Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

XLOC_000948 (gene) - C. hemisphaerica

Overview
NameXLOC_000948
Unique NameXLOC_000948
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000012:160968..196288+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000948 ID=XLOC_000948|Name=XLOC_000948|organism=Clytia hemisphaerica|type=gene|length=35321bp|location=Sequence derived from alignment at sc0000012:160968..196288+ (Clytia hemisphaerica)
CCCAGTTCTCGAATGAATAGATGATCTATTGGATTTTGGAACCCCAGCAA TGCTGTTTTTATTCGTAGGGGTTGCAAAGTCTATAGATTATTGGTAGATT AATTGTATCAAGAAAATAGACCACAGAGAGGTTATTGAAGTAAAAATAAT GCAGAGCCTTACATCTCTGACATAAAGCTCAACATCGTCTATTTCCTTAT ATGGACTATGGACCAAGGCATCACTCTCATCTGTAAGGTCCATGGAAATT ATGCGGATTACTGCAATAAAGATGGGTGTCTGTTTATATCGATTCACCAT ATTACATTACAATTCTGCTCAAGGAAGAAAATGTGGGGCAAGGCAgtaat gaaaatctttttattttttggtgtGCTTGCCACAACCCAAGGTAACTTTG TTCTTTCTTGAAtagaatctttaaaaattttgagtaAGAGTGACATCATT TGCTtatcagtggcggcctggcagggggtgcagggtgtgcagtgtgCAGA GCTTTTttaagggggcgccaaaattttttcgatNacagggtgtgcagtgc accacccagaaagatctgagaggggcgccaaaagagcttttttAGGGGGG Gcgccaaaaattttttgatgtttaattgggcaatttggcgccctttggca cgtttatagcgccttctatgagtacaatgttattttttttcgcctGTGGC CCCTTATTTTACCCTCTTGCATCCTTTCTCTcttgatttttatcaaaact tctatcaatattgaatcagaagtagagaagtgttgtgtttccaccagggg ttaaatcacctccaaaatgagagattgccaaaatgatcaaaacttgttga ttcTCGCTGTGGTGTTGTGGTCTTATACTGACTAACTTTATccgttttag aagatctttcaagctgtttgacctttcttacaccaatttTTTTTGCCCGC GGTGCCACAATTACAAGGAACCCTTCCTCCCGACTTctgaatttttgggg cctctttcaggCATTGATCTTTAATAGAGAGTAAAGTGAGACCAGCGGCG CGAAAGTTTAAAGATTACCtggtaatttttctgataatagttttagaaag caaaaatatagactaaatcgacttaccaggtataaaatttccatttcaaa gattaggggcgttactttcaaacagtcactgctcttacagtttaatattt tcacttaatgatggagggcgctaaataaggacaaaaatactaggggcgcc aatttcatagtttgcaccaccaagaaatttaagccaggccgctactatAC AATAGCCTTCGTCGTGGTTTTCTTAACTGTATGAtagttttgaaaatatc aatGTAAAACCTTATTTTACAATCATAAAACATATTTATtcaggaagaaa agacacttttttattctgctaatGGTAGTTTCATGCTACTTTGGTGACAA ACTTCAGACAGCAAAAAAATCTTTATACACTTTCAATTCATTTCACAGCC TTTATTTTCCGTTTATGAACCTTATATATGTAAAATATGATACAAGTTCC TATAACATCGTtccaagaaagaaaaagaaagattctgggtaattaaaata taagatatTTAATCcaaataagtttgcgtttatcgacccagtacagtggc gtggtgggaaaatttctctggggttGCCAAGGCAAATATGGTGCCCCTCT CCatacgctcattatgaacacaaaaaagggagtgtgcgagcgaagcgagc cagaaaattttgagtttttgaggtgatgaggggcgccatttttgtttttt taNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNCCCCTGGCCCCCCCTGCCAACACGCCA CTgcccagtgatattcatattggaagtttatcgtggcttggatcacgaga aaCAAAAatccaaacgtaaatctcgtgattcAAGCCAcaataaacttcca atatgataTAAGAAACTTTTAGAATAAGAAAACAGCCAAGCCAAGCAACC AATAGCTAACCTGATACTGCCAATCAGGCAAGAGTTTTCTGGCTATATTA AACAATAAAATCTACCCTGTTGACTGGGCATTGAAATAAACCGATCATTT AGCAAGTATTTTGAACGGCAaataaagtaattgaaaagtgaaaagtatTT AACGCCGATAAGAATAAGAAGAAATAATTTGGTTTAATTCCTTTGAAAAC ATGGCATTTTATCAACATTGTTATCACAAGAAAATGAGTGCCATCACCAG TTACAGTTAGCCATGAAACCCAACTGACTGGCCAATGGAATAGTTTAACA GCGTCCATTGTGATTAAAGCCGAAGATGCATTTGCAGTGTGggttttatt ataagaataaactatacaTCTTCAATGAcccaaatattaagaacaagtta gcaACATATCAAAAGGTCTTTGTGGATTCTAAAACACCATATGTCTAAAG AATTTGCACAAAAATACGCACAAAAAGGTGTAATTAAgaccattttgaat atttttaggcttaaaactcaataatatatttttattttatgccTTGCAGA GCAGCACCGTTATACTGATTGTATAACGGCTCTGCCGCGCATGGCAACAC AAATTTTTCTATGATATGTGTGTTCACAGATGCTTGTGATTAGCACAGTT TTTGGAATAAGGATTGTAGAGCTAATTTTATGAGGTGACCTTAGAATATA GACTTGTAGATTAGTAGAGTTGTGGAAAGGAAATTTATATACAAGAAAAA ATCAGAGTGTAGAGATTGGTAAAAGGAACAGAGTTGGTGGATTGTGCCAG AAGAGTTTTGTAACAGATCAGGGTGTGgagattggtaagagaaacagGGG TGGTGGGTTGTGGCAGAACAGTTATGTAACAAAACAGAGTGTGGGAATTG GGAAGAGAAACAGGGGTGATGAGTTGTGGCATAAGAGTTATATAACAAAA CAGGGTGTGGAGATCGGTAAGAGAAATAGAGACAGTGGCTTCTTTTTCCG ACGAGTCGATAAGTATGACAGTGCAAGAAAAGAGATTTTGCCATAGCTGG CTGGTTGAAGGAAAGACTAGTGACAGCTACATGTATTGGCATCTAGATAT AGGAAAAGACCCTGGCCACATTAGTTTAGAAAACTAGCTCATATACATTT GATTCTATTTCTAATGACGTTATTCCCTTTCAAATGTTGGATGTGAGCTG AGTAAACGAATCCAACATGATCCAACAcgaaaaaaagaagtaaatgttgg acaaaatgtttgatggcgatcaaactcCCACCCAACatgattttttcttc ctttccgATTTTTGCATTCgagtaaacgattccaacattccgTCCAACAG AGAGAAAATGGCATGTTGGATAGAATAttggaatcgtttacctcgGCCTT TATGTACAGCAGCTGACCctgagaatgtagtaaaccccgagaatgtaggt ttctcattttttagcattgtagccctaacgatagttcaacttcataaaat aTGTTCACTGTTACATATTACTTATTATCTAagtacataaaattttaact tgaattaatttttttcaacgaaaatctgaattgaagttgattggatacta cccgAATTGAGGCACTTTTTAAATAGATCCTCTctaaatcaaaatctatt