Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073672 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073672
Unique NameTCONS_00073672
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1329

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073672 ID=TCONS_00073672|Name=TCONS_00073672|organism=Clytia hemisphaerica|type=transcript|length=1329bp
TTGGAAAACATGGCTATATTTGTGAGCAAGATATCAACGTAACAGTTCCT
TATTTCACCAAATCTTCATACATGTCTATGGTACCGCCCGCTGATTTGAG
TATCCGAACGAAAACGATCATTTCCGTGCGTTTCAAAGCGGACACTGGGA
ACGGACTTCTTTTCTATACAGCACATTCGATGGATAGCGGTTCCTTTGGT
GATTTCATTGCTGTCAGTATTTGGCAAAGATACATTTATGTTAAATTCAA
CCTTGGCACTCATACAGCCTCGATGCGCAGCCGACAAAAAATCACCTTTC
ACAAATGGCATAGCCTGTATATTCGTCGTGAAAACAAAGAAGCTGTAATG
AGGCTAGATGGAAATTACTACGTTGGAGTGAAAGCCTCTGGTCCAATGTC
GAAACTAGATGTTTCTTCAGACTTCTACCTTGGAGGAGCACCATTACTGT
CCAGTATTCAAAAAGCAGCATTGAAAGACGTACAATCGCAACATGATTTT
ACTGGATGTGTAGATTCATTCAagATAAATGGCCACCATTTCGAATTATC
ATCTTCAATCAAATCAAACAATGGTCGAAATATTCAAGAATGTGGTACGG
CATGCTCACAGAATAATTGTCAGAATGGCGCACTATGTTCACCTCTAGCA
CAAGATTTGAACACAACGGCACCTGAAGACGTCGGTTACTCTTGTCAATG
TCCATTGGGTTTGAGCGGACAACTGTGTGATAAAGaaatcACGACGCTTA
CTAAAGGCAAATTCGCAAACACAAGCTATTGGTACAGTAGACGTTCAAAT
TTCAGcTCGACTTACTACTCTCACCTGAAGTTGAATTTCCAAACAAGCAC
GTCGGACGGTCTTTTATTCATGAACGCGCGGTTAAAAGATGTGAATAGTG
ATCAACTAATGATTGGCTTAGACGGAGGGAAGTTGAAGATAGTGTTTGTA
TTGGACAAAATAGTGGCTTTTGCGTACAGTGATTTTTTATATGATGATGG
GATAGCTCATAAATTAGTTGTGTCCAGAATTGGTAATATGATTCAATTCT
TTGTCAATGGTCACACTCCAAAAATCATGAGTAATACTCAAATCAAAGAA
TCTATGACAACAGATGGCCATATTTATATTGGTGGTCTACCATCGGATGT
CCGAAAATTAACCAAAACTCATTTTATGTCCGGATTTAATGGTTGTATTT
CTGAAGTCGAGTTTAACGAGGAGAAATCAGTAATTGATTTTGCATCAAGA
TCGAATAGCGTGGGAAGGAACATTGGTCAATGCATatgaaaattttggat
atttatAGTGAGTGTTAAGAATCTTGCAA
Run BLAST on NCBI

transcript from alignment at scaffold_97:661323..668383+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073672 ID=TCONS_00073672|Name=TCONS_00073672|organism=Clytia hemisphaerica|type=transcript|length=7061bp|location=Sequence derived from alignment at scaffold_97:661323..668383+ (Clytia hemisphaerica)
