113 ID=TCONS_00000113|Name=TCONS_00000113|organism=Clytia hemisphaerica|type=transcript|length=9502bp|location=Sequence derived from alignment at sc0000001:2147059..2156560+ (Clytia hemisphaerica)
CCGAAATCAGTTTTACTGGATAAAGTTGTTTACTTGAAACGGAGCAGTAA CTCGATTCACAAAATGaaggttttgattttaatatttcttggaattttAA CCCTGGTTCAAAACCAAATGATGGATTTCAAATTTCTGAATCCACTCAAA GACAAAAAACTGGTCGATGAATCTTTATTTTTATACCAAACTGACAATGT TCCTCAACAGAAATGTGTCATCGATTGTGCCGCATCTCCGAAATGTGGGT CTGTAAATCACCATGATAAAACGCAGACCTGTATTTTGAATCGGGAGCCT AATTCAAATGGAGAAGACGTTAAAGACTTTTTAACAAATGCAGAAGGATG GATTTTCTTCCAGAAAACAAAAACCAAGGTATGttacaatagacgatatc ggcttaacgtgNattttatttatttgttataaTTTGTTTTATACAAATTT CGATTTATTATTGAGTGATATTTCTAAGTTTGTCATTATGCATTgttcaa tagacgatatcggctttacattaaaactcagatttgacccccgagaattg cccacaatgctttgtatGGAAAGAATTTCATCGTGAactttttccgcgca aagcattgtgggcaattctcgggggtcaaatctgagttttcacgttaagc cgtaTATCGTCTATTATTTTCCACTCCCAACGATGGTGCTGTTTCTTATG CGACTCCACCTGTCACTTATTGTGAAAAATACCGCAAGCCTGCAAGGGGT GTATTTGAGAAAAGTCTCGATTTCCGAGAGGACTTGAACTCATTTAAAGA TGTAAAAATTGATACCAGATATCCCAATATCCCCTTATCTTAGATATCAC GTCCAAGGAAAATGGTAGAAAGGTTTAAGACTTCTTTCGTAAGGACATAA CACAAAAAAATGGGCTCGTTCAGAAAGAATTTGAACATGGGTGAGGatat aaccttttttttgaaatttactcCCTGGACATAGATCGCAGATCACAAAT TGCATATAGAAAACAGATCTCAgcccccggacattcaaaattactcctaa acagagcaagtttgctCCCAAAACAAGgtaaattttacagatttttcact acccctccGGACAATATATTCAATATATCCTCCACACTCCATGTACAaag attttctggaagagcccaatgaggtcgcttaacctttttgtttacatttt atacaGGATTCACCAAAGATTCCAGAAGGCGATGTCATCAATAAGAATGA AGGTATTATCGAATTTTAAAATCACCGTGAAAATTTCAGgcataataaaa tataaattataaaaaaaaaattttcagaaaaggtGCCCTAGgactagacg atcctatcgtctacacaagatcactaaaaagggaatagtttaggagaggc gtgataaattcgggtggagtaagcagtggcggagatgtttacagtgttcc aaaactctactgccacttttttcccgtaaaccgccctgacgccctaactc tttctcgcatttactttaaacggacgatagcatcgtctacccTAGAGGAC CCTCCAAAAACATAAAGCAGGAGTTGTTTTAGTCAAAGTTCTATAAGTCT CAATCTCAAATCATCAAAGAAGAATAGTTAGTTCCAAGTTAGACCTAGTC CCTAGTTCAGTGAAATTTAAGAAATCTCGTAACATCCCTGTTCCCTCGAA CTGTGTTCTATTGGAGAAAGAAGGGAATCTTCTATTCAGGGTCTCCACCG TGAGAAAGTTACTTACTCCAATTTCTACACTTCCATCAGCCACGGTGCAA Caattttcctcagtggggataaaaattcctattaaatcccagtggggata aaaattcctattaaaTCCCAGTGGGGGGGTAGATATTCTATTGTTCGAAG ATTAGTGGGGATGGTTTAGGATTGCAATTtctaaacatttaatttcgagt gggaataaaatataagtcaatttcccagtggggctgaatttCGGTgtatt ttcctaccggggacgaaatttttgcaaggtttcccagtggggctggggtc ccagcgggtatgtgacacaggggtgtatttctAAAACACTGAAATTTCCT GCGATCAGGGCTTTCATTTCAATATGAATCTCTTTCAGAATTTTACACAG AAAGGGGAAAAATCATCCAAGAAATGGACGTATTACCTTTACAGTGGAAA TTATCCTTCAAATTCAAGCCGAGGGTGATGGGCTATGAAAAGATTTCATC TCTCATCCATTTCCAAAGCAAGAAAATTTCCGGTGGAAGTAAAGCAAATA TTATTGCAGCTGGGGTCTCGAAAAACCAGCATTTGTATGTCAAGCTCATA ACAGCGACGAATTTCACAGCATTTTATACCTATTCGAAGGAACCCCTTCA ACCAGAACAATGGATTTATGTTCGAATCAAGTAAGTCTTATCGTGGCCGA GTTTTGATAAATTGGAAAGCTCGATTAAGTGGCTCGGTAGTATATGGTTT TCCACTTCAACCAAAATGGTTTTAAAGGAATCAGCTGAGCAATATTTCTG ATTAATTGCTGAGTAAGCACATTCCGGACATCCCGCATATCCCTTTGGAA