ggaattaagttatgatgatagggtattttcttacacctaatgaacaaaga aaatggggaaaatagttcgtcatttcaatatttattgttctaagctagat attttgacgaaaatgcttgacctaccgggtgcaccacaaaaaagtttctc tccttgaaactaattttctcgaaatctgaaagttttaaaagaaccattcc tatttcattggaaagaagaaagatagacttaaattttgatgggtcattta ttaaatttgattcattagatcaaaagttatgctcaattgaatagaaaagt tactttcagaaagtgctgaAAAACGCACtaaatagaatctcgattgaaCG ATACAGGTCAATATCTGATTTCGGTCTTTGCTTTTCACCGTAGgtactta aaaatcacttgcggttttaaagttttaagaTAATTCCCCTTTTGTGGCAA ATAATTCGGCATCTAAAACGTATCAGGACACTTtagttttatgacatttt ctcaGTATCTATTTATTCTATATACGAAAGTTATAgtgttaaaaaagaaa taaatattatTTCAATCTTTATATTATTAGTTCTTAAACGATAATGCACG TACAACTTCCATAAGAACTACAAAAATCTACTTTCATATACTGTTTAAAT ACTGctacaaaatctaaaaatgatgTTTATTATAATTTAGAAATGATACG TTTTCACAACGTAATCATTTTCTTTAAGTAACCATTTGTAATCCAATTCC AGAGACTCGATCAAAAGACGGCTCAAGGTTTTTGGATTCCCATAGCCGCT GTACCGACACAGCAATGTTTGTATCTGCATGCACCAGTAGTCCGGATACA TCTGTAAGTATCCCAACCACGTCGACAACAAACTCCGTCTTTACCGCAAA AACCTGTCGAACATTCCCCATCTTTCTTGTTACATTTCCACCAGCAATTT TTACCTGTATGAGAAAACAGAGTAAaacatataacgttagatgaacgttg aaagaacATTGGTTGGTTGGAATGGGAAAATGAATTCGAATTTCTGGTTC TAAATATTCTTTAAGTTATTAAGAGCTTTTTTAGAACCACTTTTTCAGGA ATAcatttgacgctctctaattcgatgttctaCTATTCCATAATTTAAAG TCACCGCCGAAAAGAAACTATTAAAAACGATACTCTTTTACTATTCAATA GGCTCCCtactttatgaaaataaaatttccctTGAAATTCAAGTTAGAGA GTGCCAACTGTATTATGCTAAATCTACACCGAAAGTTTCAAagacaaaaa gtcaaaatcttcTACAGGGCATCccgaaaaaaagttagtatcgAGTCGAA CCacttctacagggtgtcccgaaaaaagtatcgagacgtaccacttctat acagggtgtccctaattaaagtatcgagtcgaaacacaactatgagtaga aagttttatgtgcgtgttcacaaaattgtattttaagctctccctctttt NNaagaaagttcttgtgtgtgtttaactaaatttgctatttttatcaaag tttttctctgtgtcatattaattgtcacgagacatcttttatgaataact tttacaaaaaacaattctcaataactttaacgtcatgaaaattgtaaaga aagttaattcttttttatcataatgatgactgttgtaaaaacaattattg tggTGGTAtacattttcttacattttgttaaacacacgcaacaacctaCT ACTCAGAATCATATTCGAACACGtaactttttttcgggacaccctgtaca aagATTGGTGTAAATATGAACCAACCGCTATTTTGGACATCTCGTCTTTT AGTTGTACAACAATGCTTCCCATTGCACGGTGTGGCCATTCCTGCGCACC CAGCATCATTCCATCCTCTTCGACAACAACGCCCGTTCACGCCACAAAAT CCAGGACAGTAACCACCCTTTCTACCACACTTCGACCAGCAATTTGAGCc ttaaatataattttgttaTGAAAATACAGAACTGTAGTATAAAGATGCAG AATTTTGGCGCCTCATTTCTCATGCAAGTTAACGGGACCCTCTTTTGGAT AGCATATTGTTTTTGTTGCAGGTAACTTCAACGTTTTATAAAATTACTTT GTTCCAACACCAAATTCGACGTCTTGTATCCACTGGCTAGCTATTATATT CCCTGAGTTTAAATGAAGGGAATATCTAAATTTCTGCAAAATTCTTAAAA CTCCTAATAGTTTTAAGGTCAATGAAAAATTAATCTTACCTAGGTTCTTA ACAAGAGCTGGCTCAGTACAACAGTGCCTATTAACGCAGGGGAATGCAGC GTCTTGCCATCGACCCCATCCTTTTCGACTGCAAAGACCTTTTTTACCAC AGAAATAGGTAGGTTTTTTCCAACAATTTTGTCCTTGGTTTCTTAaatct aaaaagaaagaaaggtggtatattatttttattttgaaaacaatctGGGT TCTTGGTAAGGCACAAAGACAGGGGTAATAAgtttaaaaaaacatcaaaa gacaaagataaataTACAACGTTTGGAATTTCCTTCCTTTATCGTCAACA TGAGAAATATGagaaatctgattggctaaaaacgcatCCTCATTATCATC ACCTAGGTCGGAAACAAAGANTTACCACACTTCCACCAGCAATTTGAGCC TTAAATATAATTGTGTTATGAAACTACAGAACTGTAGTATAAAGATGCAG AATTTTAGCGCCTCATTTCTCATGCAAGTTAATGGGACCCTCTTTTGGAT AGCATATTGTTTTTGTTGCAGGTAACTTCAACGTTTTATAAAATTACTTT GTTCCAACCAAATTTGATGTCTTGTATCCACTGGCTAGCTATTATATTCC CTGAGTTTAAATGAAGGGATTATCTAAATTGCTGCAAAATTCTTAAAACT CCTAATAGTTTTAAGGTCAATGAAAAATTAATCTTACCTAGGTTCTTAAC AAGAGCTGGCTCAGTACAACAGTGCCTATTAACGCAGGGGAATGCAGCGT CTTGCCATCGACCCCATCCTTTTCGACTGCAAAGACCTTTTTTACCACAG AAATAGGTAGGTTTTTTCCAACAATTTTGTCCTTGGTTTCTTAaatctaa aaagaaagaaaggtggtatattatttttattttgaaaacaatctGGGTTC TTGGTAAGGCACAAAGACAGGGGTAATAAgtttaaaaaaacatcaaaaga caaagataaataTACAACGTTTGGAATTTCCTTCCTTTATCGTCAACATG AGAAATATGagaaatctgattggctaaaaacgcatCCTCATTATCATCAC CTAGGTCGGAAACAAAGAATAACCCTCAATCCACAGTTTGCGATCAGCCA TTGCAGTACTCAGTTCCTCAATCTCTATTCCTGTTTTTCGTTTCAAAAta cagggccggcgaatcaattttgaaagtggaggggccaaatagtaagtgtc taaggaggcgccaccatggttgggcctttcttagcaaaaaagtggggggg ggcatggccccCCGGCCCCCCAGTTTCGCCGGCCCTGAAATATCAAGAAG TGTGTGCTTTTTCGAGCGCCTAGGGCCAGCAGGACACCGAAGTAGGATTT CAGATACGATTTCATTTGGTGCACGGAAACATTGACCTGAGAAAGAGTCC ATGATAGATCTCGTGAAGGGTTGGGTGGTTGCGCCAATCAAGATTCTGTA TTCTTTGCAAAAGGTTTGTATAACAGCCATCAGGCTCTTCAGCATAGTTT TTGTCATAGTCCAAGTCTCTGAGCCATAAAGAAGAATGGGCTCGACAAGA CTTCtaaaagtttgaagtttgaGAGCGTTAAACAAATTAGAGTGCCCTAT CTTGTTTAACTTATTACAAGCTTTTCAAGCTAGACTAGATCAAAGATGGA TTGATCTTAACTTTTCGAAAACCacctaaaaacaacaaaaaagtcgACCA AAGCAAAGttttaagttgtatttttttactaaacaaatattctttgattt ctttcccatttatgacgttctaagattaaagaacctctgatataaaaatg aagatcacaGCATTAATCTAtaagaagttgattttattcttcttcttttt