Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073467 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073467
Unique NameTCONS_00073467
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length1363

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073467 ID=TCONS_00073467|Name=TCONS_00073467|organism=Clytia hemisphaerica|type=transcript|length=1363bp
CATCTCGTCGATCTTTTAATAACACTCCTGTACTGTCATTCAGCAGTGAT
GATTGGTTCCAAATTGTACATTTTCGGTGGCTGGGATGCGCCGACCTGTC
ATGATGATATCTATTGTCTCGATATAGTCATAATGAAGTATACGAGATTG
AAACCTATTGGTGAAGGTCCGTCTGCCCGTACTTGGCATTCCACCTCTGT
TCTATCAAATCCAAATCAATTTTGTATTTATGGTGGCTTCGATGGCAACG
ACAGTTTGAATGATCTTTTTGTTTTCGATTCAGTCAAAACGTGTTGGAGC
AAGATACATAACGAGCATAATTCCATTTTACGTGCTGGTCATACATCACT
GTTGATGACGTCACCATATAgtgatgatgacgtcacaaaagcCAACAACA
AAAGTCAGGTGTTAATTTTCGGAGGCGGTGATAACGCCGGACAATTTTAT
AACGATGTCATTCTACTGGATGTGAAATAGCAAAAGTGTCGTTTACTATA
TTTCgtgttttttaatattttttttttggtatttttatttaGTATGATTC
TTATGTTTATCTCTTTTAGGCGAGATTAGGTAAAGAATATTATCATTTAA
GATTCTCCATATTTGTGGTAGTGTATATAgaattaaagggacataaaagt
actgacgaaattagtaaacaaaccatatgtggcgggatacaaaatcaaaa
caaatgtcacatgtcaaaatcaaaaatcaaaaNNNNNNNNNNNNNNNNNN
Naaaatcaaaacaaatgtcacatgtcaaaatcaaaaatcaaaacaaatat
ggctgattttgattgtttcaattgttttacaagtttgttttggacacgtg
attttaattgttttctttaatgacacgtggtttgtgcaatgtttacattt
tactacttttatgtccctttaagcagGCAGCAATTATGTGTGATTTCAGG
AGTTCTATATGTGCTTTAACCTCCTTTCAGAGAGATGAGTTAAATAccga
aattcatgatattcatgacgtaatgttttctacggaaagaccccggtttt
tgccagtagtggcacttttttacaccttttgtctagtttataagtgccac
tactggctaaaaccgaggtatttccgtagaaaacattacgtcatgactAT
CAAGAAATTAATTCGTAAATGCATGCTCCTCCCATGCTCCTCTGATCTTA
CGCGAATTGTATTCACGAATTTTGAATTGAATGAACATTACttgcaaatt
tcttttcatatttTAATATATATTAAAACTTTAAATCCGAATGTGGTTTT
AGAATGATCCAAAATTACTTATACTTTGTATGACGTCCTGTTGTTATCTA
TTCATTATTTAAT
Run BLAST on NCBI

transcript from alignment at scaffold_92:259747..264699-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073467 ID=TCONS_00073467|Name=TCONS_00073467|organism=Clytia hemisphaerica|type=transcript|length=4953bp|location=Sequence derived from alignment at scaffold_92:259747..264699- (Clytia hemisphaerica)
CATCTCGTCGATCTTTTAATAACACTCCTGTACTGGTAAGAATGGAATTG TCTTTCATATGTGGGAATTCAGATTCTACCGTGGCTGATCTGGTATTTCG AGGTTTTTGGTTATTTTGCTTTCGGCAGCCGCCTTTTTAAGAGGCGACCG CCAGTTTTAATCCGCGGCCGCCTTTTACAAAGAGCGGCTGCCTATAATAC TGGCGGCCGCCTTTTATGATAAGCGGCCACCTTTTTCCTTCGAAGAAGGA GGCCGCCCTTTATTACGATGGCCCCTAAGGCTCACCACGCACTTCCAGTT CTTATAAAATTTGTGAACTAGAACTGTCTAGGGTCATGGCCCAGAAGGCT CACAAGACACTGCGCACTTCCGAGTTTTTTTGTGACGACATTGCACACTT CTAAAAATATTTTAGAAACGTAAAAGTCCCCCTCGAAAGATAGCCGTTCT GGTCAGCAAAATAGATACCGAGTTGTAATAAGTGAGTTGATGATAATAGC GAAGAGGCTCGGAAATCCCGAGTTATTTTCTTGAGTTCAAAAGCCGAGTT AGTTACGAAAAACCGAGTTATGACGTTATTTTTCGGAAATTTCGACGTCA TTTTGTACCTTCTATATGACGTCATTCTCAATTCTGTAGCTCGTTTTTTT TCCTTGCCTTTAAAATTTCGAGTTATCTCTGATGGTATCTAAACTCAAGT AAGTCCTGCCTTTAAATTTTCGAGTCATTTCTCGTTTTTTAACTCGGTTT