TCONS_00000010 (transcript) - C. hemisphaerica

Overview
NameTCONS_00000010
Unique NameTCONS_00000010
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length755

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00000010 ID=TCONS_00000010|Name=TCONS_00000010|organism=Clytia hemisphaerica|type=transcript|length=755bp
TTGGCAACTAAATCTCTGTATATGGTGGCGAGTAGAAGTTTTTCTTGGCA
TGTAAGGAAAATCATTCTTTTAGTGTGTGTATGAAGTGTAATTGATTTGA
CTCTACTGATTtgatttgacaaatttttttaaagaagtagCAAATTTGAC
AACACAAAATgaactttttgaaattagttGTAACACTTTTGGCAACCATT
GCGTTGATCAATGAAAGTGAAGCAATGCCACCGCCACCACCGCCGCCATC
TAATCAACAACAATCTCAGCAACAACAAGAACAAACCCAACAACAGCAAG
AACAAACTCAAGAACAGCAGCAACAAACACAACAACAATCATCAGATCAA
CAGTTAGTTCAACCAGCGCAAATCTCACAAGTTACAAGCGAAGAAGCACC
GGAATGCCCAATGGAGCAATTACCATGTACAATATGTTCAGAAGGACTAA
AAACAAAATGTGGTTGTAAACCAGGTTGTGGCGAATGCACATCGATACCA
GGCTGGAATTATAGCTTCTGCTCGAATAAAGTCGAAGGACGCCCGTTAGA
TTAGAAACAAGTTTGAAGGAGGCTCAACGAAAGCTAACAACTGTCATATA
ACCCTAGATAAATTTGTTGTTAAATGAGGATTTGAATGATTTTGTAGAGA
ATATAGCTTATATTTGATGTACTTGttactgtacacgttttttattagaa
catccaccatctttgaagacttcagatgttcttaacttttttagtactaa
gccca
Run BLAST on NCBI