tcatcttcttttttccatttttttaaagatttttcttttttgcaaatATT CCACTCTGGATTATCTTTCAAACGAGCACAAAACTGttttctaattcgaa ttctatcaaaagttacagccttttttgtctcctcTGCAAactatattgag acagacttcaGTTTTAATCAGATTTTGGTAACTTCTCTCAATGTCGTCGT CTGCTTGAGATATAAAAACGCATATATAAATGCTGTATTCTATATTATTA TATACaagtaggcaaaaacagccattgaataattcctgatacaccatggc tattataccacggtagaatttttttttcttcaaattttgctttcaaagtt agattcttttaattaagaaaatcattaaaaaagaaaaacattcgaccGTT CtattatgggagtgttttatgtGAATCGTTTGACTATTTACAtaatttca gttttgtttttgcctctaggtatataataaaacatatattcgataggttt tcgttggctattggatttattaaccctcggtgatatatattcaactcggc ttcgcctcgttgaaCATTACATCGACctctagcccggggtccacttaaag ctttttgatagactggatggcgcgattaagtggcccagtagtatatggta atatgtttttgctttggcggactgtaaaacagtccgccagatttttgttg tttttggaaggtaaaaacagtatgaagcaatatttttatttgagaataag ggattgcataTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNCAGGGTCacctttttcgcaaatttcgagtcccacgtag ggtccatttttcgaacctcagcggagcacccccgtcggtcgacaagggta gtaccccccccgggatcTCAATAACCaatttttacctattgaatatctgc ttattgtACCGTACACATACAAGACCGCGTTcaaaaaggggtctggtaag cgagagatcatatttggatttatttttgtaTCTTATCCCGAAAGTTATTC TCaggaatgttttcttttttcctctCAATACTCAcaaaaattatttatat tttaatattttaatgaGCATTCGAATCATTTTCGAAGATgttaatgtttt gatgttgatttgtgaaaaaacaaaacaaagaagagAGAGAAGACAAATAA AATGGAGAGAGAAaagtttgttaatatttttcaagttgacgataaaccag ttatcacacttttactCGTACAATATAGGATAACTACTACTTATTTCATT GATAtttactagcaagtagctgtcgctatgaatgccccgcgaACGCATTC ATAATCGAGAATGAACGTTTGAAGGCCGCATTCCACCAGATCGTTTTATT GGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNcagggtcacttttttcgcaaatttcgagt cccacgtagggtccatttttcgaacctcagcggagcacccccgtcggtcg acaagggtagtaccccccgggcaagtagctgtcgctatgaatgccccgcg aACGCATTCATAATCGAGAATGAACGTTTGAAGGCCGCATTCCAACAGAT CGTTTTATTGGAGCGCCATCCAATAAGCGCACAGCTACAAATTTCTATTC GCTGTACCGAAAGATATATGGCtgtttatcaaaagttattgatttgattc ttatgaaGTAGGTGCTTATAAGACAAATAAAAATGCTCTCATTGTGCACT GTCCCtggtttactttataagaactatgCCAAAAGGTATAAAGCTGTtga tcaagagttattgatctgAATCTTATAAactagatgcttataagaacaat aaacaggctcatattgtgcactgtcccttgtttactttgtaagagctaat taccgaaaaatGTATGGCtctttatcaagagttattgatttgattctttt aaagtaggtgcttataagaaaaatcataagaaaaataaatatgttcatat tatgcgccgtcccttgtttactttgtaagaactaattcacgaagggtata tcaccgtctatcaagagttattgatttgatgcttataaagtagatgctta taagaaaaagaaaaatgctcatgttatgcgccatccattgtttacgTTGT AAGAACTAAAACGTGAGAATTAATACAAGTCgcaacaaaatagataaaat gaTAGGTGCGCGCGAGCATTCTTTAACCGcggcggcccgctcagaatcga aagaaacaacatcatgaacatgaacatgaatatttttctggcaaACAAGC CCACTGCGAGAatcaacaaaagcccctgcggggcaattaGATAATTTTGG CCAATGTTTAGGTTTGATACAAagtattttaaaaacaatttaggCAATAT AcactcctgtgtcacagacctggtgGGACCCCCAACTCATTGGAAGATTT GACCGAAATTTCGTCCCCCgtgggaaaaataccccaaaaatttcaacccc actgagAAATGGACTTTGTTTTCATCCCTATTTATTATTGAAcggaaaaa attgcactccaaaaccatcaccACTGGATCTTTTCACCTTAGAGCAATAG AATTACTATCctcattgaattcatttggattTCGATAGAACTTCTCATCC CCGCTACGGGAAAAAGTTTCATTGGAGCTGCGAGACAGGGTCATATATAT ACATCTCCTACAATAAAATACACTCAATCAAAAGTGATTTACACCGTGAT TTAAAAAGAATACCTGGAATACACGCTCCATTGTTGCAGGACTCGAATTT GATTTTCGGTCCTATGCATGATTTTCCGCCAAAAGCAGGCTTTGGGTTAT TGCAATTTCTTGTTGCTCGTCGGCGCCCTGGACCACATCTTCGATTACAT GCTCCGAAAGATGACCATGTACTCCATTTTCCATTAACCGGACACGCTCC ATTGTTGCAGGACTCGAATTTGATTTTCGGTCCTTCGCATGATTTTCCAC CAAAAGCAGGCTTTGGGTTATTACATTTTCTTGTGAATCGTCGGCGCCCT GGACCACATTTTCGATTACATGCTCCGACAGCGGACCATGTACTCCATTT TCCATCaactaaaattgattttaaaagattgtTAAGAATAGTTTAATTTG ATAAAGACAATATAGTCGCCAAACACTGAACTTTTAAGGGAACGGTTGGG CCAATTTTGACTTTATTGCAAAttctttcaaatcatttttaatttcaata aatctaaaattGTAGGGAATGTTCTTTATACTACTGAGTATCCCTTGCCA TGGCATAATGTCAAAATGATTCACCTGGTATAACTGAGTGAAAACAAAAC AGAGCGTTGTATGGTTCAAATCTCTTATTACTAATTGTGTCTTTTCAGTA AACTAAAACCTTTGATTTGTTATAATGTTATGGCGAATTAAATTCAAcaa gaacttttttttgggggggggggcccttTTTGGGAGTTTAATCAGAGAGC TTGTTTTCGCCTTGAAATAGCAAAATCTTATAGGTTTAAAAGTAAATCGA GATTGAATATTTTTCAGATCGTTTTTTCACCCATTCGTTTAGTTTGAGCT TTAGCGTGATGAACAGAAGACAAATCACAACCTGATCTCAGGCTAAATGC AATTTATACATACCTACTTTTGCATAAATATAAACAGAATCAGTGGTACC AATacaattttgacctttttcacAATGATGAAAGACTGTGTTGATACATT TCTCGTATGAAGTTTGACCAGGATAACGACTCCCGTGATCCGCAGCCTTA GTTTCAAAACATTCCTCGTAGTCGGTTAGAACTAGTGCTCCTTCTTTTGC TTTTGCTGCACAGTCACAAGCCAAACTGTAATTTATAATAATAACAAGAC TTTAAAAGGCTCATacataaatgcaaaaaaaataagatttaagGACAAAG CTAAGCCTGGCGATTATCGGAGCTAAAAGGCAGAATAGTGAAAATTGGCT GTAAAGAATCCCTTAACTCGCCGGAAGGTTTCATTTCAACCTGATCTTTT AAGCTATGActatttgaagaaaaagaaaatacctCTTTATTGATCCATCA