TCONS_00000056 (transcript) - C. hemisphaerica

Overview
Name
Unique NameTCONS_00000056
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1882

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000056 ID=TCONS_00000056|Name=|organism=Clytia hemisphaerica|type=transcript|length=1882bp
agacaaacgtatttattactttttctaaagaacgcgtcatccctattgtt
tagaaataaccaatcagttaagcatcttgtaaaaactccagctcatccca
aattTTGATGAACCTATTATGTAACTCTGGTCCCACTGATCTTGCTAAAT
AGGTCACTTGAAACGCAGTTTTAactaaatttgttaaaaatagCCATAAA
AACAACAATCCTGGTTCCTATTACGCAATGCAATATACTACAATGTGTTA
TTTTTGTTCTCCCTTTTTACAAGAAATAGATCATTTCTTAGGACAGACTT
TGGACCCTCATCAAAAAACATGCAAAACTTTCGATTTATGAATTTGCACA
AACAGCATTACACATtataaatacttttttgaagcaCATAGTCTTATTTT
AGATCAACATGACAGTCGGTGGATGGAATGGAGTTTCTACTTTGGATTAA
TGAGCTGTTTcagatttgaaataattataaatatcaaagttttgaaatat
tgtggtacagtcaactctctctaattcgaacctctataattcgaatattt
tttaattcaagaGAGTCAATCGTAGAACTAATTGAAAGGTTTTTGGATGG
TACAACTTGATCGATGCTAACAAAGTTAAACAAACTTAATTACCTTAATC
GTAATCTGAGCATACTTTCCTTATCACCAAAGCAGCAGCCAATCAAAATG
TCCACAACGTCGTCACAGTTCACACTTTCAATTGTTGACTACCTCGTCTT
TGCGATCGTCTTGGTGGCGTCTAGTGTCATTGGGATCTATTTCGCTCGTA
AAGGCAAACCCGCATCATCACCATCATCGAAAGAGAAGAACGAACGACTA
AACATCCTGAGTAAACAAGGAACGAAAGATACAAACGAAAATGGTGATAA
TCAGAAGGAGACTGATGAATATTTAGTCGGTGGACGAAACATGCATTGGT
TTCCACTTTCAATTTCCTTTATGGCAACATACATCTCTGCAAGCTCTTTA
TTGGGTATTCCAGCGGAGATTTACACATATggttttcaatatattgtctc
TTGTGGTGCACTGTTTGTCTCAACCTTTTTCACTTGGTACATTTTCATAC
CGATCTTCTACAGACTGAAAATTGTGTGTGCGAATGAGTATTTAGAATTA
CGATTTTCAAGAGGTGTTCGAAATATCGGCTGCATCATCATGTCAATTTA
CATGTTGATTAGCTTGTCGATCGGTTTATATGGGCCAGCCCTGGCATTTG
AAGCAGTTGGCGGTGTTCCACTTTACGTATCTATTACAGTGACTggtctg
gtctgtattttctaCACAACGATAGGAGGTATCAAAGCAGTTGTATGGAC
AGATTGTTTTCAAGCATTCGTAATGATCGCAGGTCTACTCGTCGTTATCA
TCATCGGGGTGGAAGAGGTCGGGAGTATTgggaagatttttgaaaaagca
cAGCAAGGTGAAAGAATACATATTCTAAACTTTGATCCAGACCCCCGTAT
TCGAAACACTTTTTGGTCACTAATCTTTGGTGTTGGGTTTACCATCTTAC
CAGCATGGGCTGTCGGTCAACAATCTGTTCAACGCTTCCAGGCTGCCAAA
TCAATGAAAGAGGCTAGACTAGCATTATTATGGAACTTCCCATCAATGTT
GTTTATCTCATTGCTGGCAATGTTAGCAGGTTTGGTGATATATGCAGTGA
ATGCAGATTGTGATGTTGGAGTTTATGGGTTGCATCTTGTGGACAGGAAT
GACCAGGTATTACCTTACTTCATCATGCAGAAGTTGGGACATTTGACCGG
AATTCCCGGGTTGTTCATGGCAGTGCTCTTTAGCAGTGCTTTGAGGTTTC
AGGTGCTTCCGTTTAAAACATTACGTCGTGAG