transcript from alignment at sc0000001:314485..317171+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00000010 ID=TCONS_00000010|Name=TCONS_00000010|organism=Clytia hemisphaerica|type=transcript|length=2687bp|location=Sequence derived from alignment at sc0000001:314485..317171+ (Clytia hemisphaerica)
TTGGCAACTAAATCTCTGTATATGGTGGCGAGTAGAAGTTTTTCTTGGCA TGTAAGGAAAATCATTCTTTTAGTGTGTGTATGAAGTGTAATTGATTTGA CTCTACTGATTtgatttgacaaatttttttaaagaagtagCAAATTTGAC AACACAAAATgagtaagtatttatttttttcgttaAGGTTCATCCCTGTC GTTTCCAAACTCAGGTTAACAGGGCCTCCTTAACACAAATGGACTGCTCT CAGATATAATGGTCTGTACAAATTAATAAAACGTCATCCAAATGATTTCA TTGATTCCCATATAGCCATTTCCAAACAGACAAAATGTTGCTTTTCATTG ATCACTTTTTTTCTTCGGAAAAAACGGTCTGTAAAATAACAATAAGCCAT CAAATGGTCACAAaaacattttggatgttcttattaccTCACATTTGACA CTGTTCTTTAGAATGCAGTGTTTTTTCAAGCTGTTTAGAAAAGTTTTTGg ccttatgaaaaaatatttcgactAGCTTTGCTGCAAGCTCATGCTAATTT TTATCGaactaaattttgttttaacttTTCGCCATTATCGAATAAGACGT TCAAATCTGGAGAANNaaccactattttgaagatttcgagacgaagaagc atttacaaaaattttccgcaaaaatttttattgttcggtaaaagatacac catctactgcgaaaaatatttcaaaatgcNNNatgtataacatgccatag ttttgttggttacatcagtcagaaaacacattttaaacacggcaattatg aaaaattcactatggtcagagcccttaagtacgCAATTCGAACGTTTAGC TTTCATACGTAATAATGGAAGTTACATAACGGACGTTaacttaaaaacat caaaaatccCTATAGCTATATCTCTATGGAATGCCACCACATCTCAAATT TTCATTCACCCTTGTAAACTTTGTTTGAATTGAAACGGGCCTTCTAAACA AACGTAGGTTGAAATGTACAATCGAGGTTATCCATGAAAAGGCTTTTGTA GAAatcttaatgttttttttttacattacagactttttgaaattagttGT AACACTTTTGGCAACCATTGCGTTGATCAATGAAAGTGAAGCAATGCCAC CGCCACCACCGCCGCCATCTAATCAACAACAATCTCAGCAACAACAAGAA CAAACCCAACAACAGCAAGAACAAACTCAAGAACAGCAGCAACAAACACA ACAACAATCATCAGATCAACAGTTAGTTCAACCAGCGCAAATCTCACAAG TTACAAGCGAAGAAGCACCGGTAATAACACCAGTTAAATTTCTAGTGGCA GGGGAttctatcgtctacacaagatcactaaaaaagggaaaagtTTAGAA AGCAGGATAAATTTAAAAACGGTGGTAAGCCcggcggagtaagcagtggc ggggGTGTTTACAGTGTTTGTTCCAAAGTCTACTGCCactttttttcccg taaaccgccctgacacCTTGACTCTGCGCGTATAGTTTTCCCGAgtttac tgaccctctaacGGACAATAGCATCGTCTAGGGAGGAGGTTAAAAATCAG ATAAAATGATGATGTTCATAAACATATAACTCATTTACAATGAACATTCT CAAATATGTGACTTCCCAAGCGAAtaaaagtacctgaaaatcggACCGGC TTTGTTACGGCATTATGAGTGGTCTAGTAGAGGTCAAATTGTTGCTTCAG ATCGGCCTTCATACCCTCTAGAAAATAGCGGTCCTGGTCTCTCGTTGGGC CGGTCGTGACCGCTCCTTAGACCTGATCTGGCCGTTAGTTAGTGTTTGTT GTTAGCTTACATCAATAAGTTATTATAAAAAGAAGTCTACTGATCGATAA TGAGACCGGTCTGGACTTGAACGCGCTTCGATGTGGCCGCTAAATTCACA GGAGTCGTAGCGGCCTTTTCGGAAAGTTTGTCAGTCATTTACTAACCCTA TCAAAAGACCTGAAGAACGGCCCGATTTccaaaatacttaaaatcgcttg aggAATCACATGTTATAAGTTAAAGTGAGCATAATAATTCAGTTCCTTTG AAAACaaacacccttacagtgtactttgggAAACTTGGAAAAGGGACCTT TgaagggccgcacgtatggtaggTCGCTTACCTTGAGTGGGATACCCCCG GTGGTATCTCTAGTTTcttaacccagctggcacacaacgttgtttcaacg ttcacctaacgttatatggacgacacaacgttgtgtgccagctaggaACA TTAAACGCCAtgtctttatttttctatttgtaGGAATGCCCAATGGAGCA ATTACCATGTACAATATGTTCAGAAGGACTAAAAACAAAATGTGGTTGTA AACCAGGTTGTGGCGAATGCACATCGATACCAGGCTGGAATTATAGCTTC TGCTCGAATAAAGTCGAAGGACGCCCGTTAGATTAGAAACAAGTTTGAAG GAGGCTCAACGAAAGCTAACAACTGTCATATAACCCTAGATAAATTTGTT GTTAAATGAGGATTTGAATGATTTTGTAGAGAATATAGCTTATATTTGAT GTACTTGttactgtacacgttttttattagaacatccaccatctttgaag acttcagatgttcttaacttttttagtactaagccca
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_000007XLOC_000007Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00000010-exon-sc0000001-1491911889:314485..314646TCONS_00000010-exon-sc0000001-1491911889:314485..314646Clytia hemisphaericaexon
TCONS_00000010-exon-sc0000001-1510915933:314485..314646TCONS_00000010-exon-sc0000001-1510915933:314485..314646Clytia hemisphaericaexon
TCONS_00000010-exon-sc0000001-1491911889:315566..315804TCONS_00000010-exon-sc0000001-1491911889:315566..315804Clytia hemisphaericaexon
TCONS_00000010-exon-sc0000001-1510915933:315566..315804TCONS_00000010-exon-sc0000001-1510915933:315566..315804Clytia hemisphaericaexon
TCONS_00000010-exon-sc0000001-1491911889:316818..317171TCONS_00000010-exon-sc0000001-1491911889:316818..317171Clytia hemisphaericaexon
TCONS_00000010-exon-sc0000001-1510915933:316818..317171TCONS_00000010-exon-sc0000001-1510915933:316818..317171Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:314485..317171 +
Expression

Hover the mouse over a column in the graph to view expression values.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.714753 0.253453 0.220713 0.575821 0.438129 0.346216 2.00493 1.40775 1.80693 2.02113 1.38245 0.510641 28.6253 27.8158 42.2611 35.4221 2.2243 11.4791 0.0125541 0 0 0.36772 0 1.15146 0.209291 0.80941 0 0 0 0.440873
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00000010 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Spatial Expression
in the tripal_feature_cv_term.tpl.php