Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00000075 (transcript) - C. hemisphaerica

Unique NameTCONS_00000075
OrganismClytia hemisphaerica (Jellyfish)
Sequence length276

The following sequences are available for this feature:

transcript sequence

>TCONS_00000075 ID=TCONS_00000075|Name=TCONS_00000075|organism=Clytia hemisphaerica|type=transcript|length=276bp

transcript from alignment at sc0000001:1662722..1667190+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000075 ID=TCONS_00000075|Name=TCONS_00000075|organism=Clytia hemisphaerica|type=transcript|length=4469bp|location=Sequence derived from alignment at sc0000001:1662722..1667190+ (Clytia hemisphaerica)
ACTTCACGTCAAGAAAGTTGAAATCAAAGTACAAGGGTCTACCGCATTCA CAACTCAACAACCGTGGATATATTCCGGAACGGTTCGGCAAAATATACTC TTTGGTAGAGAGTACAAAAAGGACTTGTACCAAACGGTCATCAAAGCCTG TGGAATGCACACTGTAAGATTTGATATTTTGTTACATGATTTTAGagtaa gaccatgttcagacgttacggttccgttccgttccgttccgaaacggttc tgaaacaagtgtgaacgtcaaaattcgaacctcgaaaaagaagacgttac aaagcaaaacaaatagaaacggtttcgctccacttttttcatcggaacgg aactgctccgttttctcgCTCAGAAACTTttcgaaaccaatatgaacaaa atcataccggaacgaaacggaacagtaacgtgtgaacatggccTAAGGAT AAGGTCAGGATGGTGCAGTAGCCTAATAACTGTGGCGCCAAGCGGGAggt ccgggttcgattcccgaaAGTGTCTTTGTCTTATATCCCTCCATAATCTA TACAGCTCGTGACCATAGCAAACTTAGTTCTCTATCTAGTTCCAATCTAT AAATGTAgtacccactgacctttatataccctgtaccaagcttctcaatc ccagccaagcaatcTTTAccaatctttgatcggagttttttgacaATTGG TACCCTACTGTTGGTACCCAAttggcggcactactcgatagcggtgtaaa tgcatcgaaaGCGCTAGGTctatttttcctcaaattcttttgatgatgta gcggcgtgagacgttaatttttaacattgcaatagcTTCTCCTCGgttac caattccaaaaaaactccaatcaaagatggcagatattgcttggtcccgg gttatataaaggtcagtggtggTACCACAGTGTGAATAAATCACTGGTCT TCGGCACCCCATGTTGCGCCGTGTTTGTTTAACCACAAGTGAGTTAAGAC TTGCCAAAATAATCTTACTATCGGGCCATATAGGATAAGGTAATGTAGCT TCTCAGCTACGGAAATGGCTAATTGATTGATAAGGTTAATACGCTTTAAC GTTAAGGTTGTTTTCTGAGCTTTTAAAAGTTGCGGAGATCGATGGTCATA AATGACActaaaaccttattttttatttgtttgtatTATATTCGAAATCC CTCTTTTATTTGAATCAAGTCTAAGAACATCTGATGATTAGAAGAtattg tcaaaatatttttaaaattggttgaagattttttaaatcaacttGAAAAG GACACTACTGTTAGAGGTCGAAGTATCGTTTAAAAACACATTGTTtggct ttttggacctacttggaggtcctatagaatttaacctgtgttcgtccgtc cattcgtccgttcgttcgtccgttcgtctgttaccaacttttctcgggat tgaatcataggaattttgtgatttttggtacaaggtgcaaaatggtgatt accaaaatgtgacggagctcgatgtaagaaataagaaaaaaatttgggga gGGGgccaaaatggccaaaaatagggtttttggactttgtgaaaagtccg tttattagtttttcctgattttttataCAAAGACGTAAAATTAAATTGCT TAATatgaaaaacttcatttttcgaaaataatatttttggcaccaacttg caaaattttaaattattcagttttttttgcTACATTGCCTTcattaaact tttattattcgtcttataaacaggtaggtccataaaagtatcgcttgttt ttctggaaaaacccatTTCAACAAATATTATTCATCAAAAGCCTTCATTc gcttatatataaaaacaacACCAGTGTTGGAATGAGCTTGAGTTCTAATa agaccccggggggggggggNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNcgaggtgacgggtatgtccgagccgaaaatcga aaatcgaccctttgagagacaaaattttgttgattttgggaccctttgag agactttttcctaaattttggtccattttttccaaattttggtttgattt tcaccaaatttttgTCNATTCGTCTATCAAAAACACAGCGTTGATACGAA GGTATGActaatttatttgataaataaTATTGTTACTGGTATTGAAATCT AATCATGTCAACAAATATTATTCAGCAAAAGccttagacgatgctatcgt ccgtattaTATATTAtcatgatataacatagtttgtatattataaaacgt aatatgttgcgcGGCGGAAAATAAAGTCTGTGATCCACGTTTGTtcctta gatgaaactcgtcttagactaagTAGTCTACCAAAGCCTTCGTTcgctta tatataaaaacatcACCAGTGTTTGAATGAGCTTAAGAGCTCTTATAAGA CACTTCActattggtcatttgaagtaatggAGTTAACACGTTTTAAGAAA AAGTAGCaatattgttttattacaggttaaagGCCAactaaatcaaataa