TTGGAAAACATGGCTATATTTGTGAGCAAGGTAAAAGTaaagtttgatgt tttttaatgGGTTTAAATTTTAATAACCCTATACTAaactaaatcaaatt tttttgtagTGTTTATCTATAGTGGTTTTTGTATATAATTGGAAGGGAAC GATACCTCGAAAAAATACCGTAGGATAGCTAAATTTTCTATTATTTCTGG GGACACTTTCCTATTGCCATACTCTGGATAGGTACAAAAGTAATTTGTTA GGCGGTCACAAGGTCATTGCGTGTTGTGTACGCATTTGTACCCAgcaaaa accatttttttgcCGGTAAATCTAAAAAAGACAGCGGGAAGATCGCCGAT ATGTACCAGGAAGGTTTCACCGAGGAATTACTACAGTACTGTACTATACT GCATCTTCAACAAAGTCGCATCTGATTGAGTACAAATGAAATGACTAGAA ATTAGCAAGATGATTTAAACATGCCATCCATCActttgggcttttccaga aaaaagccgtacaccccctgttgaggagctccaaccttttggaattccag gcaattttaggatcatacccctctggaataccgaatttttacagattttc aatcattacccccatggaattccacttatttttgacggatttttgtctac tgctatggaattccactgcatttcaaaccataACCCCTTGGAATAGAAAT ggactcctcaacagggggtgcacggtttttttctggaaaagccctttTCA AGTACCTATGATTTATTagatccagggtggtcagtactaaaatcttGGAC ATCGTGATATCGTCTAAAATACTTTTAGTACCACAGGTGTTATAAACAAA AGGATAAACATGACATATCACTTTTCAAGTACCTGATTTTATTAAAGATC TATTGTTCGTTTCAGGGTCCTTTTTTACCTACTCAGGAAGTCTACAGAGA GTGTCTTTTTTGAGCACCTCAATTATGTATGTCTGAATTTCATAGCCATA AGACTGACTGAAAAGGAAGAAGTATCATTCAAAATACAGGAATGGAACAT AATGTCTATCCCAGTCTGTCATGTTCTATATCACAGATATCATTATATTC TTTTACATACGAGATAGGCTAACTGCGCACAGATTTCCCGTGGAAGTTTG TCCAATTTTGAAGTCGACTAGTCTGCCATATTGTTTTTCCAATTGACCta agattttcgaacgttcgaatttcaaaacattcgaatcgtaCTGTTGACGA CCAGAATTGAAAACGAGATGATGGACTAGTCAGCTCTAAAACTGGACACG CTTCCCATATACGGGTAGCCCGTAGTCAAGTAGTTTGAGATCAGTATCCC AAATCCTTTATCGATTATCATTTTTCCTCTCAGATATCAACGTAACAGTT CCTTATTTCACCAAATCTTCATACATGTCTATGGTACCGCCCGCTGATTT GAGTATCCGAACGAAAACGATCATTTCCGTGCGTTTCAAAGCGGACACTG GGAACGGACTTCTTTTCTATACAGCACATTCGATGGATAGCGGTTCCTTT GGTGATTTCATTGCTGTCAGTATTTGGCAAAGGTGAGCTTAAAAGTCTTC GTGGCATAAATATCTTCTACGtgactattcatgatatgcaccattgaaat gtcttccacggacccaacagctgattggttgaaagtgacgtattgtctga ttttacgtcacttacaaccaatcagttattgggtccgtgatgtaatgtct gAAGACATTGAAGTGGTGCATGTCATGAATAATAATCGTTTCTTCGTGCT TACAAATTGGAGAAATAAGTCGAATCAGGGATAACAATAATGATCGGTAA ATAGCCGTGATTTTAGTTTGGAGATATTTAAGATTTCGAGGTCGCGTGGT CTGCAAGTGTGGGTCCTTTGGTGAGCCGTCAGTATTTGGCAAAGGTGAGA CTTCAAAATCTTGGCGAAACAAATATCTTTTAGGTTATCCTTTTCCGGTC GccaaatcataaataaaaaatacattcaTATACAATGCATTCTGTGCATA TTTCCATCCCAAATTACCACAGATTCGAGATACCAGAAGTTTTTTTGACT AGCATTTTGTTGTTTCTAAAATCCGATAtgcaaaaaataacaaatctaTA GGCggaaagagaattaaaaaatcattatttgtTTAGCCGCTAGCttgcca ataaaatttcaaacaaatacacttttttaataaCAAAGGACTACAataga acataaggctttgatggccaaaatattaagaacaagttaagaatatttag tAAGGCGGACtctgaaaaaacaaatttctaaagaaactgcacaaaaatac tcagaaaaagACGAAAATATGAActcttaagaatatttttaggcttaaaa ctcaaaaagttgagaacggcttcaaaaattttggaggttcttatagaaaa acgtgtatgtgtAGATAGGATATGGTCCAGTTTATTATTAAAATTCACGG CTCCCTTTCATTTTTCCATGTAGATACATTTATGTTAAATTCAACCTTGG CACTCATACAGCCTCGATGCGCAGCCGACAAAAAATCACCTTTCACAAAT