XLOC_000060 (gene) - C. hemisphaerica

Overview
NameXLOC_000060
Unique NameXLOC_000060
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:2134555..2135889+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000060 ID=XLOC_000060|Name=XLOC_000060|organism=Clytia hemisphaerica|type=gene|length=1335bp|location=Sequence derived from alignment at sc0000001:2134555..2135889+ (Clytia hemisphaerica)
CCTCAGGATACTTGTCGAGATAGTCAATATCATGCAGACCAAAATTGAAC AATATTACATCATATTGTGTAGGGCGTAAACTTATTGTGGATAAAAAATA ATCCAAACATTGACGCCCATAGCTTGAATCCATCGCCGCCCCTGCTTTTG AAGAGGGCGCCAATTGAACTTGACAACTCCCATTAAGGGCGGCTGCAGCT GAGTAGCTATACCTGGAATAGAGATAATGATGAAGTTGATTAGccataat aaaagtttttcttaTATTTGCATACTACTCCACTCTATTTAAATACGACC GTATATGCGGCCTAAAATTAGGCCTTCGAAATTGGACCCTTATAATGTAG AGAAAATGTAACcaaattttagtaaatttgggacgaAAAATCGACCCCTA CGCTATAATTTCATGAAAACCTTTGACCGttaaaaggccaaaaaattgtc agaatttccaaaatttaagcCGAAGACCTATTTTCCGAAAAAGTTTCTCT TTAGAAATACGGAAGGGCAACATATTGAATTGCAATGGACAATTGACAAC TTACCCTAAAGCAATTGAATCTCCAATCACAAGACAGTTAGGTTTCCCTT CAAAATACGTTTTCATAACACCTGGTTTACACACTCGTGAAGCTTTTATA TCACCATCAGGTACAACATTTTGTTGGTTAGTGGAAACCAGCCCTAATGA CTGTTGCTCTTCATGCTTGATCTCTTGGCGATGTTGCGTCTTGTTTGTAG CCGGTTTGGTCGGCGTCATAGGGCCAGCGGCACTGTTTGATAATAGAGAG ACCTTGTCATCTGGAGATTTCTCTGAAGCATCTAATTTATCAATCAAGTT TTGAATGCTTTTGTctggttttgttttcaaatgttGGTCCTGTTTTTTGG CCGGTGAGTCGGTCTTCACCTTCTGCTTTGTATTGAACTTATTTGCCTCG ATTGCtttgcttttgatttttttgtcaacCGTTGGCGATACATTTTGCTC TTTCTTTCTCTCAATTGccttatttttgatttttttgctgcTCGACGAGT CATTTGACTTTGTTTTTGTCTCGATTGCTTTGTTTTCAATCTTTTTATCA GCAACGGGTGACAACTTTTGTTGCTTCTTTAACTCGCTAGCCTTGATGTC AACTTTTTTTGTCTCTGTTGTAAAAGTAGgttttttatctgttttactAC TTTTTGTTACTGCTGGTTTCAGTTTTTCAGTTGTTATTACAGAAGGATGA GGGATTGGTTGCTGTGAAGTAGCTGTTGTATGTTTCTTCTTGGCCGTGTT GTGTTCTGGCATCACTTTCTTCTTCTGTATTTTGG
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000112TCONS_00000112Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2134555..2135889 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 0 0.1 0 0 0.58 0.61 0.33 0 0.55 0 0 0 0.18 0 0 0 0 0 0 0 0 0 1.16 0 0 0.18 0 0
Spatial Expression
in the tripal_feature_cv_term.tpl.php