CCATAGACTGGCTTTCTCATTATGAACTTGGTAGGGGCATTATCATTCTT TGTAAAACATCCAATACGGCTTAGTTTGGAACCATTACCACagtctgaaa aatatttgagatcatttcaactttaaaggagagaaaataattaaaaaaaa gttactATTTGGTAAATTTCCagtcaattatttttcaaactaactattga aaaacattttttaaggaGATATAGGTTGAATTTAGAGCTAATTTTAACAT ATTTCTAAGggttctaggaaaattgcccccgagaaaattgccccccggaa aactgcccccggaaaattgccccccggaaaattgccccctaggaaaactg CCCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCaattttctcgggggcaattt tcctgacaCCATTTCTAAGTACCAGCAGCTCCACAGGTCAAGTTAAGATC CCCTACTAATGACCTTATTCAcataaattactcaaaaatttcctaacatg aaaaattatttcaaccATATAAAGTTCTGAAATCAAATTTGAGATTCCCT TCAAATCAACCCTTTAaatgccaatgtcgtatatatcagacatgggctgt AATGcacagtttgagttagaaatcatCATTGTTAGTCTAACTCGTatgaa ttggattgggcttcatggtgaagcaaaaaaaaaaatcaacaggGAGCCTT TCCAGCGatattttaagccaaaaagtcaaaaaaatgcaaagatttgacaa aaatccactcttttaagattttgaccgttttttgatcATNTAAAAAAAAT CAACAGGAgcctttccagcgagattttaagccaaaaagtcaaaaaaatgc aaagatttgacaaaaatccactcttttaagattttgaccgttttttgacc atttttggtcaacgagtgatccaagaaccaccaaatttggccctgtttta cttgattctgtNtcaacgagtgatccaagaaccacCAAATTTAGCCCtgt tttacttgattctgtcctccagcgaattaattTAAAGTTTTACCATTGGG CATCTTTCTATCATTTAGACAGGTCCGCGCAGCCCAccccgcccttccta aatcgggcggcctCAAAGGTGCCttaaagaaagaggagactccaAGCTAT CAAACGAGCTATGAacaagcttctaactccttctagatctcgagatataa gcctttaaagttttaactagtgattttctttaaaaaacttagaaaaaaat gaccatGGCATATAAAGgagggggggggtttgtaggggttcgaaataccg ttttcccgtcaaaatttttgctgaatcccggaatcccgaaaattggaaaa ataataacaccgtcacacNtttgctgaatcccggaatcccgaaaattgaa aaaataataacaccgtcacaccggcttgtacagggcgaaaatgtacctaa ataccgtcaccgtctgattttgaaataccgttttcccgtctcttttttcg tcaaatcccgtaataccgtactaaaaaagggccaatcccgccACACCgga aaagtacaaaccccccttaTAAAGGGTTAACAATCTTCCATATCATTTGG TTCCTTGATTTCTCTCCTCGCCCtgtgatttgaaaacatttaaaCTGATC CCTATGAAGGGGTTTTTATAATAAACAGCCTACCTAGAATGTCTGCAAAA CATCCCGATGCCAAATAAATTGCGATGAATAATTGCAACATCATGATGTA CTTGATTtctaaacaatagaaaatataGAATTCAGCCTCACTTTTTAATC TTCGGTTTGGGTTTAtcttatacgtttttttatgaacaaactttataaga acataaggctttgcggactgtaaaatacccaatttcttaggaaaatggac aaaaacacttggtgaaaataagaacatgtaaaAAAAGCTTGTACCTTCAT TATCTCAAGTCCTATGGAAATGTAGATATTATGAATAGAGCTCTCATTCA TTTCATCTCATTTTATCATAGAGCATCTCATTCAGAacttcagaaatttt caaaccaaaaatatctcaaaatgttTGACTAGCCTTACCTTTTTGCTTGT CAATCTTGCAATGATGAGAAATGTGCATTTTGCTAAATGCTATAACGAGA ATTTTTTTGATCGAACAAAGAGCCACAAGCTCTCAACGTTACAAGAACAT GGCAACCAGGGTGAAAGCATGCTCTATGGTTAAATTATGAAGCATGGTAA TGCGAGAGATCAAGTCTTGACGAATTTTCAGTTCGCCTTGATAATccaca tttttttattaaacatTGCACACgctgttttatttataagaacaatttta taacaaCACCAGCCTCAGTTTTAGCCCATCGGAACAATAGCTATATTGTT TGGAACattataaataaatttaaaaaaaatcttatcctcaaccaaaattt aatggtttttatttaaaagaaagcGTGGAAACTGATTATACATCTGTGTC AGTGATCCAGGTGATTTTGAACCTCGTTGCTCTAAtaaattgtaaaatat aaaGCGTTTATAGTATTTTACGAACTGTCGAGTTTTCATTAGGATGAGCA AACATTTTCCATGATCTTTAATGAAGGTCATACCAATCAGATcacaaatg agaaaaataaaaaaattcaatgaaaaactTTCCTAGCTGGGCCAGatgaa tttgataaaaaaattgaaaactagaaatgtaattttattcattaattgac gtttcggtgtcttctTTGCACCTAGCCTAgggatccatgctatgatttct tattctatatactgatggtgaaatatatagcatggtatagACTgggagtt tgaatttcccagatcctaataacggttgaaaacatagccaatcaaatttt gttattcttttgctggtcacactttcttagagaaagcgcaagttccgaaa tttggtttttattttagtaagtgaggacagcgctaaattcgaattttccA CCGTAAATTTTTTGAAGCAGAAATCTTCCCCTCACAGGTCATAtccgtcc tgtatacatcagattataaaaatacaggacgggtatcCTGTCTACTTTGC ATGCTTATACtcatcaatttttaatttacaagctttttcacattgacttg acacggatgtggagcaagattggtcagagaGAGGANcacaagctttttca cattgatttgacacggatgtggagcaagattggtcagagagaggaaaaaa acaacagttttttgcttattcagcacaatataacaatagggagccACCGT CCTGGTGCCTGATATGAAAAGGGAACGCTTATGTAAAAATCCACTACATC TTCGAGCCGCTTATCCCTATAGTATATTATCATCAAGCTGGACATAAAAA TCTTAATCAATAATTATTTACTGTAACTGATGAATACTTTATGtatcttt ccataggatatggCTTCTCACCATTTGAATCTCTATCTGACTACGAAAGT AATGCATTTGAAAAAGATGGTAAGATTGATATTTCAACGCATTGCTTTAT GAAACATGTAATTCGATTGATGGGAATCAAGGACAACCCTGGGTTGCTGG CAACCACCAACGGATTCGTGGTCCTTGTAGAGGCCCGGGGGGGggactcg attttgaaaacgaccgtacgttcggccaaaaatcaggtctctaaaatcag acccttacagtgcaggaaaaatttggctgaaaatcgacccttatagtgca attgttcgaatttttttgcccttttcagggcaaaattttttgaaatttct caaattttacctcaagaTTTggtattttctaaaattttacacccttacag tgcactttttcccacttgctcacaaatcaacccttacagtgcactttcca aaaaacctacccttaagggccgcacgtcaggtaggtcacttacctggagt gccccctCCGGGTGTAGAGGGAGCTTATACTACATGCACTTTTGTAGAGG ACTTAGACCAGGACACCCCTATCTTTGTGACGCAACTCGTCCCAAGCCTT TTTCTTTTGGAACCCTTATTctcatcaaaaaagaaattctagaTTTTAGG