GGCATAGCCTGTATATTCGTCGTGAAAACAAAGAAGCTGTAATGAGGCTA GATGGAAATTACTACGTTGGAGTGAAAGCCTCTGGTCCAATGTCGAAACT AGATGTTTCTTCAGACTTCTACCTTGGAGGAGCACCATTACTGTCCAGTA TTCAAAAAGCAGCATTGAAAGACGTACAATCGCAACATGATTTTACTGGA TGTGTAGATTCATTCAaggtacagtagagtctctgtaattcgaactgtCA GGGGGAGCAAATCATTCGAGTAATGGAGACATTCGAATTGTAGAGGTTTG CAAAGTTATCCCTATTATTTGTAATCCAGATTCGAATGGAAACACATGCT CTAGAAACAAGCTCCAATTTAGACGACGTACTTTTcgccctgtctattct aattgtgaattaaagtgggcataaggttggctgtctaaagtcaatgaatt gccctcttttgacgtcaatgcaatgatgtcTTCCGATCTTTCCAATCAAA AAATTAACTGCCCACTTTGTGGCCATTTTTGGCCTACTcttacaattaga ataggcaggacagaaagtcggccgtctaaactagagctaatcGCAAAATG ATTTTACTGGATGTGTAGACTCGTTCAAGGTAGCCTGCTTTTTTATACCG TCGTTTTATGTCGTTTTAAGATTCCAACCCAACTAATTTAATCCCAAATT GAATTTGCGTTTTCACATGAAGATCTctgattttttaaatgaaatccaTG CAAAATTTCTATTGTCAGATTTTCAGCACAAGTACACAAAACACTGTAAA TTAATACTTTTGagtaaaaaatgacattttcaaGGCAATTTTCAACTGGT TTCTTGGTTTACTCAAGAAATTAAATCTTGCGAAAATTAAATACAATCAA AGTAAGATCCCGCTAATTGTCTATGAGATGTCTCCATGCTGACCGgggaa aaaaatggaaaaattgcaTCGAGATTTACTGGAAATAGCTGTGTCCAACT GAGATACTGACCAAATTTCTTAAGTTTATATTGAACTAGCTGGAGTCTTG GTCTTTTTCCGCTGGAAACTGTCCAGTAGGTTTTAGGTGAATCGACGGTA CAGTTTTCGAAGGATCATCGTTATTTTTCACTCTAGATAAATGGCCACCA TTTCGAATTATCATCTTCAATCAAATCAAACAATGGTCGAAATATTCAAG AATGTGGTACGGCATGCTCACAGAATAATTGTCAGAATGGCGCACTATGT TCACCTCTAGCACAAGATTTGAACACAACGGCACCTGAAGACGTCGGTTA CTCTTGTCAATGTCCATTGGGTTTGAGCGGACAACTGTGTGATAAAGGTT TGACACTTAAAAACCATTCACTTTAAaagtgtgcactctttcttTGCTAC CATGTAGAAACCACGTCCAAGGGAATAAGTCTTAAATATGATGACATGGT TTCCATATGCAGAACAAAAATCACAAGGAAAAGTCGAATCCAACCGCTTT AAAGATATCCAATCGCTACCAtatggaaaccactctcaagggaatTACTC TTAATTACGCTGACATGGTTTCCACGTTAAAGCAGAAAATAGTGCACATT TAAAAGGAATACCTTACTTACCCATAACAATCTAAAAGCTTCCTTAACAC TCAAACGcgccaaaaattacaaaaaattggATAGTTCTTAGGTACGGTCA ctttaaaaaagagaaaaactcgAAGCTGGTGCTTTATTAACGAAAGAGTT CTCTCAGGGTCTTTTTTAGCCGGCCAGCTTGGTTTGCCTCTCGAATTATT CAGAAAATTAGATTTATAGTCCCCATCCCCCATCCCATGAAGCATAGATT CTCGTCTATAACTTTGATTTCTATATTTCTATAAAGTAATATAATTCTAT ATATTTTATATaatttctataattttagaaatcACGACGCTTACTAAAGG CAAATTCGCAAACACAAGCTATTGGTACAGTAGACGTTCAAATTTCAGGT AAATTCTTTCTCATGATGgctacagtggagtctctttaacgctagccttt ataactcgaatgtcttcttaacttgaacctctataactcgaatgttttct ttaactcgaacctctataactcgaatgtcatCTTAACTAGTCAAATTGAA ACCTTACCTTCTCCgtcacagaaaaacacacatacataaacttggtaatg tcttccacggacccaacagctgagtggttgcaagtgacgtattgactgat