Error message

Warning: shell_exec(): Cannot execute a blank command in include() (line 59 of /var/www/marimba/sites/default/modules/tripal_cvterm/theme/templates/tripal_feature_cvterm.tpl.php).

TCONS_00073276 (transcript) - C. hemisphaerica

Overview
NameTCONS_00073276
Unique NameTCONS_00073276
Typetranscript
OrganismClytia hemisphaerica (Jellyfish)
Sequence length431

Sequence
The following sequences are available for this feature:

transcript sequence

>TCONS_00073276 ID=TCONS_00073276|Name=TCONS_00073276|organism=Clytia hemisphaerica|type=transcript|length=431bp
ctttaaaccttggtctgaacacgaccataaTATGTAtagtaaaaatatta
ttttatcaatttCCTACATTACGTTATTACTTCAAAGAATAATGAGCAGC
ATTAGGATCTGGCAGGAGGTATTCCGTCGAAAACCGTAGCCATCAAGACA
GCCATCAACGAACACGGAGCCCAGCTGAATTTCAACCTCCTTAATGAAGG
TTGACCGTAAAAAATTAACCAACTTAAAAACTTGCTTTAGTGACTTGCTG
TGAAGGTAAAGTACGGCCAACCTCTGTTAAGTTAATGTTTGAATctgtat
atatataaaaaaaaatttaaaatcaaaacaaaacaaaaattttataattt
atgcaatttcagtaaaatttattcaatttaatttaatttattcatgacat
cataatttattttcattagctAATTATTTAT
Run BLAST on NCBI

transcript from alignment at scaffold_89:89356..89786

Legend: exon
Hold the cursor over a type above to highlight its positions in the sequence below.
>TCONS_00073276 ID=TCONS_00073276|Name=TCONS_00073276|organism=Clytia hemisphaerica|type=transcript|length=431bp|location=Sequence derived from alignment at scaffold_89:89356..89786 (Clytia hemisphaerica)
ATAAATAATTagctaatgaaaataaattatgatgtcatgaataaattaaa ttaaattgaataaattttactgaaattgcataaattataaaatttttgtt ttgttttgattttaaatttttttttatatatatacagATTCAAACATTAA CTTAACAGAGGTTGGCCGTACTTTACCTTCACAGCAAGTCACTAAAGCAA GTTTTTAAGTTGGTTAATTTTTTACGGTCAACCTTCATTAAGGAGGTTGA AATTCAGCTGGGCTCCGTGTTCGTTGATGGCTGTCTTGATGGCTACGGTT TTCGACGGAATACCTCCTGCCAGATCCTAATGCTGCTCATTATTCTTTGA AGTAATAACGTAATGTAGGaaattgataaaataatatttttactaTACAT Attatggtcgtgttcagaccaaggtttaaag
Gene-mRNA-Prot
This transcript is a part of the following gene feature(s):
Feature NameUnique NameSpeciesType
XLOC_045459XLOC_045459Clytia hemisphaericagene
The following exon feature(s) are a part of this transcript:
Feature NameUnique NameSpeciesType
TCONS_00073276-exon-scaffold_89-1491911889:89356..89786TCONS_00073276-exon-scaffold_89-1491911889:89356..89786Clytia hemisphaericaexon
TCONS_00073276-exon-scaffold_89-1510915933:89356..89786TCONS_00073276-exon-scaffold_89-1510915933:89356..89786Clytia hemisphaericaexon
TCONS_00073276-exon-scaffold_89-1575043694:89356..89786TCONS_00073276-exon-scaffold_89-1575043694:89356..89786Clytia hemisphaericaexon
Position
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
scaffold_89supercontigscaffold_89:89356..89786 .
Expression

Hover the mouse over a column in the graph to view expression values in transcripts per million (tpm).
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset | Show/Hide Values

Values :
    GrOo_1	 GrOo_2	 FGOo_1	 FGOo_2	 EG_1	 EG_2	 P1_1	 P1_2	 P2_1	 P2_2	 P3_1	 P3_2	 PoPr_1	 PoPr_2	 St_1	 St_2	 GO_1	 GO_2	 PH_1	 PH_2	 BMF_1	 BMF_2	 MMF_1	 MMF_2	 M_1	 M_2	 GEC_1	 GEC_2	 GEN_1	 GEN_2
0.525395 0.535879 0.215215 0.237371 1.25372 0.762421 1.30966 2.9079 0.438143 1.09955 0.898507 2.21714 5.21533 3.09057 75.1893 33.5836 1.62467 1.43466 3.35532 1.06661 0.974088 0.678294 1.66508 1.16611 0.609897 2.00374 0 1.16931 0.695266 0.77395
Blast
The following BLAST results are available for this feature:
BLAST of TCONS_00073276 vs. Swiss-Prot (Human)
Analysis Date: 2017-10-03 (blastx Clytia hemisphaerica v1.0 mRNA vs SwissProt (Homo sapiens))
Total hits: 0
Match NameE-valueIdentityDescription
back to top