TTAGATTCTAGGTTTTAGATATAATTTTGCACCAGATTGGAATCCTAAAT TGAATCCTATCCTACACCCCTTTTTACAGACTCATTGGGACCCCTATCCC ATCGNTCCTAAATTGAATCCTACCCTACACCCCTTTTTACAGACTAATTG GGACCCCTATCCCAtcggaaaaattggccaaaatatccccagtggaaaat tatactttaatttttgtccccactgacagtaatcagataagcaaatcctc attacaaaatattgtgctattttctcCTTCCACACTggttataaaaagtt ataaaaaacaTCAGAATATCAATATTATCAATACCTACTCCATcaagttt tggtccgttattttcaaCCCACTAGCTGGTCTGTTATTTTCACccctact ggctgaaaaaaatcctaccgggtctgtgataaGGGAGTGTGACCCTACAG GGTATCTCAACGATATTTACACCTTTAAACTGTTTCAAAGATCTTTGTCA Gaccttgttttttttataaactttatgacttcttcataaaaaatacctta taattcttttaaagaatatttagACATAATTGACGACCTCGATCACGATG CAGAAGCCAACTTCTATGATGCAAGTATGTGAAGTATTTCCCTAGAATCA TATTGTAATGTGAGAGAAATTCCCTATTagtgaattttaaaaatcagaaa atgtttttttgccaCCGATATTTATTATGGTCCTGTTGTAGTTCACTTCG TGGAAATTCGTGTCCTTTTGTAGAAATCTTCGATTTTGTGGCCTGATCTG GCAAGATTCAAGGTTTTATGTTGTTTGATATATTATAGTTTTCCCCACAT TACAGGCCCTGTTGAAAGATATCGAATCCAAGATCCATTTGAAGATTATT TTGATGTATTCAAGAGAGCATCGAGTAAGGAATTTTACTTTACAATCTAT TTGGTGATTTGGTGAGTCTTTTAATAACGTTCATGCTCCAAACCGATAGT TTCCATGTAAAATCTCATTTATACCCAAATTATGGGAAGCTAACAGTGAT AATATCGAGATTTACAGTGGCTTAGAGATTGTTTAACCAGAAAATCCAGA ACTCGAATTTATTCCGACTTCGAACAATTCTTTGCCCCTCTTGAACAAAC ATTGTTCTTCGCCACATCGTGACTTAATAAAAAAAGGAGGGGAGGTCAGA GCAttcgaaaaatatttgttttgtgtttgttaacCTCTCAAAAAGGAGGT ACATTCTCCATAACGTTGAATTGACACTCCGAtacaatattttgaatatt ttttcagaATGCAAAGACATATTTTCAAACTGTGCACAGTTGACAAAATA TTGCAAGAAAAAAGGAAAGCAATTCAAACAGATCAGAGCTGGGTGTAGAT TATCCTGTGGATTTTGCAAGGCACCAAAAGCCCCAGGTATTTTATAGATC ACTATCACTTAAACATCTTAAAgatagaattcatgatattcgtggcgcaa tgttttatacggaagcgcCCAAAAAGAGACTGAGTATATGCTaccaattt tgaatttaaacaataaaactagtaGCCATATGGCCCGGGCTATTTTAGTT GCTTATTCGTCATTACCTCATGAATATCATGTATCAATAAGCtctcacaa aaataaaaatattatatatagcCCAAGTTTGAAAGTGGTTATTAACCACA TTATTTATTCTTTTTGAAATGATGGGGGGGGGAGGGCAACTAATCTTACC GACCGACAGGGGTGTACTGCTGAGATTCGAAAAACGggccctacgtggga ctcgtttttttcaaaaatgttggcaaaatttgcgaaaaacgTGACCCTGA GTGGGAccgaaattccaaaatttcacaaattacttttttctccaaatttc acaaaaaaggtGAGGGAAATCCTATGAGGgattgatttttctattttagt tttttttcgaCCAGAACTGGGACTCATGGAGGTGAAAAAGGTAGCCTGAC CAACGGTTCATCCCGTTCCCCTTTATACCTACAATTCTCATGTTCTGTTA CAGCTTATGTGAGCGCGAGACCAAAGATATCATcgtctgaaaaagaaaag atcaaAAGTAAGTGAATAAATGTTCTCTGTTTTCACGTGATATAGTCTTC GAAACCTTGTGATAAttcggcgtttgtgtaaaagcCGCATGGGCCACGTC ttttgaatgggaaataagtatGACTCCATATCCCATCCAAAAGCATTATC TTTAGCAACTTGGCGGCTTAAAActcattttctcaaaatgcataaaacta TTGCGGTCGTCTTTTAAAAGAATTGCTTCCAATTACTGTGTGTAAATTAT GTTTGTAATAACTATCccatttgaaaacgaggcctgcATTGACGTTGATT TATCGCGAGAAGTATGCGCGGTCAAAGTAACAAGTTAAGTATACAATCAC AAATAGAAAGTAAAtacaattttacaaaatattattttacatTGAAACAT ACAATACTGTATCTATATTACTATCCGATCCTTTGATACAGGAACATGTT TGAATTCTCATAACGCCAAGCGCCGCCTTCACCAAAAGACACCTCCTATG GTATGGAGTCAAAAATTGGCTGATCGTGCACAAACCTTTGCTGAATNCAC CTCTTATGGTATGGAGTCAAAAATTGGCCGATCGTTCACAAACCTTTGCT GAATATCTGAGTGCCAACAACAAGTTTGAACATGATTCGTTCAGGAGGAA TGGATTCTCCAGCAGTATTGGAGAGAATATTTACAAATCATCTTCTAGTA GCAGAATATCAGAAAATGCAGTCACAGCTTGGTATGtgcaagttttttca aatcatttcatcTGCTCCATAAATGCAGCCCTGTTTTAGTGAAGTCTATT AGGATAACAATCGACCAGATAAAATAGGAAATTTCACTTGCTCtgatttt aaaatctgaaatttctacctcaatttttaatttctacCAAGTGgcataaa aaattttgaaatatgccAACGTGTTTATAACAATGAGGGTAAGGGAAAGG TAGCGGTCAAAATCTTACATCGCAGTGATTTCAAAATACATTTCTTCTCG TCAATCAATCATCATAAAACCTTTCCATTAAATTTCTCGACCACAAATCA TGCACGTGATGTTTCAAATTCACAAACAACCACAAACAGTACTACCTCTC TAACTTGGTTACCTTCATTATCAGGTACAACGAAATCAAGAATTACAGTT TTGGAACAGGCGGCACCAAGGGCGGCGCAATTGGGCATTTTACACAAGTA GTGTGGGACAGATCTACCATCTTAGGATGTGGTGTAGTGAAGTCTTCAAG AGGAACCTGGGTAGTAGCCAGATATGAGCCTGCCGGTAATTTCAGAGGTC AATACAAGGAACATGTCCATCGATTGAAAAACAGCGGCGATGCTTTtctt gaagatgaagaagaaatggTTTTGTAAAgattgagagaaaaaaaatctta cNCTTtctttgaagatgaagaagaaatgaTTTTGTAAAGActgtgagaaa aaaaatcttaaacaaGCCTATGATTGAGGAAACATATAGAACAATGAGCT TTAGCAGTAACTATTTAAGCGTATGGTATACTTcgtactgaaaatattaa ggATTTAGTTTGTTAGCAGTAAAAATCTTaggatgaaaaaataaaattta aaatttcgaataaaagttacaatatttttttttcttttattttgactgaa taaatatatttttgaaaatctttcacaTTTGTGACGTTCTAAGatgtaag attttttatatGAAACCAAGTTCCTTGATGAAAATGGGGATCATACGTAT CGAACTTTTACAAGAATAAGTAAATCTTtatcttcttcattttgaatcat tctcctagctttattttttcatggagaaaatattccactcctgattatct tttcaacatgATTAAACCTGATTCCAATTctaagagaaaatttttttctt cactgcACATTATATTGGGACAGATTTTATACATTAAATTTCATGATATT TAAGCTTCCAGGCGTCAAACAGGCTGCccaaaagttttagcctcgttttg gcgaagaACTtatccccaggccccaaaaattaaaattttacattcaccca