TGTTTCTTTTAAATTTTCGAGTTATTTTCCTTCCTGTACATTCTCGGATT CTCGAATTATTTTCACAGCAGAAGGCTCAAAACACACACACACACACACA CTTCTAGTTTTCATGCACTTAGGGTGGTCCTATGGCGGAAAATACCAGCG GCGTGGAGGCAAAAAAACAAAGTTGATATTTGCTCACTTTTTGCTTCCCA GATTTTTGCCACTGGGGGGAATTTTGCAGACCAGGACTTAACTCAGAAAT TTTAACCTGTAACTCTTGATATGAGCAACTCGGAAATTTTAACTCATTTT GCGTAACTCGACATTCATTTTATAGACCAAAAAAAAAATTGATCGCGCGG GCCGCTCGCTTGGAAATTTCCCGCCCTGACAAAAAGTCAGAAGTGCGCAG TGTCACTTGAGCCTTCTGGGCCATTGACCATAGGCAGTTCTAGTTCACAA ATTTTATAAGAACTGGAAGTGCGTAAAAACTAGAAGTGCGTGTTTTGAGC CTTCTGGGCCATCGTACTAACGGATATAAGGTTGGTTCTTTCCGGACATC TCAGCAAACCTTTGATAGCTGGTTTGCTATGAAGCCGCTGATATCGTTGT GCCTCATTGATACGAAACCACCTTTTTTGCACGTCAGGGCATATTCGAGC GAGAACGGAGTTCCACATTTGCAATGGGAAGGTGTACGCTGTGTAATGCC CACCCGTAACGGATTCTGATTAGGTCAACGAAACATTGCTTGTTGAGAAT GTATCCTTCGTTTTGAACAGGCAAAGTCGTGAGCCATGCTTAGGCTCTGT GTTGTCGATTGAGCTCCATCAGCTGGACTTGATTTCTTTGGAGAGTCAGG TCGTTGTGAGGTGAAGAACGATGTTGCTATTTCGTTCCCTCTTTTCATTC TTGATTTTCTTTGTAGGCAGGCGAGGATCAAGTTTATATGCATATTCTTG GCTTACGATTGTCTCGGATAGATTGGATGTGATGAGTAGTAGTAGTNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATG TCAAAAAGTGTGTCAAAATCTAGCTAAAAGCATAACACGCACTGCACACA GAGCTTTTTAATAGAGTGCTCATTTCAATAGGAAAACAATGGTTGTTCTC TTGAGAGAAGTGCCTTCTAGAGGTAGTTGGTTATCTATTATTTTTACATC GTTGATCTATCTTTGTAGTCATTCAGCAGTGATGATTGGTTCCAAATTGT ACATTTTCGGTGGCTGGGATGCGCCGACCTGTCATGATGATATCTATTGT CTCGATATAGGTAAATTACAACATTTGTATATCCTTTCAACTCGTATCAT TGTTTTCCTTCGGAGACAAATTTCCATTCATTTTCACCGCCTATGGAATA ACAATAGGATCCCAAAAGAAAATCATCTCAACTGAAAAGACAACTAAAAA AACTTGTCTTTTAAACTTGTTGGCTATCGAAAAAGATCTTCAATTCATTA TATGCACCACTGCAATGACTTCACGAAATTATGCAACTTTTCTGTTTTTG TTCCACCCAATACGTCACTTTTTCTATTCTTAAAGTGACATATTGGATGG AAAATCTTAAAAGTTCTCAGAAGACTCTTCAGTGGTGCAAATCATGAATA TTTTAATAGAGTAGATATTCAATACTTTTATGCAATAAGTTCCATATTTT AATGCAAGATCATTTTAAAGCCAAGTATTTCTTCCCAGCGACGACTTTAC TAAACAACCACTTTAGTTTGGTCAAATTTAATCGTTTTAACTTTAACTTT CTCTTCATAGTCATAATGAAGTATACGAGATTGAAACCTATTGGTGAAGG TCCGTCTGCCCGTACTTGGCATTCCACCTCTGTTCTATCAAATCCAAATC AATTTTGTATTTATGGTGGCTTCGATGGCAACGACAGTTTGAATGATCTT TTTGTTTTCGATTCAGGTAAACCGTGCCAAAAAAAGGCTAGGAAATTGAG CTTTTTTTTGACAGGAACTCGTCTTTTTTTACAAGGGAAAACACGTACTC AGGACTCGGGGTTCTGAGGCTGTTTGACTTTAGTCTTCTTTACCTGACTA TACCAAATTTATTTTGTGTTATTAATTTCGCATTGCGAAAGTATTACGAT AGCCTTTCGCGGCGGCGGTGTCCTCGGAAAAAAAATTAGAAAACGAAAGT GCTTGATACGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTTTGTTTTGAGA TTACTTCTTTTCTTCTGTTTTAGTCAAAACGTGTTGGAGCAAGATACATA ACGAGCATAATTCCATTTTACGTGCTGGTCATACATCACTGTTGATGACG TCACCATATAGTGATGATGACGTCACAAAAGCCAACAACAAAAGTCAGGT GTTAATTTTCGGAGGCGGTGATAACGCCGGACAATTTTATAACGATGTCA TTCTACTGGATGTGAAATAGCAAAAGTGTCGTTTACTATATTTCGTGTTT TTTAATATTTTTTTTTTGGTATTTTTATTTAGTATGATTCTTATGTTTAT CTCTTTTAGGCGAGATTAGGTAAAGAATATTATCATTTAAGATTCTCCAT ATTTGTGGTAGTGTATATAGAATTAAAGGGACATAAAAGTACTGACGAAA TTAGTAAACAAACCATATGTGGCGGGATACAAAATCAAAACAAATGTCAC ATGTCAAAATCAAAAATCAAAANNNNNNNNNNNNNNNNNNNAAAATCAAA