Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_045869 (gene) - C. hemisphaerica

Overview
NameXLOC_045869
Unique NameXLOC_045869
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at scaffold_99:19814..20674-

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_045869 ID=XLOC_045869|Name=XLOC_045869|organism=Clytia hemisphaerica|type=gene|length=861bp|location=Sequence derived from alignment at scaffold_99:19814..20674- (Clytia hemisphaerica)
TGCATCTGCTTGTGTCTTTGTTTTAGGTTATTTACGATTCAAATATTGGC TTGAAAGTAGAAGAGCAAACATTGGTTCCCTCTCGCATCAAGAATGGAAA GTTTCACACCCAAAAGGTAGCGCCCTCGTGTGACGCCCTTCTGTGACGCC CACTTTGAATTTGAAATCTGCCAATTTTTAGAAATTTGCCAACAAATAGG ATTCGTATTGTGTTACTAGGTTCAACAGAGAAAAGTTTCTGATTTCCATT TTTCAGCGATTTCAAAGTAGAAAATTTGATGAAAATTGACTTCTTAGAGA TTCTGACTACGCTAACGTGCTGTTGTTTCTTTGGTTTAAAGTTGGAAGTT AATAAATCAAAATAAGCGGTCTGGTCGCTAAAGGGTATAGGGAGATTGAT TCTACTAAAATCATTTTTTGTCTCTTAAATATTTTTCTCGCTGTTTTTTT ATTTGTCAGCGCTACACGATCCAATTAGTGGAATATTTCCAAGAAAATCA TTGGAGGTATTTATTCGGACTTGAAATTTCTTACTGTAGCTGCTTGATGC AGGCATTTTTTCAATTATCGGGTCAGGGCTGGGGTCGCTTGGCTCATTTT CTGAAAAATTTGCTTCGACCACCCATGATAATATACCATATTTATGCTTA TCGACCATAGCCAGATGATTGTTTCCAAAATAATAGGCCATGGCCAGCCC CCTCAAAACGCTTCACTTTTTTCAAAATGCCTGTGAACAAGCTTTGGCCA TTGATTGTAGCATGAACATATAAACGACTGGACATCCATCTCCTTTGTCT TTTTGAAGATAACAGTGCTAGCTTCGTTGCCGCCTCGTTAAAAGTATAAA ATGAAACAATA
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00073852TCONS_00073852Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_99supercontigscaffold_99:19814..20674 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
4.27 4.51 7.38 7.04 0 0.25 0.15 0.14 2.89 3.18 1.84 2.04 1.67 1.27 1.6 0.46 1.13 0.83 1.28 1.36 1.67 0.85 1.62 1.54 0.12 0.11 1.14 1.41 1.39 0.56