Run BLAST on NCBI

transcript from alignment at sc0000001:1388720..1403424+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000056 ID=TCONS_00000056|Name=TCONS_00000056|organism=Clytia hemisphaerica|type=transcript|length=14705bp|location=Sequence derived from alignment at sc0000001:1388720..1403424+ (Clytia hemisphaerica)
agacaaacgtatttattactttttctaaagaacgcgtcatccctattgtt tagaaataaccaatcagttaagcatcttgtaaaaactccagctcatccca aattTTGATGAACCTATTATGTAACTCTGGTCCCACTGATCTTGCTAAAT AGGTCACTTGAAACGCAGTTTTAactaaatttgttaaaaatagCCATAAA AACAACAATCCTGGTTCCTATTACGCAATGCAATATACTACAATGTGTTA TTTTTGTTCTCCCTTTTTACAAGAAATAGATCATTTCTTAGGACAGACTT TGGACCCTCATCAAAAAACATGCAAAACTTTCGATTTATGAATTTGCACA AACAGCATTACACATtataaatacttttttgaagcaCATAGTCTTATTTT AGATCAACATGACAGTCGGTGGATGGAATGGAGTTTCTACTTTGGATTAA TGAGCTGTTTcagatttgaaataattataaatatcaaagttttgaaatat tgtggtacagtcaactctctctaattcgaacctctataattcgaatattt tttaattcaagaGAGTCAATCGTAGAACTAATTGAAAGGTTTTTGGATGG TACAACTTGATCGATGCTAACAAAGTTAAACAAACTTAATTACCTTAATC GTAATCTGAGCATACTTTCCTTATCACCAAAGCAGCAGCCAATCAAAATG TCCACAACGTCGTCACAGTTCACACTTTCAATTGTTGACTACCTCGTCTT TGCGATCGTCTTGGTGGCGTCTAGTGTCATTGGGATCTATTTCGCTCGTA AAGGCAAACCCGCATCATCACCATCATCGAAAGAGAAGAACGAACGACTA AACATCCTGAGTAAACAAGGAACGAAAGGTATTTtggaaaatacaatttt tttttataagaaccagtaaattttggatCAGACTGGGCTGtttctaattt ttcaggcttattAAGATGCTTATTAgtgtttctttacttaaaatccTTTA ATATCTGTACTCAGATTATTATAGcatcttataaaattattcttatgaaa aagcgTGTACCTTAATTTCCTTAATTTTCGCGCGCTTTTTATTTTCGCGC CTCTAATTTTCGCGCCTTTCATTTTCGTGCAGCTCGTAAAATAGAATATT CGCGCatcctttaattttcgcgcattttGCAATTTCTGGGATACTTTCTG AGTGTTTTTGACGATTTTAAGTGAGTTTTACTCACTTTCAGTGTGTATTC AAGCTAGATTTTACATCCCAGATGCATATTTACCATGAATCGAGGTccta ttttattaaaaaagtcaTAAGATGAGATTTCCACACGTTCAGAACGATTA CTAGTTCGCGcaccctttaattttcgcgcggCCAAGTGCGCGAAAATAGG CCTATTACAAATAACCTATTTACATAACTACTATTTACCCTACAACAGAT GTTGTGGGGGCCCCTCTCCCGATGCATAGTTAACTTGAAATATCATCTCG TTTATTTCaatattcattaaactcacaATACTACTATGAAATTTACTGTA ATTTTCAGAATCCCCTCTGCTAGAACCCTAGGTTTCTGAGCCAATTAAAT TTACTGGTTGAACTGTTAAATGAGACAGGAGTGTGCCCGAGCAATCTGTC CAAGAAGTGCTGACTTAAGCGTGGAGTAGCCATGATTAGAAAAGTTCAGA ATATGACGTAGCCGGTAGGCGACCGTAGTGCAAAAGTAAAGCATCCGGCT ACGGGTTCACTACCCGGCAAAGTCATACCAAAGTGCTTCTAAGTTCTTAG TACAACATTGTACTATATAGCTATCATAAGTGGAACTTTCAAGTCACCTC