tttacgtcacttacaaccaatcagctattgggtctgtgatgtaatgtcag aggacattgcaatggcgcatatcatgaatacagtaTCTTTTAAGTAAAGT AAATTCCCTCATTCATCCAACACCCTCAAGAGACAAATGAGCCTTTTTGT GCAACATTTCTCTCcttttttaatttcacagcTCGACTTACTACTCTCAC CTGAAGTTGAATTTCCAAACAAGCACGTCGGACGGTCTTTTATTCATGAA CGCGCGGTTAAAAGATGTGAATAGTGATCAACTAATGATTGGCTTAGACG GAGGGAAGTTGAAGATAGTGTTTGTATTGGACAAAATAGTGGCTTTTGCG TACAGTGATTTTTTATATGATGATGGGATAGCTCATAAATTAGTTGTGTC CAGGTAAGCCCTGTTACAGAAGCTCTACTACCTTAAGCgaacttattttg gcaggaGCTAGTTTTGCCGAATTCTGCGAATTTAGATAAAATTCTCCAAA ATTAGTTAccccaaaataagttcccttaaggtatttgaTACACTTCTTTA TTCGTTGAAAATCGAATTccatttgaaaatcgaattcccTTTGCTAtttc tttgtttacaaaagcaatagaatgtgaggtcatatctcgaaacaactttc gatctttcaTTTGCTTGGATGATATCGTTGCGTAAATAAGTAGCATTTAT TTATCTGACTCATCATTGAGACACTATTCATTCTGTGGCTTATTCCTTTC ACCCCCATACAACATCTTTAAGCTTCTGTAACGTTGTTCCTCGAAAAATC GAACTGTGATGTTGGAATTCGCAGTTTGCGACTtaacagtctgttcctct aaagaattccgcattgtaacacgcatgcgtaatttgtcgttctttaaaac catatgtagttaattTCCGTGATAAACAGAGAGGAATGAATACGTAGGGg cggtacagtcactttcggtcggggatTGTGGATGGCGACAtgtgtcgttt tttatgaaattagtcgttcttttttgtcaatttttagtaatgcaggattc tttaaataaacatttttcttaCCGTTTTAGAATTGGTAATATGATTCAAT TCTTTGTCAATGGTCACACTCCAAAAATCATGAGTAATACTCAAATCAAA GAATCTATGACAACAGATGGCCATATTTATATTGGTGAGTTACATTACAT TTTCTATAGCCATTTCACCGTAGAAATCAACGTGCTTGTTCTCTACCATT TAGTGGCTAAACTTTATCATTTCCGGGGAAAACATACCGATAAAGGTAAG TTTCGCTACAAATGCGTAGCCGGCCTCATGGCTGACCGCCTAACAAGTTG AAGCTACAGTTgttgctctctaattcgattttcaaatggaatcggatttt catcaaataaaggAGCGTATCGAAAAgtagtttcttgttgacggtgactc tCTATTATATATTATCTATTatatattatcgaataatggagcgtatcgaa tagtagaacgtcgaattagagaacaTCAACTATACTTTTAAACTTACACA GAGTGTCGGTCTTCTTTCGTTGTATATTTGTAAAATAAGAGAGTTTtacc gggaatgagaaagtttaaCCATCCTATGGTAGTGTGTACAACATGCTACC ATCTCTAAAACGTGTTTATGAAAATCTTTTCGAGAAGCCtttttttcgaa cattttctttttcctaCGTCCTATACGACATTCTATCTAAGAACAGTAAA CGGGCtttcgaattgattttttttttgcttttattccGTGTAACTCACAC GAAAAAGTATCAACAAGCAAATAAACtctgatggtttgagacagcgCACA TTAATATATTATCCAATCAGAGGGTTTGAACATTTTCTCGTGCCACATAC ACTGAATCAAAACATAGACCTTATTCGAAACCAGTGTATTGTATAGTTTT TCAACAACAGCCTTACACTTACTGTTTCTTATAACAGCGACAATTTCAAT ATCCATTCCATAGGTGGTCTACCATCGGATGTCCGAAAATTAACCAAAAC TCATTTTATGTCCGGATTTAATGGTTGTATTTCTGAAGTCGAGTTTAACG AGGAGAAATCAGTAATTGATTTTGCATCAAGATCGAATAGCGTGGGAAGG AACATTGGTCAATGCATatgaaaattttggatatttatAGTGAGTGTTAA GAATCTTGCAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045748XLOC_045748Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073672-exon-scaffold_97-1491911889:661323..661352TCONS_00073672-exon-scaffold_97-1491911889:661323..661352Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:661323..661352TCONS_00073672-exon-scaffold_97-1510915933:661323..661352Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:661323..661352TCONS_00073672-exon-scaffold_97-1575043694:661323..661352Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:662706..662904TCONS_00073672-exon-scaffold_97-1491911889:662706..662904Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:662706..662904TCONS_00073672-exon-scaffold_97-1510915933:662706..662904Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:662706..662904TCONS_00073672-exon-scaffold_97-1575043694:662706..662904Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:663846..664140TCONS_00073672-exon-scaffold_97-1491911889:663846..664140Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:663846..664140TCONS_00073672-exon-scaffold_97-1510915933:663846..664140Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:663846..664140TCONS_00073672-exon-scaffold_97-1575043694:663846..664140Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:665059..665269TCONS_00073672-exon-scaffold_97-1491911889:665059..665269Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:665059..665269TCONS_00073672-exon-scaffold_97-1510915933:665059..665269Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:665059..665269TCONS_00073672-exon-scaffold_97-1575043694:665059..665269Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:665851..665920TCONS_00073672-exon-scaffold_97-1491911889:665851..665920Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:665851..665920TCONS_00073672-exon-scaffold_97-1510915933:665851..665920Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:665851..665920TCONS_00073672-exon-scaffold_97-1575043694:665851..665920Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:666354..666575TCONS_00073672-exon-scaffold_97-1491911889:666354..666575Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:666354..666575TCONS_00073672-exon-scaffold_97-1510915933:666354..666575Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:666354..666575TCONS_00073672-exon-scaffold_97-1575043694:666354..666575Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:667253..667356TCONS_00073672-exon