Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073429 (transcript) - C. hemisphaerica

Unique NameTCONS_00073429
OrganismClytia hemisphaerica (Jellyfish)
Sequence length940

The following sequences are available for this feature:

transcript sequence

>TCONS_00073429 ID=TCONS_00073429|Name=TCONS_00073429|organism=Clytia hemisphaerica|type=transcript|length=940bp

transcript from alignment at scaffold_91:206385..207324

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073429 ID=TCONS_00073429|Name=TCONS_00073429|organism=Clytia hemisphaerica|type=transcript|length=940bp|location=Sequence derived from alignment at scaffold_91:206385..207324 (Clytia hemisphaerica)
ttttcaaaatttgaaaagtaaacacaaatcgccattttcaatagacctat ttatttaaacataaaggaattCTTCTTAAACTACGATAAGANCTTTCGCT TATTAAAACAGGTGATTCCTCGAATTCAggattttttcttccattttttc gagtggtcacatcaaaaaatagataaaaatatttgttgttaTGACAACAG CTATATAAGCGGAGGTAAATCATTTGGTGTGACCGCtctctttctgttct aatatataatataatacatAACGAACAAAAAAgctattgaaaaaatatta ttacatCATAAAGATTGTGAAACAACTAGAACATTGCGTGACAATTTTCT TCCTGGTACACCTGTTTaatttaaaaagtgtgaatGTGAAAAAGATTATT TCATCTTCTATCATATATCATGTCTGCTACCAAAAAAGAAAGTCTGGGGC ATACAATAAGTGTATTATTAATTgtttatcaaaaacattcatAGGTTTAT TTATAACTAAGCTTTCAGCAAACAAAAGTAATTTTTATGTACTAGAAAGA GATTAtgtttttttgataaacataatGAAGTGAATAtagaaagactttaa aaaagtgtttattcaGGCGTGTGATCCCACTCATTAAATTACATATACAG ACTGTGTTagattcttttttctctttgcatttcaatttttaagtttcgct taaaaatttttgcttcgcaatttttatctcaaaaaacttttttcttcgcC AAAACCTGAAATTGCTTCGCAATTTGCGAAGTGCgaagctataattcgaa ccctgcacagaaaaatattttcctgtcTTTTCAGACAGATTTTTTAACAA TAGGTCTGAAAATTAGAACaccagaaaaaataaataaacaaaactacatt ttttctttgtaattgagaTTTTTCTGCTCTTTGTGCAAGA
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045573XLOC_045573Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073429-exon-scaffold_91-1491911889:206385..207324TCONS_00073429-exon-scaffold_91-1491911889:206385..207324Clytia hemisphaericaexon
TCONS_00073429-exon-scaffold_91-1510915933:206385..207324TCONS_00073429-exon-scaffold_91-1510915933:206385..207324Clytia hemisphaericaexon
TCONS_00073429-exon-scaffold_91-1575043694:206385..207324TCONS_00073429-exon-scaffold_91-1575043694:206385..207324Clytia hemisphaericaexon
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_91supercontigscaffold_91:206385..207324 .

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.487662 0.592525 0.867582 0.953262 1.56667 0.648884 0.811162 1.63563 0.940653 1.05528 0.8359 1.01331 0.737349 0.871543 0.895831 0.841792 0.546505 0.386913 0.56751 0.652416 2.35353 2.15899 0.459354 0.6188 0.587413 1.06962 2.42116 2.66998 1.44968 2.02808
The following BLAST results are available for this feature:
BLAST of TCONS_00073429 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top