Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

gene:BL97461 (gene) - B. lanceolatum

Overview
Namegene:BL97461
Unique Namegene:BL97461
Typegene
OrganismBranchiostoma lanceolatum (Amphioxus)



Sequence
The following sequences are available for this feature:

gene from alignment at Sc0000311:14607..19144+

Legend: gene
Hold the cursor over a type above to highlight its positions in the sequence below.
>gene:BL97461 ID=gene:BL97461|Name=gene:BL97461|organism=Branchiostoma lanceolatum|type=gene|length=4538bp|location=Sequence derived from alignment at Sc0000311:14607..19144+ (Branchiostoma lanceolatum)
NNNGTGTTCACATTATGTTTCTGGTTGTTCCACAGGGCAGAAGTATGAAT ACGAGTACATGAAACCTCTGAGGACTCACCCCGATGTTCCTCTGGAGGAG TATCCCGCCGCCTGTGTTCCCATGCCGACAGGGGAGATGTTCACTCCGCA GAAAGCTGGACGGCTCATGGAACGTCTCATGCAGTTCATCGCATCCCAGG TGTGTGTCATCATTGTTCTGACATGAACATGACAAAACTGCTTAGTAGTA ATTTTTTCATTGCCTTTCGCCAGTCGTACTAAAATCAGTTTTTTTTTTCA AATGATCAGTCCTCTTTTTTACAGCTTCGACGAGAAGTGTGGCATATGAA ATATACTTGCAATGAAATAGATGCTTGTAATGCGTCGATAAAGGATGGAA ACCGCTTGTCTTTTATGCGAGATCAACAGTTTACAGACAAGGGACAAGAG AAGCTGACTGAACCACCGTTGCACAGATTACAATCATGTGTAAATCATGG TTACAATCTACACAGGGCCAGATCATGGTGCGCCGGGCCCAGGCAAAGGG TATCTGGGATCCGTGGAAGGCCAACTTCAGCGGCTACCTTCCTGCTAACG AGAGGCTCATTGAAGAATGGCAGAAAGACGAGGAGTTTTGCCGCCAGTAC CTCCAGGGTCCGTTGCAACATTTTCTTTCTAACACACATAACAAAAGGGA ATTGCAATCGAATTTAAGAAAAAATGGTTTGTCTTTCTTGTTTTCACATT TGTTTAGTAACATGCAACACATCTACTGTATTGTTAATGATTGTATGATA AAACTGTCGTATGCGATACAATGTACTACAATGTGGTATTGCGTGCTTTG ACTGCTTGAACAACGCAAGAGACATAAATTCACACTTAGAATAATTTGGT ACGTTTCAGTAAGAAAGCAAAATAGTCCAAGAAAAGCCACATGGTTATTT CGTTTTATTCAACATCAGGCATCAACCCCATGCTGGTGACCGTGTGTAAG GACCAGAGCCGGATCCCAGCAGAGATGCTTGGCCTGAAAGGACAAGGCAA GACTACACTGCAGCTCATGGAGGAGAACAGGCTCTTCATCGTGGACTACG CACCCATGCTCGGTGTTCCTCCTACTCCGGGCAAATTCTTCTACGCGCCG ATCGTGCTGATGTACAAGGAACAGTTGGCTGGAGGGAAGTCTCGTCTGAA CATGCTCGGCATCCAGCTAACTAGAGACAAAGGTAAGGCATAAGAAGGGA ACGTGTAGCTTTTCCCTTTCAGATTTCCCGCTTACATAAGCCACGTTGTA GTCCTCAGATTGCTATTATACATACATGTGGATTGTCTAAAAGCTAAACC GCTCATTTTGTCATAGGTGAGAACGAAGTGTACTCCCCTGAGAGTGCTAA GACTCACCCCAACAAGTACATGTTCGCCAAGATGCACGTGGTGTCATCTG ATAACAACGTGCACCAGTTCCTATACCATCTGGGCTACACTCATCTCGGC ATGGAGCCGTTAGTGGTCGCCATGCACACCCACCTGCCACCAGACCACCC CATTCACCGCCTGCTGCTGCCGCATTTCAAGGACACCATCGGCATCAACT ACCTGGCCCGCCACTCCCTCGTCTCCAGGATCTTCCCAATCACCGACCCG ATGTTCGCTACTTCCACCGTGGGAGGGCTCATCATGTTCCTCGAGGAGTG GCGCAAGTACAACTTCATGGACATGGCGTAAGTTTTGCAATTCGATATTG AGTTTCGATGTAGCGTCACTTAAACAAGCATGACACGTGTCTTTCATTTT GCATATGGATGGTTAGTATTAACATGGTAAATTCCCTTTGGTCACCAAGC CTTCGATAACCTATATTCTATTATTCTATTAAGTTTCCCTGAAGAGCTGA AACGCCGTGGTTTCGATGAGGCCGGGACGGATGGACTGGAAAACTATTTC TATCGCGATGACGGCTTCAAACTGTGGAACGTCTACAAAACGTACGTGAC GGGGATGGTCAACCATGCGTACACTGGTGACAAAGCTGTGCAAGCTGACA AAGGTTTGCTACCAAATATTTCCACAACCTAAAAATGAATGTGTTTTTTT TTTATTCTTAAGGTAAACAGAAGAAATTAAGAAACAGAGTCTGTATGTAG CATTGACGATACTTTGTTTTCCATCATTTTTTGTTTGTAGCCCTTCAGGA ATTCTGCAGGATGACTGAAGGTCCTGGACATCTTCACGGATTTCCACGTG