aggaacaagtgtgccaaatttcaattAAATCCCACAATTTTTGAACTCTC CAGGATGctctaaagtttttgtgaaagACAGAAAGACAGACACACAGATT TGACACatattgtcagattctagctcaactgaagttgaaaaTATAGTGTA GCAAATTCTACCTGAATAGTAGGCCATATACCCGGGGGAGGGGCagccct tgagcagtgaaaaggtacctCTAAAGTACATCTTATCGACTGTTTCTAAC CCTTACAGtgaagttttatttcatatcttattttgctgaaaccACCTGAa aatgtgcaaaacaaatcaaaatggatgCGAGTCAAAACTGCTAAAGATAC CTTACGAGCGGCCCCCGGGCCATATAGTCAGGCTATGGACCTGCTCGCTT GAGAGACTAATACACATGACATATGTTTATGAATTAAAAAAGGAATGGCA ATATCATGGATATGCTGTCTCTGAAaacgaatttgaaattattttgtaat GTAAGGCTCATGTTGATCAATACATTCAATCGATCTGACTGATAGACACA CAGTCGCAGGGTCTAGCTCATCTGAAGTTTAGAACTACTCATTGCACATG GCTACTAATTGTTAACAAAATTGATAAGCAATTGATCAATATTGGCCTTT ATTGGCATCTTTGAAGCATTTTAGTGTTAAGGAAATTAATTATTGGTTGT CGTAAGGGAAATTAATTTGTAACTAATATTTCCGAATGAAACAAAATATA TAATCGATCATCAGTGGTCGGAAATTAGTAAAGAAAAAGTCAGACTTCTT CTATCCAACCATATTACTGAGAGATCTACAAAGTTCTTTacttaagtcaa aatcaaaagttGACACGTGGCTTAGCTTGTTAAAGAAACAGGGTATGAAC CAATAAACCTTAAACAACTCCAAACATCGAGTTAAAGCCCCTAAAGCCCC GAAGGGAGGGGCTAGAGAGGGATCTTTATTTTCTTCAGCGAGGAGAAGTA AAGTCCTGAATTGTCTTAAAGCAATTTAAAAATGTGATGTGATGTGATCT GATTTGTGCCGCACTCTCGCTCGGGTAACTAGTAAGCGTACCCTCGCTaa ttcatttttattccaaccccccgcttattaatttttgggaaaatgttttt gaaggttttttgccctaattctgctgtataagcctccttttcaaaatttt tccagccAGGACacttttattccaaccccctcggCTATTTGGTACCCGAC AGTACAGTAGTGTTTTTAGcgtatttttcgaaatctggtgataaacttta ttttcaacCGGCGTTTGTGAGAAAACTACTTGGGTAACACgtttaaaatg gaaaataagtggcttcatttgtcatccaaaattttcaaatccaGCCCGtt cggggctttgaaatcagCTCCTTATCCGATATGGAGGAAAAGTCATCGAC CCTGAAATTTTATCTTTATCCGACAACCACACTGAATCTTAATCACCTCT GAGACTTcgtttaacaaaaaattaagttatGAAAATTTCGTTAGCTCATC TTTGAGATTCTTGAACTAAAAGACACAAAAGTATGTAGGCATATCTCAAA GGTgttttatctttttcatttgaagtCATTTTGGTTAAAATCTTTTTCCA TGGTACTTGGTAGAACAGAATACGTTACAAAGAAACTTCACAAAATGTAC GGGTTACAAAGGTTGTAAATGAAAAAGTCGAACAACAGGACTTTGAAAGG ATTTCAAATAGTGTTATGAAATACGTTATGGAAGTAAACAACCGAGaaaa atttcacgaaaacaagtgaaaaaattaaacCCCAAATAAGGGATACTTCC TCGTGCTGAAGAGACAGTTTATTCAACCAAGTTGTAATTAATTATATTAC CCGGTCCGCGGTCCGCAAGAACGCACAAGAGTAATTATATGACTTTCATA ATAGCTTATTTGGCACTCACAAGTTAATTAAAAGAATAAATACTGTCTAC TAATCCCTACTTTGTTGTTGCAGTATTAAAAGTTCTCCCGTCTCAGCGAG GTACAAAAAGAGACTTTCCATctacaaattcaacaaagtatccacaaaat ctgaaaaatcttgtctaatttattgattaaaattcaTCTCTGTCTGAAAA AATGGTTTGATGTTAATCAATGTTCGATAACGATATAATTTCTGGGATCa gtttttcgagaaaatttaTCGTCAGTAGGTCTCGTTGATCTAATATAATA ATTTTTCCGCGAATGGTGGACTCAATTTGTTTAAAGAACCCTGGTTCAAC GATTCGAATGACTGTTGAATGACGTTCAACCTCATCAACATAATCTTTGC CACTTGTAGAAATTTCGACACCACGATGATACTGTACCCATTCTCTCCGA ACCTCACTAAAGCCTAATTTTTGATACAAATATCTTTCATTGTAAGTACT GTTCGTGTTGTAGTAACATGTATCAGTAACAACATGAAACTGTTTACCTT TTTGCTGAAAGAATTCTCTCAGAATAAACATTAACTGAAGAGTTGCATCC ATGTCGATCAATAAAATGTCTGTCTCATACACCGTACGTAAGTTCAGGCT TCCTATCGGAGATTCAAAATAGAAGTCGGATTTCTTTCCGAAGTCTTGCG GGAACTGTGACATCAGGGCATCATTGAATAGGTGTTTGTTATGCTCAAAA CGGTTGAAATTTGGGTTCTTTAAAAGACCGAGTAGGCTTTGAAAACATAT TGGCATTCCATCGCTGACCATTGTAATGGCTATAAATCGGTGTATTGGGA GCCATTCAAGctcagggaaatcaaaattatgGTTatgaaacaaattaaaa aagctcTGGACTATCCAATGTCCTATTACAAcaaaagtattttcattttt cgttgATATTGACTTCAATTCCATGAAAGCTTTGCCAGCACCGTTGTCTT TTAAATAGAATACGATATTTCTCTTGGTGGTATTAATTCTTTCAACCCAC TCCTGGACTTCGCTTCTTTCAATACGTTTCATGTTTTGAAAANTTTTAAA TAGAATACGATATTTCTCTTGGTGGTATTAATGTTTTCAACCCATTCCTG GACTTCGCTTCTTTCAATATATTTCATGTTTTGAAAAACCATTTCGAAAT GTACATTTATCATGCTTTTGTCATCGTTGCTATTAAGCTCGATATATTTA CGGTCCAATGGGTTATATAGTCTTGCTTCGTAACAAGGGTCACGTAAAAT GTTTTGCACGACCGTTTTCAGATACCATAACCCCGGTCCCCCTGCattat tatcaaatttttctgaaaacctgGTAACATATTCCAAGTCGATAAAAATT GTCAATGTCGTAGCCTGTAGACAGTGTGTGGCTGCTGTCTTTCCTCTGAT GATTAATATATAATGTATTGCAAAGCTTAAAGTCCTGACAAAATTCATCT TGATTTTGGCAcgcttttcaatttttttttcataaaaatccaAACCCTTC CCTTCTTCCTTTGATTTCTTCCAAACGAAGAAGATGTTTGAAAGCTGGCC TATCTATTTATTCATGATTAatttaataaagtttttttcaacGATTGAAC TATCCTTTTAGATTGaacagctggcacacaacgttgtttcaacattcatc taacgtcaTATAGAAGttttgaacgttagataaacgttgaaacaacgttg tgtttgTTCACTTTAAAGATgagttttttattatttgtatTGTCAGTGGA TACAGGTAACGACAATAACCAGAAGCAGTCGGTGGAGagactttttagaa atatttgttcttatcttctaggagaccacatcttaagatcttcaattttc ttgtacaaatcagggatatgttatagcggagctggatgaaggacgagaat tccttagcggattgcttctttgtcttttctattgtaaactgttgataata gaaatccatctctgtccccttgagtgttctatttttataagaaaaatgaa gcagactagtgtatatgtataagaattgcgaagcgatccaggcaagtcac tcgattcgcaagttgcaagcaaaatatttatagggtcacacactagaaat tgcaagttaaaatagattcataatcaattcgtaaatgtaaaccCCGCGAA