CGAATGTGGGTACAGACTTTATCTTGAGCGCCGCCTATTTCTATTATTAG ATACAAACGAAAATGGTGATAATCAGAAGGAGACTGATGAATATTTAGTC GGTGGACGAAACATGCATTGGTTTCCACTTTCAATTTCCTTTATGGCAAC ATACATCTCTGCAAGCTCTTTATTGGGTATTCCAGCGGAGATTTACACAT ATggttttcaatatattgtctcTTGTGGTGCACTGTTTGTCTCAACCTTT TTCACTTGGTACATTTTCATACCGATCTTCTACAGACTGAAAATTGTGTG TGCGAATGAGGTAGGTTGTCAATATATTTAGCTGACAGTCATTGAAATTC GTTCAACctagtatctacggctaatttcaaaatgccgtagagggtctgtt gtcattgtttttctcattatttgagatttttcaaacctacCGCtccgatg gagtgttggtgagagaggggagatgATGAGAGAAGTGTGGCtatttaaaa atcatacttcatcgcagaggtttctgtatgggaatttttttatcaaacag ataATGCGCACAGAGTGGTTCTACAAAGCGATAAAAAGTGAAATAGGTAG ATCGCTAGTCACGTGATTTACCCCAGGACAAGGGATCAAATCGAGCCTTT TAccattcatgatatgcaccattgcaatgttttctaacattacatcacgg acctaACAGCTgatgattggttgcaagtgacgtattgactgattttacgc cactaacaaccaatcagctgttgggtctatgGTGTGATGTCGAAGACAAT GCAGTTATGCGCTTCATTGATACTCCCCCTGAACAATATACTTTCTAACC TTATGtacaattttttcttgaaaagcttATTGTTAGATTAGCCAACTTTC TCATtggcgagattatgtatcggagatattctactgctacggttgcgggg ctgcccatgcgggtcgtcaccaaaggcgacatgtcgttgtctactttgct ctgtacgggaaaacaccaaaacaccgtataagcaaagtcaacataatgcc gtacgtcaaatatcgaacttgctttcacccgccattacttgcattactcg ccatttccctcgccgctttaaccgtagccgtagagaattccagatacata atctcgctattatGAATATCTATACCCCAgttctttataaaaaataaaaa atccgcaatttcatcaattttttgaagaaataatttcaaatgGGAGACAA ACCTCAATTATGAAATGGTCAACCTCGTTCCCATTGCATTATTAAACATC ATCTACTCTGATGGCGCTAGAATATATTCTCTAATGTCAATCGGTAATGt gaataaagcctgggatacacggggacgaggctGTGAAATAAATTGTTTAA TACTTCTTTAAGAAACTTCTTACTTAATTTTACTTAATCAGTATTTAGAA TTACGATTTTCAAGAGGTGTTCGAAATATCGGCTGCATCATCATGTCAAT TTACATGGTAGGTAAATTTAGAATGTTCTCTGGctgaaattgaaataatt agTCTGTATCGCAGACTTTTATAGATATATTTCCTctaagaaactctttt cgctTAGAAGATTcatgagcagaagcctataaAGTAATTGAATATCAAAT GTCTACTCCAAACAACTCTTCTCATTCACAGACCCACTAGAACCgcttcc cactggaaaagttgGCCAAAAAATATCATCCTCAGTGGAAAGTTATACTC CAAATtgtgtccccactgaaaataataaaataaaccaatcctaaAATACA TGTAGTAATATGTTATTTTTCCCATCGCGATCCCCACTGAAATTTCTAAA TCCCCGAATATCAATTCTCATCGAgcttcagtccgttattttcaccccac tttctgaaaaatcctactgggtctgtgagaagggggtgtctccCAATCTG TGTCAGAGACAAGCAATAATTTTCTTGCCTGTAGGATTAAAATTAATGAC CAAAGGGAATATGAATTTCCTTTGCTTCTATTGGATAAGGCTAGTGAAAT TCAATATATTCTTGACGAACGTTTTTTCGGCCAAATTCTGCAGTGTGAAA TATTTGGCAGCAGTGTTTTCCCaggttttttaatattttttgcacaaaaa