Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073457 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073457
Unique NameTCONS_00073457
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length219

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073457 ID=TCONS_00073457|Name=TCONS_00073457|organism=Clytia hemisphaerica|type=transcript|length=219bp
TGTAAATATAATTcggataaaatcaaagaatgaatgactaatttttcata
ggAATGTTTGATGATCAAATGTACTCTACAACATTGGGGAACGCATTGAG
CGCAGTCATCTaaTTGCTGATAGTGAAAGAACATTGACTGAGAGTGAAAG
AACATTGACAGCATTAAACTTGTCAACACATGATGAAGGAAAAATGAGTG
GGTTTTTACAGAAATGGNN
Run BLAST on NCBI

transcript from alignment at scaffold_92:66948..67522-

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073457 ID=TCONS_00073457|Name=TCONS_00073457|organism=Clytia hemisphaerica|type=transcript|length=575bp|location=Sequence derived from alignment at scaffold_92:66948..67522- (Clytia hemisphaerica)
TGTAAATATAATTCGGATAAAATCAAAGAATGAATGACTAATTTTTCATA GGAATGTTTGATGATCAAATGTACTCTACAACATTGGGGAACGCATTGAG CGCAGTCATCTGTGAGTATAACCTTTTTAAACTGAAATTCTATTACTACA CATTTTAATGGAACTGCTGTAAACAACGTCACTTCTCAGAGCTAAATGAA TTAAAACATTTTTCTAGCTATTTTCATTGAAAAGTATGAATTCTGGCCCA AATACTTTTAAAAGGCTTTTTCGTGAAGGTGAATGCCTTTTTATTATATT AAGAATTCTTAACAAATTGCAAGAGTTTATGCTTGTATTTACACATTCAA ATTTTTTTTAAATTTGAAAATCTTTGAAGCTGTGAAATCAAAATTTAAAA TGTCCCTAGTAGTAAAATCAATCATATTGCCTTAATTTTAAGACTGACAT TTTTAAACATTTTTTAGAATTGCTGATAGTGAAAGAACATTGACTGAGAG TGAAAGAACATTGACAGCATTAAACTTGTCAACACATGATGAAGGAAAAA TGAGTGGGTTTTTACAGAAATGGNN
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045592XLOC_045592Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073457-exon-scaffold_92-1575043694:67412..67522TCONS_00073457-exon-scaffold_92-1575043694:67412..67522Clytia hemisphaericaexon
TCONS_00073457-exon-scaffold_92-1575043694:66948..67055TCONS_00073457-exon-scaffold_92-1575043694:66948..67055Clytia hemisphaericaexon
TCONS_00073457-exon-scaffold_92-1510915933:67412..67522TCONS_00073457-exon-scaffold_92-1510915933:67412..67522Clytia hemisphaericaexon
TCONS_00073457-exon-scaffold_92-1510915933:66948..67055TCONS_00073457-exon-scaffold_92-1510915933:66948..67055Clytia hemisphaericaexon
TCONS_00073457-exon-scaffold_92-1491911889:67412..67522TCONS_00073457-exon-scaffold_92-1491911889:67412..67522Clytia hemisphaericaexon
TCONS_00073457-exon-scaffold_92-1491911889:66948..67055TCONS_00073457-exon-scaffold_92-1491911889:66948..67055Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_92supercontigscaffold_92:66948..67522 -
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0 0 1.42268 1.39187 6.18391 3.29443 4.84631 3.76928 3.1765 0 2.15495 3.49938 3.86406 0 7.50107 3.94453 4.17751 10.056 2.67139 3.07984 1.79021 0 0 0 7.83405 13.7062 0 0 0 0
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073457 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top