CCAAAAAAGCAAGTGGGCCAGCAGGGCCAGCATGGTGTTTGTAGAATGTA CGATTCTCTTATTTTGCCAAGGTTGCAAAGGTTTTATTTTACCCTAGAAT ATTATGCTGCATGTTCACCTATCAaccataggccatttcacagttgCAAA GCGTAATTGGTAATCAGGACCATTGCACACTAACCAACGGGAAACCGTTA TTTGGGCGCAATCaatcctgattacccatgatccatttcgactgtgaaat ggtctATTAAAGTATTTGAAGATATGCGTAAGTTTAGCAGGAAGAATTGA CGTTATTCCAAGAATAAATGGTCGAAATCCCACCTTGAATGTGACTTTGT GAACCATGGGTTTTTAGCTTCCTTTATACCTCTAGTTCATATTTTTCGAT GGTTTTCAGCCAGATTAAGTGGTACTAGGTTCGTACCAGTCTTAAGTTTA TCATTTTTTGTCGAGATGGagttttacaagctcttatttgattttgttgg tcattaaccagtaataaaactttttctaaagaacgcgtcatttttattac ttcaaatgaccaattaaagtatcttataaaaactccatctcatctgcttT ATTTCCTAGTAAACTCAAGCCCGGTGACCTTAACATTTTAAGGGCTGACA GAATTTTTTATATTGTCACCATAGCCTGTATCAATTGAACAACGGAAAAT ATTATATATTCTGGGCAATTGATAACCAATTACAAAACGATGTTGAAGTA CCAGGATGGGGGACTGTTTACACCGACATCCAAGTTTTGGTTACCGCTAA AGGATCGAATGTAGTGTCTGGTAAAATGAAAGAACTTAAGTTCCAACCTT CAAAAGGTAAAAATAATTCtattacagtatgtggcccccaaaacggcgat caaatttgaaatttctctcatatctagaggaaaagagattttacaaaaat ttttgctgcatgaaaacctttaacatNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNcaactgaaactgaaaatattaagctttaaagatatttttctc ctatattttgcaaaaaaatgacagaatttgccgtttttgctgattcagcg aaaatttttatttttataatgttattttttgttataaactattaactcaa ggtgataggaatagaattccaagattttttgctttttctgatatttagaa tttttggttttgtcaatgctgattcagggctccaaaatactggttgacct tcaagatgctatatcttttacccagcctctaaagtcacagatttacattt tctgaacggcattaggtgtagaaagtttcctataccccttattttcaata tccaagggagctagagtgagttatatgcaatttttatctaattttagttt taaaatatattctttagacgcaaatttgttattttgaatccgtctcaaac cagcaaaaacatgctcatttttaagtataaccatcattctttcaaaataa accaaaatcgtttaattctgataaatctacaagtcagaatcttcatttga atgaaaacctccgttttgggggccgtctccgttttgggggccatatactg tatgaAGAATCCTGATAGCNtctcgaaaaactatatagaagacttttaaa cgggtatagccgatttcattacctaactcgagataattcacgcagaagat gctatttatggtcaattttgcccaaagtgtggcgaaaagtggaacttgcg catgaaatatctcgagttaggtaatggAAATCAGCgataaccgtttaaaa gtcttctatatagtttttcgagtttcagctagatcttatttttttcctac aaacagcctgtatttttgtaacacgaccacactatacAGTATGTGCCACT Ctcctgaccatagtcggaaaaatagtcggaaaattgattttagtatttga acataaaagttctattttagattctttaacacttttaacaaagaacgTTA TTAAAGAACGTTAATGACGTTacgaactttaaaaagacgttaataatatg ttgcatcaccttcttttataaaaagtgctaagttttaatgggtaattaac ctttttgtttcgaagttttttcaaactgtcggcaaagaattgaaccgttt taaatttttcggaaaatttttcaaaattaatgcatcaaaagttatgttat ggttgtttttctataaaaaattgggatggaaaattggtcaaaaagcacga ttttcaagattttgaatcgaataagcttttaaaaaaattttccgaaaaac taattttagttcgataaaataaactaagctcttcaaagttgaaatactct tctgaGCAagagtcttcattttcttctttatcaattttttttcattgcga ttcttaaattttcagactcacagatggttggcctaacagaaaatgtataa catgtcaaatTTTCTCCGCTACATTAATACAAATTAATACAATAtcttca gtacagcccgaaaaaaccggtcgttattgtatttgttaaccgtttcctta agcttcgattgatttttagcgctttatctaGGAAAAATAgtgaaataaag cgaaaaaaaaaagcgaaaagagataaaaaattgttataatttctgagtca gtaataacaagcaacatgctgaatgaacctacctaatgattaacatcagt tgaaaataagaaaaaagtgacaataattgtacaaaaattcagaatggaaa aaaNNacgaaaatcacttaaaccattcagacccaaaaaaccttttaagct