tcCTTTGTCTTTTATTTCGGTGGAGGTATACTGCCAAAATATAGATGGTA TTCGTTTTCTTTTCATATTGTTCAGTTGATTAGCTTGTCGATCGGTTTAT ATGGGCCAGCCCTGGCATTTGAAGCAGGTACGAAATATTTGATGTGTTTA AGAGTTTTCCATAGTGAATATAGATAAAAGATTGCTTTCTCGGGATTTCC AAACCAATCAAAATTATGTGCCCTGGCGATCAAAGCGTCCCGCTTAATCC ATCGCCAATCAAATTTATACAAAACACTGGATTTAGCAAACTTTTTTTCA TCGccaattttcaggattttcagaCTTCTGTCATATACTTTTTCTTCTCA TTTTCAGTTGGCGGTGTTCCACTTTACGTATCTATTACAGTGACTggtct ggtctgtattttctaCACAACGATAGTAAGTTTTCTTCGTTGTTTAAAGG TGGGATAGTGGtctttatttacaaaaagtcACTGGGCGAAAAGTGGAATT TCCAGTATAATGCAAGATCccaaaaaaaagatcaaaaaagacctggaaat gttatattttaaaaactttccggtctaatggaaattgttttaatcttttc aaaaattagaaaatcagaCTCCCAAAAACTTTGGAATGTGACTTTTATTT CAGGAACATTTCGTGAAAcatgatattttcaagtttttttaaatatttgt aACACCAATAcgctttcttagaaaaatccctaggCAAGTGATGATGTTTT CCCTGGCGAAAAACCATCCTGGTAAACTCCAAGGAAGTTATGCCAAAGTC TGTCACAAAAGTTACCAAGTTTTACCCGACGAAAAGTTTTACCCAACTAA GTTTTCCTCTTTAAGGGTATTAAAACATCAAATGTAATAAAAACGTGTGA ATTTTTCTATTAACAGGGAGGTATCAAAGCAGTTGTATGGACAGATTGTT TTCAAGCATTCGTAATGATCGCAGGTCTACTCGTCGTTATCATCATCGGG GTGGAAGAGGTCGGGAGTATTgggaagatttttgaaaaagcacAGCAAGG TGAAAGAATACATATTCTAAAGTAGGTAGCTctcagtgaattttttttaa gtctAGTGAGTCTTTCCATGAACTTCTAACGACTGGACGGAGAACtcatt gtttcaaaaacaaagcgCGGCTTTTTCCTTTTTGCAGAGAGCGCGTTGCc gccaaaaaattgaattttgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCATACTGTAA CATTgttgtcaaactaaaaataatgaatttttgttCTATTTTACAGGATG GCTATAAAAAGATTGGAAACAGATTGGGCGAAACATTGTCCAAGCTTTAA CGTAGCTACGGACTACAAACGTAAACCATGCTGGAGATAACATTTTAAGA GATGCAACCATTTGAATCAATCGGCAAATCTATGtatttatttggaaaat ttgtcgTTGAACCCGTTTGATGacgttttgaaaatattaacattttaatg ccattttttaaaagtttaaatggATGCAATCTATAATCAAACAATAAAGT TCAGATCTACAGCATCATGTGTCATGCCCTTATAAGAGACACATGAACCG TTACAGTAAACATCAATAGTTGACAACAAAAGACTAACTGGGGTGGACAA ATGATGTGTGGTTATTTTTCTGGTATTTGTGGTATATATACATTGATAGA TTTCTGATGGAATTACagtaattttttacattttgctttcaaattttctg CTCTTTAGAATGAATTTGCACACTGtatatactttaatcggattaatttt cgcgtgattaaatttcgcgatttcgcgaatttttgccattttcgcgaaat taaaactcgcatacacgcgtgagattcctggttcgcgaaattaaatccaa aacttttaaaattgtatttttggcggagaaactagttccaagtctccatt tttggcaaaaaatgcctattttcagctgttttctggcttattcgcgaaat taaatccacgcaaaatatttcaaaactctgactcacgaaattaaatccag aaaatttcgcgatttttttagctcgcgaaatttaatctcacaaaatttaa tccggttaaagtaatAACTGATTCCCTCACTGATACAAGAaattatgatt