ACCCCGACAATTGCTCAGGTTCAGGAAGATCGAGCCTCTTTAGAGATGCA CTCAAACACTTCAGGTGTACAAACTTACGACGTTTACTTCTGaagatttg aggaaaattatatgatttttttcatgaatcgttgtgaaaagttcaataat catttgtccgccctgagccttgagtcagtagcggcctggcttaattttct tggtggtgcaaactatgaaattggcgcctctggtatttttgtccttattt gcgccctataccattaagtgaaactactgtaagagcagtgactggttgaa agtaacgcccggaatctttgagttaacaaacttttatttatatcattaaa gatcaatggctgaaagaggccccaaaaattagaaagttggcaagaataag ggttctttgtaattctggcgacgcaggcaaaaaaattttgtgtaagaaag gtcaaacagcttataagatattcttaaaaggagaaagttagtccgcataa ggccacaaaaaccacagcgagcagtttcgatcaatctctcaATCTCTCAA TCTCATTTTGAaggtgagcatcctctttatcccctggtggatacacaaca cttctgttgctttgacttttcgcaattaaatgttgatagtagttttgaaa gaatttgtaaaagaaaacgaagcgccgcaagcgaaaaaatttacattgca cttatagaaggcgctaaaaatgtgtcaaagggcgcaaaatcgcccaacca aacatcaaaaagaattttggcgcccccttgaaaagcttttttggcgcccc tctcaggtctttctgggtggtgcactgcacaccctgcaccccctgccagg ccgccactgccttgagtatttttatttcttagtttttgttttagactcgt tttacttccggtttcgaactccttgcgttcaaaatcgaactttcgaatct ttctaattttaagtttcgaacgttcgaataaaaataacattggaaaactt ttttccttacataaacacccctgtgtcatagacccgctggaaaacttggc aaaaatttcgtcccgggaGGGAAAATACCTCTCTAGCCTCTTAAATAGGT CTTCCTTGCGaatcaaaaaaagttgaacagactttaaacatcactcggtt tattgagacagggatgtgaaatacagaggatttcaagactagGATTTAAT AGAAATAAATTGACTTATGTATTTCAAGATTCAATAACCATATTAATTAG GAATATTGTATCATTGCatcgtaaattctgaaaaattttacACAGTTCTC AAATTATATCTAAACTATTAGCGCTGTAAAATTctgagataaaaataaag aaaaccagataaaaaaaactgagatatagaaagtattctccaacgattct actaagtaaaacctctaaattttaccGGCAGGTTCAAaatgtacaaactt tcgcgaacacaaactttcgcgattttcgcgaattttggcccttttcgcga aagtaaatgtctttaaaaattctaggaagagccattcgcgaaagtttatg ctcgagaaaaattcttgataaaatagaaaatctgtaaaacttcaaatttt gaataaaatgtaacttttatggcactatTTAGCTTGCTAAAAGACTAGTA AGTCAAAGggcaaatgtttcaagccaatccaagaagtatttgccCCTCTA AGCCTTTTTtttatgtgaaaattctcaattttacgtcttgattcgcgaaa gtttatgctcgcgaaaaatatttttctgttaaattcgcgaaagtaaatgt cgtgaatttcgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNatttttccgttaaattcgcgaaagt aaatgtcgtgaatttcgcgattttttgtcttcgcgaaagtttctgctcgc gaaagtttgtacgcctaaagtaatgcataatgcataatatttataaaata tcaattttagaggctataataaggagaatttgaaagataatactttcagc aaaacaaatataccactttctaccagaaaataaagggtagaaagctgtaa atttgaattttggatgatgaagaaaatcccgGATCCACTGAAAAtccttg tcgccattttgattttcatagttgcattttacagaacgtacaattaaggt cataatattttgataattttggttattttaacgtttttcaagatttaaag ttccggcgagaaagtcgattttgggctatctctttaatttcatcgaatat ttcaattcaggaggggttggcagacttacaggctatattctgagccttat tggactatttttgaacttttgaatgctaagatACTAAGGTCGTCTCATgt taaactcagagttaaaactctacccttccaacctactttagagcacttac aaatcgcttgtggttcgaaaacttcccggtgtatttcccttttttctcaa atattatgaccttgattgtagtatagtgtagaaaaaacacgaaaatatct cctccgtatattacttttcttactcgaaaacgtaaattttataacaagat ctttattctgggtttttcagagatcttttcgaacaatttcttataaagtt caacgggttttccctcttaTAAAACCATTAACCAATGTGGATGCCTTTTG TTAAAGTCAATATCAGGCCAATAGAAAATAAAGAGCTTCTTGCGAAAGCt gaatcaaagaaaatagacttcgaatctttttacattcgaatgtttatatg attacctttttttgagaaagatgaAGGGGAAACCCTTTTTTGTtacgatt cgaatgttttactTTCGTttggattcgaaaagtaaatagcATATGtttct ggggaaatccctcttaAGAAAATCCTGAAACTCTTCTATTATAATAGTTC TAAAGAGCTTTTGCGGTTTTACCCTCTACAAaagagagttttagaaaata taaaatcgttctgtaaattacacaatacNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNGCTTTGGCGGTTTTaccctctacaaaggagagtttta gaaaatataaaatcgttctgtaaattacacaatactattatgcattatgc aatatgcaatatgttttatgcattttgtacctgccgtaAATTTTACTGac tgtgatttttttcaaagttgggaaagTGTTATCTTAAGTTTGCTGGAGGC AAGTACTTGGCAATCTTTTACCCTCTTACtcgagttgttgacaaacagga gcaaactcttgACATAAATAGTAAAAAATCTCTGACTTTTTTTTCGGCTG TAGCAcaggaatttaaaacagttaaaatgcatccataaacataatgtcat gttttgtcgttgtatttcgacattttacaagtcattaccattaattacca ttaccaacaataaaatcctttataatacagtcacatgtcaatgttctatA TCTCTGACCATCGATGCgtattcataaaaaacaaacaaccaaAGAGCCCA CGTCATCGAGGGTCGGCggtcaagccaaaatttcataaacaacgacaaac aaacatttctccttccactgaataagggatcaattcttccaggttagcca tatccaaaagcgcaaaatatttttgttcccatcaattcaaaacatacaaa aagtcCAGTGATGCTCACTTCAACCCCTTCAACATACATTCAATCTAAAC CAAAAGAAATGGCTTTCCCACTATATGTATACAGTTCATTTCTTCAGCTT AGATCCTCTTCTTGCAATGAAGCAACAACTCTGTTAAGCCTTGCCCGtcg atgaaagaataaaaattccatcttctttcttctcattccgcaagttcagc tgctttcttcgtttcttttcatctagcaccatctcttttcaaaacaccaa tttctcttttcaaaacaacaataaatgtttttttgttgtttttagttcga attcaaatttggaaaagttcgaaagcccTTCGAAAGTATTTGCTCGAGTA GTCGCGCTGATGATATCGAAAATCGTTTCACTTCGTGATACATGTTTgag