Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

gene:BL97480 (gene) - B. lanceolatum

Overview
Namegene:BL97480
Unique Namegene:BL97480
Typegene
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

gene from alignment at Sc0000011:1514486..1519528+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>gene:BL97480 ID=gene:BL97480|Name=gene:BL97480|organism=Branchiostoma lanceolatum|type=gene|length=5043bp|location=Sequence derived from alignment at Sc0000011:1514486..1519528+ (Branchiostoma lanceolatum)
CACTATGACATATGGACAGGTACATACAGTCAGCTACTCTCTTTATACAC TCCAAGTATTGTTTTTGATGGGCTATATGTCTTTGTGTGTCTGTGTGTGT GCGTGTTTGTCTGTCTGTCTGTGACCATGTGCTCTCGCTACGACGTATGG ACAGGTACGGACATTGAGCTGCTTCTTTGTATTGTTATCTGTTCTGTGTG TGCATAAGAACCCACACACTTATCTATAACAGTAGGCATGTGCCCCGGTA TGAGGATACATGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAG GGGTGGGTACCGGTACCGTGTACCGGTACAAAACCGGTATTTCTTAATGG ACCGGTCCAAAAAAAACGGTCCGTAAAAAATCAGTGGACCGGCCTATGGA CCGATTAGAAAATTCATAGTACCAGGCTACCAGCAGGCGGCCACATAACT GGTCTAAGAAAATACAAAACAGCAGATTTAACGAGTCGTTTTCGAAGACG TTAGCTGTGAATCATATCTAGAAACACTTAAAGGATGAGTTAACAGACAG CGAGGAGAGTATAGTTATAATTTTGAGACAAAGTGCAAACCTAAGAAATT ATATCGTTCCAGACTTGACGTTTATTTGGAGACTTTTACGTGTGTCTCGC TCTCCAAAATATGATGTACTGCGACACTACTATAATCAGGTACAGGTACA GGTCCGGACCTGGACCTGACCCTCTGGACCTGGACCTGGACCGGACCTNT ACAAGTCCGGACCTGGACCTGACCCCCTGGACCTGGACCTAGGACCTGGA CCGGACCTGAATTTTATGTACCGGTACCCACCCCTAGTGGGGGTTCTTTT TGTGTTCCAAGGTGTGGTTTTCCTTAAACACATGCAGGAACTCTGACTTA ACATCATCTTTCCTTAATATCTAAACCCTTTTTATTTTCTTATCTTGAAG GCACGTGGCTGCGGATGAAGTCCATGCACGAGAAGCGGGCGCACTTCCAC CTTAGCGCGCTAGGGGGCAGGCTTTACGCCGTCGGTGGAAGGAACAAGGA ACAGAACCTCAAGTCTGTGGAGGCCTTCCTTCCGAGGGAGAACAGGTGAC TGCGTTTTCTTAAGATTCAGAAGTCTGGATTCCTTGGTTCCTCAGAGTAA AGATTGAGCAAGCTGACAGGACGAAAACAGTCATGAATTGTTTGGAACAG GTTGGTTAGTTGGAAGTTTGGAAGAAAACGTGCTGCCCTTTTTGCCGCTA GGCACTACAAGGTGAACAACAACAAGTAATGATTGGTCAATTGGTTTATT GATTGATTGATGTATTGGTTGATCAATTGACAGATGGATGTACACCCAGT GCATTTTCATAGACAAGCTTGACCAAAACTTAGACATGTATTGCCTACTC ATTAGATGATTGATTGATTGATGTATTGATTGATGTATTGACAGATGGAT GTACGTGGCGCCTCTACGCGGGTACAGTACGGGTCACGCAGGGTGCGTCT