-scaffold_97-1491911889:667253..667356Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:667253..667356TCONS_00073672-exon-scaffold_97-1510915933:667253..667356Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:667253..667356TCONS_00073672-exon-scaffold_97-1575043694:667253..667356Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1491911889:668186..668383TCONS_00073672-exon-scaffold_97-1491911889:668186..668383Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1510915933:668186..668383TCONS_00073672-exon-scaffold_97-1510915933:668186..668383Clytia hemisphaericaexon
TCONS_00073672-exon-scaffold_97-1575043694:668186..668383TCONS_00073672-exon-scaffold_97-1575043694:668186..668383Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_97supercontigscaffold_97:661323..668383 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.447311 0.173169 2.02588 1.95117 2.61225 1.60597 2.14486 1.7706e-09 0 0.343664 0 0 0.910353 0 0.277981 0.04387 0.363898 0 0.301015 0.481562 0.335037 0.798538 0.928904 1.07365 0.070081 0 0.930559 0 0.282333 0.356039
Blast
BLAST of TCONS_00073672 vs. Swiss-Prot (Human)
Match: EYS (Protein eyes shut homolog OS=Homo sapiens GN=EYS PE=1 SV=5)

HSP 1 Score: 145.206 bits (365), Expect = 1.438e-36
Identity = 123/449 (27.39%), Postives = 212/449 (47.22%), Query Frame = 3
Query:   24 EQDINVTVPYFTKSSYMSMVPPADLSIRTKTIISVRFKADTGNGLLFYTAHSMDSGSFGDFIAVSIWQRYIYVKFNLGTHTASMRSRQKITFH--KWHSLYIRRENKEAVMRLDGNYYVGVKASGPMSKLDVSSDFYLGGAPLLSSIQKAALKDVQSQHDFTGCVDSFKINGHHFELSSSIKSNNGRNIQEC-GTACSQNNCQNGALCS-----------------------------PLAQDLNTTAPEDVGYSCQCPLGLSGQLCDKEITTLTKGKFANTSYWYSRRSNF--SSTYYSHLKLNFQTSTSDGLLFMNARLKDVNSDQLMIGLDGGKLKIVFVL-DKI-VAFAYSDFLYDDGIAHKLVVSRIGNMIQFFVNGHTPKIMSNTQIKE-----SMTTDGHIYIGGLP--SDVRKLTKTHFMSGFNGCISEVEFNEEKSVIDF 1241
            ++ ++++ P F +S+ +S +  A   +R KT I ++F+    +G+LFY A  + + S GDF+ +S+    + +++NLG  T  + + QK+T +   WH +   R   E  + LDG   V  KAS  MS LD ++DFY+GG   L+ +   A+++      F GC+    IN    +L +   +  G N+ +C GTAC  N C+NG  C+                              L Q L     +   YSC C LG  G+ C+ + T+ +  KF   SY      N+   +  ++ + LNF T+ ++GL+      ++  +D L IGL    LKI   L ++I V  +Y++  +     H +VV +   +I+ ++N     ++ +  I       ++  DG  Y+GG      V  +T+  F + F G I +V F +E   I+ 