gtttttggcccaaatttgcccaaaaaaaatttccttaaaaatctggctcc gtcacattgtgggcattgtcattttgcatcattgtgcaaaaaatcagaaa aaaattatgagtcaacattgagaagctatattttcttatttggttaaaag gaatttccccaaaatacgaaaatccgtcttttaaccctattcgtactagg gggtggggggctctttctgttcggaggtcaaactcttgctaatagctcct gaaataatagagcttttgccgtgaaattttctgtaaattcctaactttta tNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNTCacaaaattgacacttttccaatacaaatttattttcat tgtcaaatatatcgtttaaaccgtaatttattgaatatttagaataaaat aagcattttaaacgcaggcaatttttttctaaagcatTTGTTAGAacaca atagctatttataagaacaaaggaaattttcggtttttgctcactttagg catgagtgacgtcatcaaaaaaaatttttgtcaaaagttaccttgcgtca caaggatcttgtgtgccaaatttcatccaaaaagacacactagatcaaaa gttaaggggtggtacaggaaaagcccccccccctagttctgaaccgcccc taaaagcctaagttgaatagggttaaggcgaataagaattttccaggaaa aaacacttaagccattctttaaagaatcttgccctccatctttgtacaaa atatcagaaaaaagtaatgacaggattttgcacaaagtccaaaaaaccct atttttaggtagtttttggcccaaatttgcccaaatattatttttttcga aaatcgggctccgtcacattttaggcattgccattttgcatcattgtgca aaaaatcagaaaaaaataatgattcaactttgagaaaagctatattttct tatttggttaaagggagtttccccaaaatacgaaaatccgttttttaagg cgaataagaattttccgggaaaaaccacttcagccattctttagagaatc ttgccctccatcttNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNaatcagaaaaaagtaatgacagaa ttttgcacaaagtccaaaaaaccctatttttaggtagtttttggcccaaa tttgcccaaataaattttttctcaaaactcgggctccgtcacgttctggg cattgccattttgcatcattgtgcaaaaaatcagaaaaaactaatgagcc aatcctgagaaaaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNaa cgcattgttcattttcctttgaaaaagtgacgtcacaatgaattttccta acgacgggcaactctggacagtgtaggcccgtcgtcatgcgaaatgaaac aatgaattgcgcaaaaagccgtgtagctcgcttcgaaaaagtaaccggtt aacaataggcaaaaatgcatattttgaatgtggcaaatattaaaaattca ctatggtcagagcccttaagggtaccttttttggatttccaaagtcccgc taagggtcggaaaaatctgTAAGTAGCGTAGACATTTATGGAAGAGTGCT GGTTTTTAAAACACTGCAATACACAGGATGCGAAATTAAAGTCTGAAAat aaatcacgcttttactcgaaatttttatgtgcttgttacatgacatttct gattggttcaaatttattgacactaataaagttatcagctgtaagttgta aagcaagtaacataaaatcacgtgaacgttttcgagtaatcacatgtttt gactaaACTGATATCAtgttgcaacccgtgtattagctattcataatata aaagaATTATTAGTGTGTCATAAAATCTGAATtcctcttgtctacgctac tgactCCCCAAGATACTTGAAAACCTAAATCTAAAGAACCGCAAGCCACG TGGGTCCGTTAAACTTACAACCTcgagtttttttaattcaaagggagaat caaaatggtttgagaTAATTGGCcagcataaaatttctttgGTCCAGAGT AAAGCCTTCTATTGTATTTTTGTCTAACTATTTCTCAAAGCGGAGATAtc ccaatttgaaatttctaaaaatgggtTCCTTTACAGTTCTTAGGTCAAAA TTCTATTTGTTTTCTTACTAAAATTCAAAACTTGTAACTTGGATTTTTGG accccgattttcgaaaatagcaaaaatattttgagattttaatgATGAAA CTAGAAGGAATTCACacgccaaatatctcaaaccatttAATAACCCTTTT AACTTTGAActtataaagcattaaaaactaTTTCTTTTATAGGAATTACT TATAACAGtggattgttacaagaaatcaTTCCAAAATGGGGAAAATCATG GCTCATAAAAGTCTCATTCAAAGTTGTAAAGCAACCAATAGAGAAATGga attgtatttttcatttcgtaAAAGATGGAGGCTACTTTAACCGTCTACCG ACAATGTACTTCAAATCTGACACAAACGAAGTACAATTTGTACTTTGCCA AGACCCTACAAATCGTAATCTTTGCCTAAATACCTTCCTACCGTCATTTG TTTTAAATACAAAATATGATTTCGAAATCAAACATCAATTGGAAGGAAAT GGATATTATATGTCTGTTTACATCAATGGCGTACTAGAAAAACGTGACGT TACTTTTACCAACCCGGGAGTTTACGAGAATGTTGAAGTGTATATTGGAC CA