GCGACGGGAAGCTCTACACCAGCGGTGGCTACGGGACCTCCATGAACAAC GTGCCCCACGAACGCGTTCTACAGTTCTACGACCCCGAACAGAACGCCTG GCAGTGCCGTGCGCCCATGACGACCGGGCGCATCTGGCACTGCATGGCGA CGCTCGGAGACAAACTCTACGTAATGGGCGGAGACATCGGCGACGCGAGA CTTCACGTTCTAACTGCGGAATCGTACTGCCCGGCCTCAGACCAATGGAC AGCCATCGCGCCGATGCTCACGGGACAGAGCGAAGCGGGCGTGGCGGTTA TAGACGATAAAATCTTCCTCTTGGGAGGTTACGATTGGAACAATAGGGAC GTGATCGGCAGTTCACAGTCGTACAGGCCGGAGGATAATATATGGAGACG GGAGGCGAGCCTACCTCAGGCCGCGGCAGGAGTCGCGTGTTGTGTCGTGA GACTACCGACAAGATACTCCCGTATGGCGGAGGATTGAGGAACCAAGAAA GGGGAGAAATCTTTAAGAAATGACAAGTTAGTTAAGAAATGTTTAATGTT GTTCCTTGGATAAGATTTTGTCAGGCCGTGTTTATTTGTTTACAAGGATG ACACCCATGCAGGTTTTGTCTGTTTCCCCCACAAAAAAAGTTTTCCACCA TACAAAGCAGCTGCAAAAATGAGCAAATACTTGCCATATATTGCAAAAAA ATATTGGGATTTGGATACTGATGTTATAGAATGCAAAAGTCCATTCCAAA ATCAAAGAAGAATCTATTGTTCTGTATACCGTACTCTGTGTGCATTTGCT CAACCTTTTTTCGCATACATCCATTAGTTTTTGAAGATGTCATCCATGTA ATCAAATCAACATGGCCTAACTACAAGGGGTAGATGGTAGATACATGTAC TTAAGAAATGTTATTAAAGATTAGATAAGACTTTATTACTTAAATTTAAT AATATAAACTTTAAGATGTATTACTATTCGGATAAGGTTTTGCTAATCAA AGATATTCAACGTAGATATTCAAGAACTATAAATAATCATAATTACACTT AGCAGGTAGATGGTTAAGAAATGTTGAATGTAGTTTGGTCTCATTTTTCT CAAAGAGAAATGTTGTTTTACTTCATTCTAGAGCTTTAACCCTAACCCTC CTAACTTCTGCTGTTACTGATTCAAATTTGGTTCATGAATGTTTGCCAAG CATAGAGAAGGTTAAAAGATGATATTGTATCATCCTCAAGAAGACCAATT ACAAAATGTTTTGTGAAAACATATTCCAGAACTTCGAATTTTCCAAGCAG ATAGCTTTGTAATGTTGTGTTCTATATTTATATGCCTTGTATCTTTTTAC GTAGCTATTTGATCAAAACCTGCACTTAGTGCACTCGCTTTTTCACTCAC TCACTTATTCATTCACTCACTCACTCACTGTCTCATTCTCTCACTCCATC AAGTTCATTCAAAACCATTCCATAACTTAATGATTTCCATGTATTTCCTT CCTTCATTCCAGCAACTATTGAATTTCCGTCCACATTTTCATCATGTGTA AGTTTGTTGATGACATTTGTAGTGTTTTCCTTGGCCTTCTTTGGCTTCTT TTTTCATTTGTTATCTCCAGCAATGTTAGCTTATTTATGTATGATCTCAG CCTAGTTCTTCTTTAGCAGTATTTGTTGTCTTTTTATCATACGTAGGTAT TAAGAGGCTTTAGATGTTACTTTTAGTCAACATTTTTGCAATCTGGTAGG TTTTATAACTGTCCTAATGTTAGGTAGATAGGCATTGGGAATTTCTTCAA AGTGAAAAAAAAAATATTTATCCGGTTCTTCTAACTGCTGCTAAGGACTA AGCTTAAAGGAGACAAAACAATATTTGAAATTTGTACAATGTTAAAAAGC TGCAGTCTTGTATAGCCCTGCAATATATGATAAATAACTTTTGCAGCTTT TAATAGTCAAAATAAGGCCATCCCAATTGTATTTCTCGTTTAACCTATTT