AGATTTCTACCAAGAAGCTGCTCATCGACTGCCTGACCAACATCATCTTC AACGTGAGCGCGCAGCACTCCGCCGTCAACTTCCCGCAGTATGAGTACTA CTCCTTCATACCCAACAGGTACGGAGAGCTGGAAATATTCTCTTTTAAAA GACATGATTTATTGCATGCTATCGAGGTTTCGAAACGGTAAAATGAATTT ATTACAAACGTCTTGATTATGCAAGTCAATTTACGCTATGTGTAACGTGT GCTGACATGTCATACACGTGTACCGCTCGGACTCGGGGATCAGAAAGTAT TTCAAGCGGACTCTAAAAACACTCATTCCACCCTACCTCACACAGGCCGG CCCAGCTGTCGATGCCGATGCCTGACGGACCGAACGACATGTTGGAGTCC GCTGTACTCGAGGCTCTGCCGCATGAAACGAACACGACTCTTCAGGTCCT CCTGTCGTACATGCTGTCCATGCCCTCCCAGACTGCTATCACTGGGGTAA GATTCTACTTTGAATATCTGTTATGATCCCCATCGTTTGTAAAAGACACG AATTTTTTCAACGTATAGATATTACATTTGTATTCAGAGCCATGATATTT CTGAGTAGCCCCAGTCTAAGTAGTGATTGTAATGGGTCCCGGGTGAAAAA TTTTAGTTCTTGCATCTCATAAGGATACATCATTCTCAGTGTGTCTTATT GCATATTATCATATAGCCAGATGTCGTTGACCAATCAGATGTCTACACAT ACGGGTCATAGTTTTCACNTCAGATGTCTACACAAACGGGTCATAGTTTT CACATATTCACCCCATTTTACGGGTCATTAATGTCCATACAACACTTTTT CCAGGGTTCCCATTGTTTTTTATTCGATTCTAAGGAACTTTCTGATATAG ACAGACTTGTAAAAGCAAAGTGATACATGAATTTAGCGATGATAAAAAGT ATACACGATAAATAACAACATTGATATCATTTCCAAACTGCCCCCTACTT TACACATGGTACAGGCCTCAAAGGAGGCAGCCATCTTGATTTTTTGCGGT GGTGTGACGTTTTTTGATGCATGACAATGGCTATATGATATAACGTTACC GACCCGGAAATAACACATTGTCGGTTATCATAACCACCTCATAGACGACC TCGTCCGCATTGCGGACTCGGTCGATAATTCGGTGGNAATTATTTGGTTA TAGACAATGGGTTATGACACCGTATAGACCAAAGGAAAGCCGGTTATTGA CCCTATATTAGTGACAAGCGTGTTGTTTTTTAATTGTCCTTTCCTTTTAG CGCTAGCCCTCCCTTGGTTCGGTTGGTTGTTGTTGCCTTTTCCTGTAACG TACACCTAATGCTCAGTAAGCATTACATCTCATATGTATAGAATTGCTGT TATTTGGTTAAAACCTACAGTACCTACTTTCAGCGTACTACCAGGTTCTC CTCTGATTCACACCACTACACTGTACAACTACCAGCCTCTAAGTCATTCT ACAGTAACAGCTTTTTTCCACGAACTGCAAAACTCTGGAATTCCCTCCCA GCCCACTGCTTTCCCCCCGAATACAACCTACAAACCTTCAAAACAAACAC ACACCGCCGTCTCTCACCTATGCCACATTAGTTCAATTAGTTCAATGCCG AGAAGTGGCCTCTAACGGCCCTGTATTGAGCGAGATCGTTAAAAAAAAGA CGGACCGATAAGAATGCTTTGTTTGTGTCATGTACAGGTGGAGGCTATGA AAGACGTGTACCCCGATGTCCATGAGAAATTCCACACACAGCTCCTGGAC CTCTCCAAGGAGATCAAGGCTCGTAACGAGGGTCTGAAGGGGGAGGGGAA GGTCGCCTACACCTACCTGGACCCCGAGAACGTCGCCATGAGCATCGACA TCTAAAGCACACCTGTCATCTGGCTGGTGTTTCGTACAGAAACCTCTAAG ATGTTATCAGTGGTGGCAGTACGCTACAGTACCTAACGAAACGACGCCAT GATACTTGAGATACAGCTGGAATTAGTGACTGCGCTTAACATCCGTAGAG AAGAGTTGTTCCAATGTAGGCATAAACCAGCAGCAAGCGTTTGTGATGGA TTTTTTTAAACTATGATACACAAAGAGAAATCAATAATCACACAAAATGT AAGGCATGTGTTATCCACAATTAGCTTAACAATATGTGTTGACATAGTAA GTGAATTTGTTCAGTGGAGTGCTATAAACCAAAACGTACAAGAAATGTCT GGTATGGGCAAGTGACAAAGAGCTTTTGATAATGTTTG
Gene-mRNA-Prot
The following mRNA feature(s) are a part of this gene:
Feature NameUnique NameSpeciesType
transcript:BL97461_cuf1transcript:BL97461_cuf1Branchiostoma lanceolatummRNA
The following polypeptide feature(s) derives from this gene:
Feature NameUnique NameSpeciesType
transcript:BL97461_cuf1transcript:BL97461_cuf1-proteinBranchiostoma lanceolatumpolypeptide
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Sc0000311genomeSc0000311:14607..19144 +
Properties
Property NameValue
Logic namegff3_genes
Gene idBL97461
Biotypeprotein_coding