Coding sequence (CDS) from alignment at sc0000001:2147059..2156560+

>TCONS_00000113 ID=TCONS_00000113|Name=TCONS_00000113|organism=Clytia hemisphaerica|type=CDS|length=2916bp|location=Sequence derived from alignment at sc0000001:2147059..2156560+ (Clytia hemisphaerica)
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000061XLOC_000061Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000113-exon-sc0000001-1491911889:2147059..2147436TCONS_00000113-exon-sc0000001-1491911889:2147059..2147436Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1510915933:2147059..2147436TCONS_00000113-exon-sc0000001-1510915933:2147059..2147436Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1575043694:2147059..2147436TCONS_00000113-exon-sc0000001-1575043694:2147059..2147436Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1491911889:2148265..2148310TCONS_00000113-exon-sc0000001-1491911889:2148265..2148310Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1510915933:2148265..2148310TCONS_00000113-exon-sc0000001-1510915933:2148265..2148310Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1575043694:2148265..2148310TCONS_00000113-exon-sc0000001-1575043694:2148265..2148310Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1491911889:2149197..2149488TCONS_00000113-exon-sc0000001-1491911889:2149197..2149488Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1510915933:2149197..2149488TCONS_00000113-exon-sc0000001-1510915933:2149197..2149488Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1575043694:2149197..2149488TCONS_00000113-exon-sc0000001-1575043694:2149197..2149488Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1491911889:2156151..2156560TCONS_00000113-exon-sc0000001-1491911889:2156151..2156560Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1510915933:2156151..2156560TCONS_00000113-exon-sc0000001-1510915933:2156151..2156560Clytia hemisphaericaexon
TCONS_00000113-exon-sc0000001-1575043694:2156151..2156560TCONS_00000113-exon-sc0000001-1575043694:2156151..2156560Clytia hemisphaericaexon
The following polypeptide feature(s) derives from this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000113-proteinTCONS_00000113-proteinClytia hemisphaericapolypeptide
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2147059..2156560 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.0773778 0.0754556 0.0438056 0.0428569 0.0521742 0.0412287 0 0 0.0978072 0 0.391971 0.103066 1.66547 1.76859 0.549825 0.741756 1.48123 1.66223 3.05615 2.6062 2.36136 2.14615 0.464471 1.37248 1.55008 2.07325 0.371351 0.113233 0.0429417 0.0875016
The following BLAST results are available for this feature:
BLAST of TCONS_00000113 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Spatial Expression
in the tripal_feature_cv_term.tpl.php