ttatttttcatatatatTTTATCAGACCTTATattaatttcttaaaattt acttcaattttttgaagtttttaaatgAGCATTTGCAGGATATTTTGCAC TTAGACctcaatttgaaaattatttaatgNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNCCTTTCTTAACCGAAATACCACctcaaaattaaagtaaaatttaaatA CATTCAGCAGAATGTCAGCACTGTTGTTTTGGACtccaatatttttataa agcttttaaaattAATCTTTGTTTCAGTCTAATAAATTAAAATCATCCTA ATTAcagtagaaaaaagttttcattaccAAAAATAACATaagtaaaattc aatcaaaattgttgaaataaaatttctaaataaaaattgatttttgccaC TACATTCCAGAGTCACTGCCAATTTATGTTCACGTAAAATTTTGGTCATT GTGCAGCTATGACCTTACCATCGCTGGGAGTGTCAATATTGTCAgcaaac aaaataacaaaaaagctgACCATCATTCCATTGCAGTCTTTCANTCGTAA ATACATGTAATTCATCTTTCTTGACATCAGCATCTCTCATCTGCTCCTCA TACAAATCCCGTTCAGTGAATAAATGTTAGTCGTGGATATAACCATTTTC TGTTGTTGACACCACAGAATGAGAatcctaaaaatgtaaaaaaaatgtac tctttaaaaaaagcaattttgacAAGGTATAtattatttaattttctatA CATTTGAGTGAAGGACAGTGAAGGTAGTAGGGTAGTAGTTCTTCGAAAGC TTATTTGCTAAATTGTTTCCTGTACTATCAGTAATGTATAAGAGGGAAGA TttgtgaaaatcaaaaaaaatttaatgattttagtTAGAGAGTCGAAGAA ACCTCATCAGCCTGTCAGCATTCTCATTCAACATACTTTTCCCTCTCTTT TCGtagaaaaaacaaataaatattcaaCTCCTACCTTTATATTTGGATGT GAATCTGTATTTAAAAGATTGCCAATATATATTGtcgatattttgatgaa aaagcttgtaaaagtcaaaaatttccacTTCACACTGATGGTGGGAGAGT GCTTTCgaaaaagattgtttttttgcCCGACATTCATACAAATCACAACA ACTGGGTTATCGAGACCTCGACTTTTTCTGATGCAATATCACGTGAACAG AACGTCATCATCCTATTTATTTGAAACAATGAAAGAGGTGTATCTCCTTT GAAGTCAATTCAAATGATATGAAATAAgattagaaaatttttcactaaaa aaccCTTGGGTAGTGCAACGTGGAGACAGGTTGGACAAGCGAATCAAAAG AATAAGGTTTAGTAGCAATAGTAGCAAGtaccttaaccctttaagtgccg atgtcgtatatatacgacatgggctatataggagggcgaagccctcctgt aatgcccagtttgatttAGAAATCGTTANNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAATTCA TTCTAGATCagaagatataagcccttaaagtttgaactagcaatttttaa aaaaaaacttagaaaaaaggaccctggcactcaaagggttaacaaAAACC GGGACTTTTATTCCGTTTCTTGGTGAGTTCCACAACTTTgatgacttttg aaaaatagaagccttccAAGTGTATTGAcgcaattttaattttttcggta ctgcaggagcttcgaaagctaaaagtgacgtcaaaaaatcgaatttttag ATAGATAGTCTCccaacattcgaaaaagtcgcaaagtggaaaagacgtta attgcgtagaaaaaaacgCTGGTAACGTCTAGTATAGGTTACAAGTACCT CACCAATAACCGGGACTTTTTATTCCGTTTCTTGGTGAGTTacactttga tgatttttggtaaaaagaagcctttcaagtgtatTGACGCAAATTCCGAA GACCTACGCTccaaactttcgaaaaagtcgcaaagtggaaaaAAGCCATT ACCAGAGGCGTATTTAGGGTAGGTCAAGTAGGTCAAGTGACATAGTTccg agaaattgaaaaacatgaaaaattgtGAAACAGGCAATCTTATTCCTCTT AGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTATTTAGagacttttatttt gataatccgAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACT TAGCAACACCCTTTTTGACCTCTTTCGCCCTAGCAAATCGGGATCATATT ATTACCGAGCTCAACTTCTCTAAAAATTCACGTGTAATGACCTTGAGTAA CTGCTTATATATCTGGCCGCCTTTCATTTAGAGATAATATGAAGCCGAGA GACATAGCTAGAAATGGCTGAAACGACCtagcaaaatttctaaaaaaatc ggGGTAATAGCTATGAGGCTACGTACAGCTTCTCTGTCgagtttattaaa aaacaatacTCAATTCACATTTCCTAGCTTATCTCTTTCACAGTTTTTAT TGAGAGAAGCTCAGTTTCCAGAGCTGAAATTTGCTGAAGCGACCCAGTTA ACTTTTgagtttgatctgaaattttgtgaaagtcCAAGTAACTTTCACGT CTTAACTGTGATTTTATAGCTTTAATTCTTATGGATCGATTGCTAAGAAT TGATCGTCATGATATTAAGCATCAGCACCAGTTGTCACTGCTTTAAGTTG AACtaataatgtttattttttaacaaaaatgaagcatttttcaaagtctt ttaaaactttgtttttttcctGCTTTTTGGTTGTTGTTGTGAGCGGAAAT GAATATATTAGAATGATTTGACACCATTTAATTACcttatattcaattca aaacataaaaaataattttggggaTATAAAGGCCTATAAACTCAACTATA ACTCATCTATATTTCTTGTTTTGGGGAAACGAACATTGCTCCACATCAGT ATctatttttttaccacaagcggTTAANNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTCCAGCTTT GATCCAGACCCCCGTATTCGAAACACTTTTTGGTCACTAATCTTTGGTGT TGGGTTTACCATCTTACCAGCATGGGCTGTCGGTCAACAATCTGTTCAAC GCTTCCAGGCTGCCAAATCAATGAAAGAGGCTAGACTGTAAGTTTTAAGA ACAAGAGGTTCTTGTATGGAGGCAACCGGGGGACGCCCTGTATCCTAGGC TTTATTTGCGTTACTGATAGACGAATACCCCGGTGTTGGTTGATGCGAGG ACCCTCTCTAAAAGGGGGAACTTCTCAATACACCCCTATATCACAGCCCT GGccgaacttttttcctcaatggggataaaaattcctactgaaatcccaa tggggatagaaattctattgttccaaggtttaaAATACAGTAAGATGGTT TTAGAGTCCAAtatttaaacattgaatttcgagtggggatgaaatcaatt AATcgggactgattgcgcctccataaaCAGCTTCCCGTTCGTTCGAAGCA AAAACATCCTAAATCATCGACCAGTGGAAAGTCGTTGTCAGATTGCAGTG GTTCTGATTAACCGTGATTCCTTTCGaatgtgaaatggcctatgatATAT CATGTCAATGGTTTGAAAAAAGCGACCGTAGCATGGAGGAAGAGCATCCA ACTACAGTGTGCAAGGCTGTGGGTTCGATCACCAGCTGAATCATACCAAC AAAGATTCACAAAatagtacttgatgcctctctgcttgatgctcagcaat taaagagacGAATCAAGGGTAAATGAAGAAACCCAGGGAACAGAGTGGTG CCCTCCTCTACCTTCGGGTAGGAAGTTTgggaaaagggagccttcgggtc gccctcgactgcggttgCAAACTTTACTTGCTTTATTACTTATGGTTTCA AAATCAAGAAAGCAAATGAAATCTTATTTTGGATTTTGTAATCTTTTGTA TTCCACAACAAGACAGGGTATTTCAATCAAAGAGCTTATAATACGCAGGT AACGCGGCTGGTATAGAGGTATCTGTATTGTAGTAGCAGAGACCTTAACA CATCATGACACAAACCGCTTAAGGCGTCTGTGCAAACTCATCATTCACAA TTTTGTAGTACCATTGTATAAGTCCTTAAGTTGAAATTACAGATCTTTAT TTAGAGCATTATTATGGAACTTCCCATCAATGTTGTTTATCTCATTGCTG