Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073835 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073835
Unique NameTCONS_00073835
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1148

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073835 ID=TCONS_00073835|Name=TCONS_00073835|organism=Clytia hemisphaerica|type=transcript|length=1148bp
GTCTAAACGACCGCCCATGTTGAATCTTCCGTACTCTGTGATAATAATGT
GTGCAATGAAGAAATTGACCTTTTGACGATTTCGATGTCCCAGTTGGTTT
GGTTTTTAAATACCCTCCCCATTTGTGTCGGATAGTGTTAATCATTTATA
GCCGTGTTGATAGTTGTTGAGCTTTTGTAACATCATATGTTGGAAGTTGG
TGCACTGGTGTTGTAGATTTCTCCCTTGTTAAATCTTCTCTCGTATACGT
TATGGAAAGGAAGAAATTTCGAAGATGATTTATAATCATGGTAATATTGT
ACTATTCTTCTGTTTTGAATAACTGAACATTGGAGAAGGAAACAAGGGGA
CGTGCTTCTTCTTTCTGACACGCTCTATTATATTACTTTACACTGACATT
CCCCACAATATATTTTTACGTTGAGTTATTTTAATGTATTTAGACGGGAT
GTCTGCGCATGCTTGTATTTTTGCGACGTGAGGTCATTGTCACAAGATGG
TAGACAAAGATGTGTAGATGTCGCTTTATTTGTCACCTTGTTTAATTAAG
GGCTCTTAGGCACGTGTCCCGGATGTTTTTTTTGTGTATTCTGTGGCATA
ATTAGTAAATGTTAAGGCTTTTTAACCTCTCTTTATAGGGATCTGGGGCG
AGTGAAGATTCAGAAGAATTGGAGAAACAAAACCTTATCCATTTTACTGA
CTCTcacaatttcattttgaaaaaatattctcatTTTAACGTCAACAGAA
ACATGCTTAATTCGTGTGTTTGTTTAAAAGACAGGACTCATTAGCTTTCG
TAATATTTAATGAGAATCAAATAAATTGTGCTTAATTGAGAAAGTCATTA
CTCCATGGTTTAAGATTAATGATAAATATTGAAGAATGTCTGGCTAACGA
TCTCATTTCTTGTGCACGACTCGTGGTGTCGGTCAGATTGCTGAAGTTAA
ACGAGCTTTTGGAAAAGTGACATAAAGCTGTCTAAGCTCAACCAAAGTTG
TTTACTACTTTACATTCtaagtatattaaagtatgtacacgtttttttta
taagaacgtcaaaagttttcgaagccttcggatgttcttagttttttgga
tttgaagcctaaaaatgttcttaaaatgttcttattttcagcattttt
Run BLAST on NCBI

transcript from alignment at scaffold_98:86037..87184

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073835 ID=TCONS_00073835|Name=TCONS_00073835|organism=Clytia hemisphaerica|type=transcript|length=1148bp|location=Sequence derived from alignment at scaffold_98:86037..87184 (Clytia hemisphaerica)
aaaaatgctgaaaataagaacattttaagaacatttttaggcttcaaatc caaaaaactaagaacatccgaaggcttcgaaaacttttgacgttcttata aaaaaaacgtgtacatactttaatatacttaGAATGTAAAGTAGTAAACA ACTTTGGTTGAGCTTAGACAGCTTTATGTCACTTTTCCAAAAGCTCGTTT AACTTCAGCAATCTGACCGACACCACGAGTCGTGCACAAGAAATGAGATC GTTAGCCAGACATTCTTCAATATTTATCATTAATCTTAAACCATGGAGTA ATGACTTTCTCAATTAAGCACAATTTATTTGATTCTCATTAAATATTACG AAAGCTAATGAGTCCTGTCTTTTAAACAAACACACGAATTAAGCATGTTT CTGTTGACGTTAAAatgagaatattttttcaaaatgaaattgtgAGAGTC AGTAAAATGGATAAGGTTTTGTTTCTCCAATTCTTCTGAATCTTCACTCG CCCCAGATCCCTATAAAGAGAGGTTAAAAAGCCTTAACATTTACTAATTA TGCCACAGAATACACAAAAAAAACATCCGGGACACGTGCCTAAGAGCCCT TAATTAAACAAGGTGACAAATAAAGCGACATCTACACATCTTTGTCTACC ATCTTGTGACAATGACCTCACGTCGCAAAAATACAAGCATGCGCAGACAT CCCGTCTAAATACATTAAAATAACTCAACGTAAAAATATATTGTGGGGAA TGTCAGTGTAAAGTAATATAATAGAGCGTGTCAGAAAGAAGAAGCACGTC CCCTTGTTTCCTTCTCCAATGTTCAGTTATTCAAAACAGAAGAATAGTAC AATATTACCATGATTATAAATCATCTTCGAAATTTCTTCCTTTCCATAAC GTATACGAGAGAAGATTTAACAAGGGAGAAATCTACAACACCAGTGCACC AACTTCCAACATATGATGTTACAAAAGCTCAACAACTATCAACACGGCTA TAAATGATTAACACTATCCGACACAAATGGGGAGGGTATTTAAAAACCAA ACCAACTGGGACATCGAAATCGTCAAAAGGTCAATTTCTTCATTGCACAC ATTATTATCACAGAGTACGGAAGATTCAACATGGGCGGTCGTTTAGAC
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045853XLOC_045853Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073835-exon-scaffold_98-1491911889:86037..87184TCONS_00073835-exon-scaffold_98-1491911889:86037..87184Clytia hemisphaericaexon
TCONS_00073835-exon-scaffold_98-1510915933:86037..87184TCONS_00073835-exon-scaffold_98-1510915933:86037..87184Clytia hemisphaericaexon
TCONS_00073835-exon-scaffold_98-1575043694:86037..87184TCONS_00073835-exon-scaffold_98-1575043694:86037..87184Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_98supercontigscaffold_98:86037..87184 .
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.416567 0.332839 0.128489 0.251392 0.254882 0.120815 0.146014 0 0.223065 0.0790214 0.153139 0.327585 0.226526 0.0261136 0.10764 0.0230439 0 0.0873281 0 0.12628 0.110229 0.160898 0 0.0395331 0.0405844 0.108711 0.10474 0.11134 0.0847046 0.086165
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073835 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top