atattaaaaaaaatgatgGAGACTTGTAGATTTGATAGTGCTGATTCCAA ATCTAAAAAGTCTCCACGTTAAAAGGGTGCAGGTAAGCCAGAATTTAGTC TCAAAGTTAGGCATTATCGAGGGAATCGAGGAGATTCGTGTTTAATCGAT TATCAATATGTATTATACAGAACGATTTCTCTGCCTTTGATTTCAAATGA AACACGCGTTCCGAAATCTAAGCATAAAGTAGTACTATTAAACGGAATTC AAAATTGCGCGTGATTCTGCCCAAACAAAAACGTTCCGagatttatctaa aaaaaaatataaacaaagtttcgctccaaaatcgaaagtgatggCTATAA TTTTTATATGAGTGGTGTTTGAGACAGAAAGTTATGTATTTCTCAGTAAA GATTATGTACTTTTTCATCTGAACTTTGTTAAATAGATTATAAAATAGCA GAAGTGTGTGTGTACttctttcctgaaaaaaaattataaacaatgaAATG CAAATAAGTAGTTTCTTTTCTGCGATGAGCTATTTATTTGAATGTGATAG CTATATAATATAGCTATCACATTCAAATAAATAGCTCATCGCAGAAAAGA ATAGAGCATGAGAAAtttatggtttctttttttgctttagCTGTAATGAA AAATTAGTAATGAATAATGAACAAAGTCAACATTGTGTCTACATTTCCAA GGAAATCGTGTGAGTGGGATAAAACCCTGTTTTACAAAGACCTCATTATA AACTTTTCTTGCCATCCAGAGGAGAAGCGAGTGGCTGCTGATGATAATTA TGTTAGACAAGGACTACAgtatgtaaagaaattttgatggTTGCNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTAgttaaaaaag agtgtatttttagaatattttagcCATGTAAAGtacaatgtttttaaaaa taaactgTTCCTATACTCGAGTATGAGTAGTATACCATTTCTTTAGAAGA CTTGATATTTCGGATGGGCACTAAGTTTATGTTGCAATGTTATGTTGCAT ATCGAATGTGGTATCCTCGATCTTTCGCCTAAAATGAACTTTTAACCCTA CACTTTTATTATAAAAACCAGTAAGATTTTTCACAGGCTTGACTGCTCTT ATTCTTTTTGGTACTTTGAGCCTCCTTAtcatcatgttcttatttatagg gtgtaactgtgaggtattttaggcgttatactcaatttttattactttgc cCCTacattgattgaaattgagtaatttcaggctcaggaTTGTTTATAAA TAGCTCTTATTCTTTGGTGATTTTGAGGCACTTTTTTCAACCTCAACAGC GGGACTATTTTGCTCATAACAAGAATATAGGTATACTGGGACATTTTTGT TAGATTTTACTATTTTACGTCAAGATCTTTTTATCCAATATTTTCATTAG TTNGGTGATTTTGAggcacttttttcgacctcaacAGCGGGACTATTTTG CTCATAACAAGAATATAGGTATACTGGGACATTTTTGTTAGATTTTACTA TTTTACGTCAAGATCTTTTTATCCAATATTTTCATTAGTTTTCAGGGAAT AATTCGGATGATATCATAGCAATTGTCAACATTTTCCAATTAAATTGACC ACAGACTTAGTCCCTTTTAAGGAAACACccgttcccaggccccaaaatca aaatttaaaaaaaatgagaagtagaacaacagatattcacccaaggtaCA AGTCTGCAAAATCTCAGcaaaatccaaccatttttgaagctTACAGACTT TCCCgaagtttcagcctcgttttaaCGATTATACTCGTCTCCAGACCCCC AAAAtcgaatttctttgaaaaaatgaaaaattctatcaaaagataTTAAC CTTGGGAATGTATTTGCAAAGATTtagccaaatctgaccatttttgaagt ctacagacTGATTCGAAGTTTATCGGGGAAACAGATTACGCATTCGATAT TTTATCGATAAATTtatcgattttagccgtttttctaaatcttcttCGAT TATATCAATTGTTAGTGGAATAATTTGACGAGTTTGAGTATTTACAAGCA AAGAATgtcacaaaaatgaaaatacatgaTCTACAAACTGATAAATTcgt taaaatcgattaaaatcgattaaatcgattaaagtcaacttttaagtcga tttactcgttacttgcacgatagtATCGTggagactttttgattttggaa tctacacatACAAATTCGCGAGTCTccatcaaaaaaaatcatatctcaga gatgtatcacgaaaatcgttttctagccacttttttcgatatCATCAGCG CGACTagagtcaatgcaatgacttcttgaaaaatgagcgccatttgaacg cttcttgaacgcttccagcccgcgctgattttccgatctcttctttagat ttcctaatttaaaccttaAGGAGATAAAAACAAGGCTTATCTAGTAGCGG TAACCACGTGTATTATATccgtagcttttaagaattggtatatctaaacg cacgaggcgacactttttgaaaaaaacgaatttaaccatccgtaattcca ggtctccccgccgcgattctaggtttgatctaaggcagggcggacggctt tctcaatcatttctgcgtttgaaagattggatatatcagggatatgttat agcggagctggatgaaggacgagaattccttagcggattgcttctttgtc ttttctattgtaaactgttgataatagaaatctgtccccttgagtgttct ctttttataagaaacatcaAAATACATTTCTTCTCGTCAATCAATCATCT TAAAATTATCATAAAACCTTTCCATTAAATTTCTCGACCACAAATCATGC ACGTGATGTTTCAAATTCACAAACAACCACAAACAGTACTACCTCTCTAA CTTGGTTACCTTCATTATCAGGTACAACGAAATCAAGAATTACAGTTTTG GAACAGGCGGCACCAAGGGCGGCGCAATTGGGCATTTTACACAAGTAGTG TGGGACAGATCTACCATCTTAGGATGTGGTGTAGCGAAGTCTTCAAGAGG AACCAGATATGAGCCTGCCGGTAATTTCAGAGGTCAATACAAGGAGCATG TCCATCGATTGAAAAGTAGCGGCGATGCTTtctttgaagatgaagaagaa atgaTTTTGTAAAGActgtgagaaaaaaaatcttaaacaaGCCTATGATT GAGGAAACATATAGAACAATGAGCTTTAGCAGTAACTATTTAAGCGTATG GTATACTTcgtactgaaaatattaaggATTTAGTTTGTTAGCAGTAAAAA TCTTaggatgaaaaaataaaatttaaaatttcgaataaaagttacaatat ttttttttcttttattttgac
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00001765TCONS_00001765Clytia hemisphaericatranscript
TCONS_00001766TCONS_00001766Clytia hemisphaericatranscript
TCONS_00001767TCONS_00001767Clytia hemisphaericatranscript
TCONS_00001768TCONS_00001768Clytia hemisphaericatranscript
TCONS_00001769TCONS_00001769Clytia hemisphaericatranscript
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
TCONS_00001767-proteinTCONS_00001767-proteinClytia hemisphaericapolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000012supercontigsc0000012:160968..196288 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.05 0.1 0.07 0 0 0 0.55 0.51 0.69 0.48 0.74 0.91 0.06 0 0.28 0.39 1.83 1.2 0 0.1 4.44 4.89 7.29 6.85 13.73 10.78 0 0 0.1 0.04