XLOC_000059 (gene) - C. hemisphaerica

Overview
NameXLOC_000059
Unique NameXLOC_000059
Typegene
OrganismClytia hemisphaerica (Jellyfish)

Sequence
The following sequences are available for this feature:

gene from alignment at sc0000001:2089782..2091678+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>XLOC_000059 ID=XLOC_000059|Name=XLOC_000059|organism=Clytia hemisphaerica|type=gene|length=1897bp|location=Sequence derived from alignment at sc0000001:2089782..2091678+ (Clytia hemisphaerica)
CTTACCTCTTCATCTGAAGACTCCTTCCCATTCTCCTCAAGTGCGTCACC TTCGCTCATCGCTTCTCGCATTTCATCCTCATCAATGTTATCTTTATTGT TATCGAACACAGTCTTCCAAATTTTGACCTCGTGTTTTAATCGTTCACTC TCTCGATACAATTCCTCGTAAATTTGTATAATCTCATCTCGCTCTTTGAT CAAATCCTCGTTATCCACAGCTAAATCTTCGTTTTCTTCCACTATTTTTT CGTTCTCCAGTTGCGAGTTGATAAGTTCCTGTCTTAATCTCCCGATCTCG TAATTTGCGTCCTCAAGTTTAATTCCTAGCCTGCGTGTCTGATTTTTCTC TTCCTCCAGGctattattgattttctttagcTCTCGTTCGAGTTTCTTAA TCTCTTTCATAAAACCATCGCGCTCATCTAAACTATCTTGTAATTGAGCC TCCAGTTCGTGTATATCTTCACCAGATCGAGGTTGTTGTTCCATTTGTTT GATACCGTTCATAAGAGCAACACTTGCGTTctcaaaatctttttccaatT CCAATATCTTCTCCTCTTTCATTTCCAAAGTTTCCTTAAGCTCTTCGAGT TGAATCGTTAATTCTTCGATTAAATCTTCTTTCGATTTTATCGTGTCTCT TTCGACTTGAATTTCATGTTCTAACTGTTCTATTCGTTCCTCACGATCAT TTAAATCTTTTTCCATTCGGATTTGAATTTCTTCCTGTTCGACAAACTCG CTTTCCAAACTTTGTAAATCGTTTAATTTCTGATCGTAATTGGTACGTTG CGTTTTTAACTCGCTTTCGAGGTCTTTAACCAGTTCTTGTTTCGATTTAA CGTCTTCGGAAAGATTTTTTAACTCTTTAATTAAATCTTNTCTTTAACCA GTTCTTGTTTCGATTTAACGTCTTcggaaacattttttaattctttaatt aAATCTCGAATTCGTTCATCCTTTTCCTTCCGTTTTTCAGAGTCCCTAGA GCATTGTTTTTCTAGTTCCTCAATTCTTAAATCcttttctttacattttt caaactctttatttttatcattttctaaTTGGATTattctttcttgtttt tctttacaCTTATTACAGTCTCCATCTACCGTGGCTGTAACAGATGTCGT CGTTATCGCTGTGTCAATACCGTTCACTTTTGATCGTCGAGAACGTCTCG GTGATTCTATAACCGGATCATCAAGTGTACGGCGAGACGTTGTCCGATAA GAGCGAGTTTCGTCTGCAGACGTGGTACTACGGTATGGACGGTCGTATCT GGAAGATGACGTCGTTGAATAATCAGTCGTTGGTGTATAATCATCTAAGC GTCTCGAGCTACGGCTACTTCTGTACGTATCGAGCGGGTCGTCTAGTACG CTTCTACGGTATCGGCTACTGCCTGCGCTAGTACCACGTGTTAATCCACC AATGTCATCTGAGTAAGAAGTTCGGGTTGAACGGTAAGAAGAACGGCCGA GTAAATCATCCGAGTTTCTACTACTCGAATACCGAGTTGATCGTAAACGT TCGGTCATATTCTCGTCTTCCGAGTCGCTTTTACCGTCGGCTTTTTCGTT TTCTCGTTGCTCGGTAATCGGGACCGATGGATTTTTCGTATTCTTAGATA AAAATTGTTCAGGACCTTCAATTTGTTTTAAATTGGTTAAATGCCTGATT TCGTATTTTAATAAAGAAGCTTTTGGAAATCCAGAAGATTGGGTACCGTC ACCATTTTCTGTTGGACTTAAAACCAAGTTGTTATTTGCACTAAAATCAC TTTTCCACTCTTTATCATCTGCAGTGTGAATGGCCCACTTGGGTTGTGTC GTATTTGTGGTGATATCACGGACTTTGTTTGAACCGTCTTTTTCTAT
Gene-mRNA-Prot
The following transcript feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
TCONS_00000111TCONS_00000111Clytia hemisphaericatranscript
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
sc0000001supercontigsc0000001:2089782..2091678 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.36 0 0.07 0 3.1 2.11 2.83 4.4 0.29 1.27 0.14 0.67 0 0.06 1.45 0.34 2.54 0.27 0.22 0 2.32 2.81 1.2 2.89 0 0.4 0 0 0.01 0.56
Spatial Expression
in the tripal_feature_cv_term.tpl.php