ACAAATGTCACATGTCAAAATCAAAAATCAAAACAAATATGGCTGATTTT GATTGTTTCAATTGTTTTACAAGTTTGTTTTGGACACGTGATTTTAATTG TTTTCTTTAATGACACGTGGTTTGTGCAATGTTTACATTTTACTACTTTT ATGTCCCTTTAAGCAGGCAGCAATTATGTGTGATTTCAGGAGTTCTATAT GTGCTTTAACCTCCTTTCAGAGAGATGAGTTAAATACCGAAATTCATGAT ATTCATGACGTAATGTTTTCTACGGAAAGACCCCGGTTTTTGCCAGTAGT GGCACTTTTTTACACCTTTTGTCTAGTTTATAAGTGCCACTACTGGCTAA AACCGAGGTATTTCCGTAGAAAACATTACGTCATGACTATCAAGAAATTA ATTCGTAAATGCATGCTCCTCCCATGCTCCTCTGATCTTACGCGAATTGT ATTCACGAATTTTGAATTGAATGAACATTACTTGCAAATTTCTTTTCATA TTTTAATATATATTAAAACTTTAAATCCGAATGTGGTTTTAGAATGATCC AAAATTACTTATACTTTGTATGACGTCCTGTTGTTATCTATTCATTATTT AAT
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045598XLOC_045598Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073467-exon-scaffold_92-1575043694:264665..264699TCONS_00073467-exon-scaffold_92-1575043694:264665..264699Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1575043694:261840..261931TCONS_00073467-exon-scaffold_92-1575043694:261840..261931Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1575043694:261184..261339TCONS_00073467-exon-scaffold_92-1575043694:261184..261339Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1575043694:259747..260826TCONS_00073467-exon-scaffold_92-1575043694:259747..260826Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1510915933:264665..264699TCONS_00073467-exon-scaffold_92-1510915933:264665..264699Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1510915933:261840..261931TCONS_00073467-exon-scaffold_92-1510915933:261840..261931Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1510915933:261184..261339TCONS_00073467-exon-scaffold_92-1510915933:261184..261339Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1510915933:259747..260826TCONS_00073467-exon-scaffold_92-1510915933:259747..260826Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1491911889:264665..264699TCONS_00073467-exon-scaffold_92-1491911889:264665..264699Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1491911889:261840..261931TCONS_00073467-exon-scaffold_92-1491911889:261840..261931Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1491911889:261184..261339TCONS_00073467-exon-scaffold_92-1491911889:261184..261339Clytia hemisphaericaexon
TCONS_00073467-exon-scaffold_92-1491911889:259747..260826TCONS_00073467-exon-scaffold_92-1491911889:259747..260826Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_92supercontigscaffold_92:259747..264699 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
3.75666 2.93694 0.890387 2.69954 1.41911 1.71712 1.68216 1.56294 1.71787 1.24379 0.32609 0.463805 0.123682 0.561091 1.2522 0.849559 0.513194 2.25155 1.26776 0.625758 1.45907 1.0307 1.25274 1.43022 5.65068e-05 0.0196989 1.25735 0.205224 1.95697 1.0058
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073467 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top