Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073536 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073536
Unique NameTCONS_00073536
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length663

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073536 ID=TCONS_00073536|Name=TCONS_00073536|organism=Clytia hemisphaerica|type=transcript|length=663bp
TACAATTCCTCCTCAGGGTTGTCAAAGTCAGGTTTTCCACCACTGACACC
AGGTGCACAGCGGTGAGCCAAGTTCCGCAAGTCAACAAATCCTTTCACTT
GCACACCATGTAAACGAAGCCTTCTCACATCCTCCTCAATGCCAACACCA
AACTTCAACACTTTCCGATCTTCCAataatttcttcaaattttgcgggAT
ATGTCCTTGTGTTTGGCATGTTCTGTATAAAATACAATCATTACCAGATG
AGATTTGTAGCAAAGCGATGCCATCCTTTTTGCGTGACTCCCATTCACAG
TCCAGACCAATAAAATGGACAGGTCTTCCAGGCTGTAACATTTGTTGATC
AACAAGTCGATTGCATAATTCTTCATCATTAATAACATAAACTTTCACTT
TCTCAAATGCAGATTTCACATGGGCCGCAACAAATTGACGTTGCTGTAAC
CATTTTATTGAAGCTGACGGGCCAgtagtttttctttgaaatataCGCCT
TGCATACGGCAAAAGGAAGGATATCATGTCCTTCAGCATAAGTGATACGA
TGATTCCTATATGTTCATCTGGATGGTGCACTAAAGTTGATTTCCCCAAT
AAATTCCCCATGATGAGCAGTCACAGACATGTTATTTTTCTATCTTTGTT
AACTCACTATAAA
Run BLAST on NCBI

transcript from alignment at scaffold_94:460238..460992+

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073536 ID=TCONS_00073536|Name=TCONS_00073536|organism=Clytia hemisphaerica|type=transcript|length=755bp|location=Sequence derived from alignment at scaffold_94:460238..460992+ (Clytia hemisphaerica)
TACAATTCCTCCTCAGGGTTGTCAAAGTCAGGTTTTCCACCACTGACACC AGGTGCACAGCGGTGAGCCAAGTTCCGCAAGTCAACAAATCCTTTCACTT GCACACCATGTAAACGAAGCCTTCNTTTCCACCACTGACACCAGGTGCAC AGCGGTGAGCCAAGTTCCGCAAGTCAACAAATCCTTTCACTTGCACACCA TGTAAACGAAGCCTTCTCACATCCTCCTCAATGCCAACACCAAACTTCAA CACTTTCCGATCTTCCAataatttcttcaaattttgcgggATATGTCCTT GTGTTTGGCATGTTCTGTATAAAATACAATCATTACCAGATGAGATTTGT AGCAAAGCGATGCCATCCTTTTTGCGTGACTCCCATTCACAGTCCAGACC AATAAAATGGACAGGTCTTCCAGGCTGTAACATTTGTTGATCAACAAGTC GATTGCATAATTCTTCATCATTAATAACATAAACTTTCACTTTCTCAAAT GCAGATTTCACATGGGCCGCAACAAATTGACGTTGCTGTAACCATTTTAT TGAAGCTGACGGGCCAgtagtttttctttgaaatataCGCCTTGCATACG GCAAAAGGAAGGATATCATGTCCTTCAGCATAAGTGATACGATGATTCCT ATATGTTCATCTGGATGGTGCACTAAAGTTGATTTCCCCAATAAATTCCC CATGATGAGCAGTCACAGACATGTTATTTTTCTATCTTTGTTAACTCACT ATAAA
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045642XLOC_045642Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073536-exon-scaffold_94-1491911889:460238..460289TCONS_00073536-exon-scaffold_94-1491911889:460238..460289Clytia hemisphaericaexon
TCONS_00073536-exon-scaffold_94-1510915933:460238..460289TCONS_00073536-exon-scaffold_94-1510915933:460238..460289Clytia hemisphaericaexon
TCONS_00073536-exon-scaffold_94-1575043694:460238..460289TCONS_00073536-exon-scaffold_94-1575043694:460238..460289Clytia hemisphaericaexon
TCONS_00073536-exon-scaffold_94-1491911889:460382..460992TCONS_00073536-exon-scaffold_94-1491911889:460382..460992Clytia hemisphaericaexon
TCONS_00073536-exon-scaffold_94-1510915933:460382..460992TCONS_00073536-exon-scaffold_94-1510915933:460382..460992Clytia hemisphaericaexon
TCONS_00073536-exon-scaffold_94-1575043694:460382..460992TCONS_00073536-exon-scaffold_94-1575043694:460382..460992Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_94supercontigscaffold_94:460238..460992 +
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
19.3253 18.3802 6.08096 3.98585 11.9615 10.6095 9.21333 7.84997 10.1396 11.3184 10.0619 8.08989 10.0181 9.74613 11.3311 12.1296 10.4064 14.8478 2.24666 3.76945 12.7198 10.7311 24.7513 24.9227 4.14736 4.80419 2.17896 3.52358 14.875 16.9382
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: INTERPRO
TermDefinition
IPR0025623'-5'_exonuclease_dom
IPR012337RNaseH-like_dom
Vocabulary: Biological Process
TermDefinition
GO:0006139nucleobase-containing compound metabolic process
Vocabulary: Molecular Function
TermDefinition
GO:00084083'-5' exonuclease activity
GO:0003676nucleic acid binding
GO Annotation
GO Assignments
This transcript is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0006139 nucleobase-containing compound metabolic process
molecular_function GO:0008408 3'-5' exonuclease activity
molecular_function GO:0003676 nucleic acid binding
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073536 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top