Sbjct: 2710 KEALSISDPSF-RSNELSWMSFASFHVRKKTHIQLQFQPLAADGILFYAAQHLKAQS-GDFLCISLVNSSVQLRYNLGDRTIILETLQKVTINGSTWHIIKAGRVGAEGYLDLDG-INVTEKASTKMSSLDTNTDFYIGGVSSLNLVNPMAIEN--EPVGFQGCIRQVIINNQELQL-TEFGAKGGSNVGDCDGTACGYNTCRNGGECTVNGTTFSCRCLPDWAGNTCNQSVSCLNNLCLHQSL-CIPDQSFSYSCLCTLGWVGRYCENK-TSFSTAKFMGNSYIKYIDPNYRMRNLQFTTISLNFSTTKTEGLIVWMGIAQNEENDFLAIGLHNQTLKIAVNLGERISVPMSYNNGTFCCNKWHHVVVIQNQTLIKAYINN---SLILSEDIDPHKNFVALNYDGICYLGGFEYGRKVNIVTQEIFKTNFVGKIKDVVFFQEPKNIEL 3147          

HSP 2 Score: 102.064 bits (253), Expect = 7.961e-23
Identity = 116/502 (23.11%), Postives = 212/502 (42.23%), Query Frame = 3
Query:    3 GKHGYICEQDINVTVPYFTKS------SYMSMVPPADLSIRTKTIISVRFKADTG---NGLLFYTAHSMDSGSFGDFIAVSIWQRYIYVKFNLGTHTASMRSRQKITFHKWHSLYIRRENKEAVMRLDGNYYVGVKASGPMSKLDVSSDFYLGGAPLLSSIQKAALKD-VQSQHDFTGCVDSFKI----NGHHFELSSSI-KSNNGRNIQEC-GTACSQNNCQNGALC-----------------SPLAQDLNTTAPE----------------DVGYSCQCPLGLSGQLCD--------------------KEITTLTKGKFANTSYWYSRRSNFSSTYYSHLKLNFQTSTSDGLLFMNAR-LKDVNSDQLMIGLDGGKLKIVFVL--DKIVAFAYSDFLYDDGIAHKLVVSRIGNMIQFFVNGHTPKIMSNTQIKESMTTDGHIYIGGLPS--DVRKLTKTHFMSGFNGCISEVEF-NEEKSVIDFASRSNSVGRNIGQC 1283
            G+ G +C   IN+T P F+ +      S+++    +D+S   +  +  +   +     N L+F+T       +  DF+AV +    +   +NLG+  AS+RS         H++++ +  +E  +++D +    + A G +  L+V S FY+GG    S      L +    ++ F GC+ + ++    +GH   L +     N GR++ +C  + CS   C NG  C                 S   + ++T  PE                  GY+C CPLG +G  C+                    KE  +++   F +    +   ++F     +H++L FQ   +DG+LF  A+ LK  + D L I L    +++ + L    I+         +    H +   R+G      ++G      ++T++  S+ T+   YIGG+ S   V  +   +   GF GCI +V   N+E  + +F ++    G N+G C
Sbjct: 2401 GRSGPLCTDAINITQPRFSGTDAFGYTSFLAYSRISDISFHYEFHLKFQLANNHSALQNNLIFFTGQKGHGLNGDDFLAVGLLNGSVVYSYNLGSGIASIRSEPLNLSLGVHTVHLGKFFQEGWLKVDDHKNKSIIAPGRLVGLNVFSQFYVGG---YSEYTPDLLPNGADFKNGFQGCIFTLQVRTEKDGHFRGLGNPEGHPNAGRSVGQCHASPCSLMKCGNGGTCIESGTSVYCNCTTGWKGSFCTETVSTCDPEHDPPHHCSRGATCISLPHGYTCFCPLGTTGIYCEQALILIVILEKPKPAERKVKKEALSISDPSFRSNELSWMSFASFHVRKKTHIQLQFQPLAADGILFYAAQHLKAQSGDFLCISLVNSSVQLRYNLGDRTIILETLQKVTINGSTWHIIKAGRVGAEGYLDLDGINVTEKASTKMS-SLDTNTDFYIGGVSSLNLVNPMAIENEPVGFQGCIRQVIINNQELQLTEFGAKG---GSNVGDC 2895          
The following BLAST results are available for this feature:
BLAST of TCONS_00073672 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 1
Match NameE-valueIdentityDescription
EYS1.438e-3627.39Protein eyes shut homolog OS=Homo sapiens GN=EYS P... [more]
back to top