GCAATGTTAGCAGGTTTGGTGATATATGCAGTGAATGCAGATTGTGATGT TGGAGTTTATGGGTTGCATCTTGTGGACAGGAATGACCAGGtagaaaaga aatgtttttgaaaactgTTAACCACACATTTATCATATTACTTTTCATAC TGAATgatgataaaattgaaaatgaaagaagaaaacatagaaaattatAT CCTTTGGTGCTAGAATCATCTTTGGTACAGAGATACTttaaaccattgag tttaaatcccgaagggctagagtagaatctctaacctttccaaGGCAAGA CAAAGTGAAGCCACTCATTTCCCACCCAGAGCGCGCCTAGAatgcgccgt aatcatgacaacggattgtatctagcggctcctttatttttgaggactgc attttttgaatctAGCGATagtttgtatgaaaaccacgcgcgggcgttct ggatgggaaataagtgattTCAGGGTAggtagaaaacctggcccacctct ctggcccgggccatatggcctacccttggcccaccctttggcccaccttc aaacattttttcccCCGATTTTATTCTCGGACAACCAGGTTATAATGATA TGTGTGCGTCGGTATGCGCTATATTTCATTATGATTTCATCATAAAGCGC GTTGGCGTTATTGCATCAGTCGTTTTACGACAAACAATTGGTCAAATCTT CTAAATGCTCTAAGAattaaacgcttttttttataagaatagtgtacttt ggatgagaggGTCAATTATTCTTaggaaagtgccaaaattgagggtgaaa tattcttaacgtaggTCTTGTCTATCTGACCAAGGGCTAAGTCCCTTAAA ATTTTTAAGCTATGTCAACAGAAGTCAGCCTAATGGTAGCACAATGTGCT CATGCACTAGGGATCCCAAGTTCGAGTCGGGTTCGGGTCAACGTCAAAGT TTTTCGCCATGTTTTGAaactttatgtttttttgggtgaagattccgaaa aaaggggaccgaagtcctgaaaagttgaagaGCGCTACAGGGGTTGTTGG CACCCGTACAGGACTTAACCAGACCCTCTCCCGGGGGTCCCCTTAATCTA TGTCAGGTGTATAGCTGTATAAAATGCagactttttagttttttttgttt atttcagtctcgttgttttttaaaaatgccagaaaaaccAAAGTCCAACC TCAGAATtggtttgcagattttcagaatgataagaatcaaatctttttta gagttgcaaggtgggccaaagggtaggccaagggtaggccatatggcccg ggccagagaggtgggccaggttttctaccTACCCGTGATTTCATTTCTCT ttcaggagtctcgagtctagccgtctggcttggaagtcaatgctTTAAGC CCTCTTGATTTCagaattgaaagcaaaattgCGGACTACTTAGCTCTATC AAGTGGCTAgattgtcaaaatattttgggtgttttgatttttgtttttgt tcgcAGGCGAACAATATAGGGATTAGGATTTTGTACCAGAAAAAGTGTAA TATCTTATGGACATTTTATGTCAATCAACAATTGAAAAAAGATCTGAAGA TCTGGTAATAGCAGCCTTGTTTACTTAGCTAAATGCTTATGCTATACATA GAAATCACCGTAATCCAGGGGGGATGGTACCCCAGTGAAGAATAATATTC TGCTACAAGTCGATTCATCTCAGAAAGTCTGATTGACTAATTTCTACTTA CAATGCAGGTATTACCTTACTTCATCATGCAGAAGTTGGGACATTTGACC GGAATTCCCGGGTTGTTCATGGCAGTGCTCTTTAGCAGTGCTTTGAGGTA AGTTTTCttcgaattttttcttttcaaattaataTTGAATCTTTTGTTAT AAAAATCTTTGCCACTATGTATTTCATTTTATACGGAAGTACCCAAAAGT TTAGTAGTTCTCTATCAAACTGAGATCAATGCGCACATATACACGTGTTG GCACTAAATGGTAAGTCCTTGATATTGATATCGTTGGGTACCCAAAAGAG AACCGGAcgtttgccactaattttgaatttaaacaataaaactatGGCAA ACACCCGGGTTATTTCAGGTTTCAGGTGCTTCCGTTTAAAACATTACGTC GTGAG
Gene-mRNA-Prot