gagcttgtaaaaactccgtCTTGTTCCcaacccagccggcacacaacgtt gttttaacgttcaaataacgttatttggacctTATGAAtgatggacgttg ttttgacgttgtttgCCGTCTGGGAAGTGTTATGAGAGAAAAAAGTTGTC ACTGTATAAATTTTGTTGagttgataaaataaaaaaaatctcccTTGACT CCTTACAGTATTAAATGGGTGTTACTCTCTTTGATAATTtcctacacccc tgtctcacagccttggtggaactttttttctcagtggggataaaaattct tattaatttcgcatagcgaaagcaTTATAATTAGTTTTCTGCGTTGGCAT TCGTTCTTCGTGTTCATAGTGCTCCACATGTTGTTCTAGGACATTCTAGA ATATCCTCccaatacactcttttttttataagaatacactttataagaat gtccatgatgaaaatggccaaaaattaagaataatgctaagaatatcgtt atcatggaatttggctactcaagctaagaatgccatttttagagcatttt cattataaattgccaatcaCCCCCAAGTAAGACTCACTCCTATGCTTGAG ACAAacgtactaaatgttaaatctagtctgaattaggatcctaacctaag aatgctgtaagaatactttctcaaaaaagttaagaatatatcCATCATTA AATGGAtatacaccattcttataaaaaaagcgtatatTCTAGAGATAGTC TCACGCACAAAGCGTTTCTCAAATGATTCTAGTACGCAAGTTTGAGGTAA GTGTAACCAAGGGTTTGTTCCTCGTGAAAGCTTTTTATTAATGCTTGAAG TGTGAAGGCTAAAACTGCTGCTTCATTGAAAAActgagaggaataatcct tttcaatcggtgattcaagctttcatattattcctgtctctaaagaaggg tgtcggaattagacgagggatgtcgatattagaccagcTTACGGTAGTGA Tataaaatggcaatgtttaatttctgatggagcccgattttcgaaaaaaa tatttttttgggcaaatttggaccaaaaagtgcctaatatgggttttttt ggactttggggGAATATCACCTTTTATCGTTAATAAGGTAATAGGTAATT AGTTTTACTAAAATATCTATAGACGATGTATGGCTTTTATTTCCAAGAAG ATTCTGAGAGAATTATTAACACGCCGGGTAGTAATAGTGTCATATTGCAC TTAAACTTTTCGCAATCTTTGTGAGTTTTTGACTTCTTAACGAAAGCAAG TTTTCGACTTCGCCAAACTTCCGCAAAACTATCTGCCCCTTAAagtatat tagcgagtttatgtatcggaggatatcgagggtaAGTGAAAGTGAGGCGC TAACCAAAGTCGATAATTGATGTActgctctatatcgcctttgctcacct agaCAGACGACgctattttgatgtttttaccgtcgtcaaGCAAAAGGGAC AGCGATTTTGGTAACATGtaaactttgctttataccgtatccttcgattt atctcgaatacataaagtTCTTTCTTTATAGAAAACAGTCATGTAAACTT TCTCACTTTCTGAATTTTACCTTTTAAACAAAAGTAGGCTTTTGATCTTG CGAAATTTCCGCAAAACTATCTGTCCTCTTTctaacatatttttcttttt cgacaGAACGTTATAATTGTCCTGAAGATGAACAAGAGCAGGAGGAAACC AACCACCATTCGCCGACGCTTTCAGCCATCGCAAATTCTCATCAATCGTA CCCAAAGCCAACAGacagg
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000039XLOC_000039Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000075-exon-sc0000001-1491911889:1662722..1662884TCONS_00000075-exon-sc0000001-1491911889:1662722..1662884Clytia hemisphaericaexon
TCONS_00000075-exon-sc0000001-1510915933:1662722..1662884TCONS_00000075-exon-sc0000001-1510915933:1662722..1662884Clytia hemisphaericaexon
TCONS_00000075-exon-sc0000001-1575043694:1662722..1662884TCONS_00000075-exon-sc0000001-1575043694:1662722..1662884Clytia hemisphaericaexon
TCONS_00000075-exon-sc0000001-1491911889:1667078..1667190TCONS_00000075-exon-sc0000001-1491911889:1667078..1667190Clytia hemisphaericaexon
TCONS_00000075-exon-sc0000001-1510915933:1667078..1667190TCONS_00000075-exon-sc0000001-1510915933:1667078..1667190Clytia hemisphaericaexon
TCONS_00000075-exon-sc0000001-1575043694:1667078..1667190TCONS_00000075-exon-sc0000001-1575043694:1667078..1667190Clytia hemisphaericaexon
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:1662722..1667190 +

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.521429 0 0.590389 1.15521 1.40635 0 0.670379 0.627601 0.878797 1.6328 2.11311 0.694538 1.04036 1.08042 2.07259 3.81293 1.95717 2.00604 0 0.580025 3.52903 4.4263 1.19572 1.08708 1.67951 0 1.42997 1.5261 1.73624 1.1793
The following BLAST results are available for this feature:
BLAST of TCONS_00000075 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top