TCONS_00000068 (transcript) - C. hemisphaerica

Overview
Name
Unique NameTCONS_00000068
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length864

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000068 ID=TCONS_00000068|Name=|organism=Clytia hemisphaerica|type=transcript|length=864bp
Atctcattttttgtttgtttgaataaaattattcaataaattaaaaaaaa
atattgaaaataaaaaataaaattataaattttcacaCTTAAAAAAAAGT
AGagcaagaaaaaatcaaaaacaaaaacaaaactcgTCCAATCAGAATTA
CGTATATCAAGATCTTGTTGAATACATATCAGAATCTTCAGGATCAGATT
GTCCAAGATCACCTTCAATAATTATATTTTCTTGATTAGCTGCCGTATCT
AAGTCTAGTCTAGTATCTTTATCATCAACAACTTTTTCATCATCTAATGA
AACGACAGATATTTCTTGAAGTTCAGTTTGTCCAGGATCAAAGTCTTGTA
CCTCATTATTTGACACAGGTACCTCTGTATTTTCCTCGCCAACTATTTCT
TCACTTCTTTCATTTGATACGTTATCATTAACAGAATCAGGCACAACTTC
AGCGGATCCACCTTCAGATTCCACAACCTCAGTCAGTTCTGCTACAACTT
CTTCTTGTGGCGTCGGCGTCGGCGGCGGAGGCGGTGGTTGAGTTTCATCT
TCAATCACAGAAATGATTTCCTCAACTACCTCAGTTGCAGGAGCACTGAC
TTCTTCTTCCTCGGTAGAGGTAACAGCCTCTGATATCACAATTTCAGATT
CTACTACTTCATCAGGCTCGTTTTTATCATCTAAAATTTCGACAACACGC
TCTGTGGTTGTTGGTGCACTTGGTGCAAAGAGTTGAGCAATGGAAGAAGC
GGTATGATAATAACTCGTCTCAGCAATGTCAAGTGTTCGCTCGGGGTAAG
ATATAGCAGCAGCTGTTGTTCCAAAGAGTAATCCATACAATGACCTTTTG
ATGGGTCTTCCTAT
Run BLAST on NCBI

transcript from alignment at sc0000001:1500623..1501546+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000068 ID=TCONS_00000068|Name=TCONS_00000068|organism=Clytia hemisphaerica|type=transcript|length=924bp|location=Sequence derived from alignment at sc0000001:1500623..1501546+ (Clytia hemisphaerica)
Atctcattttttgtttgtttgaataaaattattcaataaattaaaaaaaa atattgaaaataaaaaataaaattataaattttcacaCTTAAAAAAAAGT AGagcaagaaaaaatcaaaaacaaaaacaaaactcgTCCAATCAGAATTA CGTATATCAAGATCTTGTTGAATACATATCAGAATCTTCAGGATCAGATT GTCCAAGATCACCTTCAATAATTATATTTTCTTGATTAGCTGCCGTATCT AAGTCTAGTCTAGTATCTTTATCATCAACAACTTTTTCATCATCTAATGA AACGACAGATATTTCTTGAAGTTCAGTTTGTCCAGGATCAAAGTCTTGTA CCTCATTATTTGACACAGGTACCTCTGTATTTTCCTCGCCAACTATTTCT TCACTTCTTTCATTTGATACGTTATCATTAACAGAATCAGGCACAACTTC AGCGGATCCACCTTCAGATTCCACAACCTCAGTCAGTTCTGCTACAACTT CTTCTTGTGGCGTCGGCGTCGGCGGCGGAGGCGGTGANTCCACAACTTCA GTCAGTTCTGTTACAATTTCTTCTTGCAGCGGCGGTGGAGGCGGTGGTTG AGTTTCATCTTCAATCACAGAAATGATTTCCTCAACTACCTCAGTTGCAG GAGCACTGACTTCTTCTTCCTCGGTAGAGGTAACAGCCTCTGATATCACA ATTTCAGATTCTACTACTTCATCAGGCTCGTTTTTATCATCTAAAATTTC GACAACACGCTCTGTGGTTGTTGGTGCACTTGGTGCAAAGAGTTGAGCAA TGGAAGAAGCGGTATGATAATAACTCGTCTCAGCAATGTCAAGTGTTCGC TCGGGGTAAGATATAGCAGCAGCTGTTGTTCCAAAGAGTAATCCATACAA TGACCTTTTGATGGGTCTTCCTAT
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000034XLOC_000034Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000068-exon-sc0000001-1491911889:1500623..1501152TCONS_00000068-exon-sc0000001-1491911889:1500623..1501152Clytia hemisphaericaexon
TCONS_00000068-exon-sc0000001-1510915933:1500623..1501152TCONS_00000068-exon-sc0000001-1510915933:1500623..1501152Clytia hemisphaericaexon
TCONS_00000068-exon-sc0000001-1575043694:1500623..1501152TCONS_00000068-exon-sc0000001-1575043694:1500623..1501152Clytia hemisphaericaexon
TCONS_00000068-exon-sc0000001-1491911889:1501213..1501546TCONS_00000068-exon-sc0000001-1491911889:1501213..1501546Clytia hemisphaericaexon
TCONS_00000068-exon-sc0000001-1510915933:1501213..1501546TCONS_00000068-exon-sc0000001-1510915933:1501213..1501546Clytia hemisphaericaexon
TCONS_00000068-exon-sc0000001-1575043694:1501213..1501546TCONS_00000068-exon-sc0000001-1575043694:1501213..1501546Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:1500623..1501546 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
37.6183 31.7624 27.3068 26.3733 10.2577 5.85565 15.3619 19.1525 24.9241 21.6048 13.6766 18.0118 12.3196 14.1703 12.4711 16.3633 45.0452 42.849 13.6225 16.5277 21.4347 20.47 34.4107 32.6311 12.6917 12.8712 32.7509 22.6118 31.0242 31.2131
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
TermDefinition
IPR009080tRNAsynth_Ia_anticodon-bd
Vocabulary: Biological Process
TermDefinition
GO:0006418tRNA aminoacylation for protein translation
Vocabulary: Molecular Function
TermDefinition
GO:0004812aminoacyl-tRNA ligase activity
GO:0000166nucleotide binding
GO:0005524ATP binding
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006418 tRNA aminoacylation for protein translation
molecular_function GO:0004812 aminoacyl-tRNA ligase activity
molecular_function GO:0005524 ATP binding
molecular_function GO:0000166 nucleotide binding
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00000068 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Spatial Expression
in the tripal_feature_cv_term.tpl.php