CACTATGTTTTAAAAAGATAATCACATGTATCATTCAGAAGCTATATCAA TCCAGAAAATGGTCATAGTTAAACCAACAATCGGAAAACGCAAAAATTGG AAATTTTGTGTGGTATACAGGCTATAGGAGATTCTTTTTAAACAGCAATC TGACCTGCTAATGTTTTGGATACAAACTTAGCCACGTTTGGGACAGTGTT CTCACCTCAAAAGCACCACCTACATCGGCTACTTACAGCGGTGAGAAGCA GTACTCCAGTCAGAAGCTCTGAAGAAGGTGTCTGATAGACACTGAAAAGT TAGCAGGTGAGATTACCTGGTTGTGTAAAAAGAGTCTCCTATACCCTATA TTCTACTAGCCTGGATACCAGACCCCCAATCTCTAAAATATATATACTCG ATATATTTTTTAGAGATTGGGGGTCTGGTATCCAGGCTAATATTCTACCA ACCTGATGAAATTATTTTGGGGTGTGGTATTCAGTTGGAAGAAAAAGCTG CCCATTATGTAAAGCTTGCTGCTGTAGTCATTTGTTTTAATTAAGAAATG ATATATAAGACCAATTTTTCTATGAGGTTTATAAATGTTGTGTACATATC CTAACTTATATATGTTATTTGTGTCGAAGACACAGTTAGTACATGTTTTA CCTTACATTTAATGGTCAATTCTGATACCCTGGAGCAAGGACATTCCTAT ATAATGTCCTTGCCTGGAGACAGACCGATTATACTGGACATGTTTTCAGA AATATGACCAAATTGAGTGTGTTTGTTTGTCTGTCTGTTTGTATTGTATA CCCAGTAAACTGCCTCATGGCATAACACAGCAGGTTTTTATTGAACAGTA CAAGCTGCATATCCGGACAGATTTGTTTGATCCACTCACACCAGGAAGGA CCCCTGTTCTTTTCGAAATGTGTGGTGGATTCTTTTACATGCTCGAGGTG TGGCTCTCCTCAAACATGACCATGATGTGTTTTAGGTATGCATGTGAAGT CGTTATGTGGGCAACATTACAAAGGATTCATTTCCATTTACCTGTATTTT TGCCTCTGCATGTTTATGAAGACTAGACCAAATTTGGAAAAACGTTTTCC AAGGTTTTAAAGGCCACAGTTTGAATGTCAGGAAATGACTATACAGTGGT CAGATTCCTATTGAAATTTTTTAAACAATGTTTGACATGAGAAATAAACA TTTGCTGTTTCGAATTTGGAAGAACTTCTCACAAGTTTAAAATGTCACAT TTTAAAGACCGTTACAGTTATGATACCACTGGAATTGCCAATGGCTTATT GAGGCACTATTGGCTACTCCCGCGAGGTGTCGCCAAAAGCGTTTCCATTT TGTGAATGATCCAAATAAAGCTGCTTCTGTTATTGACTTTGACCATGTGT CCAACTTTGTCTTAAACTACTACTTCCTCCAATGTTAAGTTAGTTAAAGT ATCCCAAACATCTTCATTAGACGCATAGGGGTGGCGCCCATCTCCATTTC TATAGCCCTTAAGCCACACATTTGTGCAAGTCACTACAGCAGG
Gene-mRNA-Prot
The following mRNA feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
transcript:BL97480_cuf3transcript:BL97480_cuf3Branchiostoma lanceolatummRNA
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
transcript:BL97480_cuf3transcript:BL97480_cuf3-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000011genomeSc0000011:1514486..1519528 +
Properties
Property NameValue
Logic namegff3_genes
Gene idBL97480
Biotypeprotein_coding